Type
stringclasses 4
values | ConceptID
stringlengths 1
31
| mention_counts
stringlengths 7
7.84M
| mention
stringlengths 1
99
⌀ |
|---|---|---|---|
Disease
|
MESH:C531754
|
{'OT': 38, 'Salvia off': 1, 'Cooling off': 1, 'FO': 26, '-off': 288, 'HCO': 4, 'off-trail hiking': 1, 'POS': 29, 'Pinch-off syndrome': 41, 'pinch-off syndrome': 117, 'off': 180, '-off phenomenon': 11, 'SMASh': 2, 'hand offs': 1, 'pinching off syndrome': 3, 'die-off': 51, 'damping-off': 17, 'pinch off syndrome': 11, '-off fractures': 1, 'pinch-off': 25, 'damping-off disease': 49, 'run-off-': 1, '-offs': 18, 'macula off': 5, 'off necrosis': 9, 'OTEs': 30, 'off-flavours': 2, 'off-': 15, 'dry off': 5, 'OLUL': 3, 'OFD': 1, 'SAT': 18, 'POD': 4, 'EXAMPLES OF COTS': 1, '-off necrosis': 45, 'rancid off': 5, 'die-offs': 21, 'falling off': 2, 'OGRES': 1, 'OCD': 1, 'Ridges-off-the-end syndrome': 1, 'NETO': 26, 'DT': 1, 'RG': 1, 'Rheuma off gold': 1, 'cotton seedling damping-off': 1, 'Cotton Seedling Damping-off': 1, 'damping-off diseases': 14, 'CF': 3, 'CLL': 12, 'WTO': 1, 'rancid off-': 5, 'COTS': 33, 'pinch off"': 1, 'step-off deformity': 8, '-off deformity': 2, 'DO': 3, 'off-leash': 2, '-Off': 1, 'FOM': 1, 'CO': 1, '-off-': 5, 'Hands-off-Intervalle': 1, 'HOI': 1, 'OLUL medicine': 1, 'OFC': 1, 'macula-off': 7, 'Off': 9, 'off-road vehicle injuries': 4, 'OSTE': 4, 'ECV': 1, 'CCOs': 1, 'die offs': 3, 'OLMU': 1, 'OTS': 15, 'GT': 1, 'GTs': 1, 'OL': 13, 'MT': 1, 'die off': 5, 'pinch-off"': 2, 'pop-off': 1, 'FOD': 2, 'run-off': 3, 'OLUs': 1, 'pinched-off': 1, 'pinching-off syndrome': 1, 'OCR': 6, 'catheter pinch-off syndrome': 3, 'Catheter pinch-off syndrome': 5, 'PA': 1, 'COI': 10, 'offs': 5, '-off phenomena': 7, 'subclavian pinch-off syndrome': 2, 'Damping off and blight': 1, 'Damping off and blight disease': 1, 'push-off': 1, 'ELO': 2, 'Fall-Off': 2, 'damping-off and wilt diseases': 1, 'damping-off and': 1, 'Diadema die-off': 2, 'OFAP': 2, 'scallop die-offs': 1, 'ROVs': 2, 'PO': 5, 'nocturnal off symptoms': 1, 'LOT-I': 1, 'LOT-II': 1, 'LOT-': 1, 'LOT-I and -II': 1, 'Pinching off syndrome': 1, 'OP': 1, 'MCO': 3, 'POT': 1, 'ROOM': 7, 'DCO': 4, 'VHS': 2, 'OLCM': 1, 'Dysmo-off': 1, 'Kick-off': 1, 't-Branch': 1, 'FOB': 2, 'running-off-road (ROR)': 1, 'ROR': 5, 'CFO': 1, 'C/O': 1, 'Fishy off-flavor': 1, 'pynch-off syndrome': 1, 'OFFs': 1, "off' phenomenon": 1, 'ROV': 2, 'ROV injuries': 1, 'OREs': 1, 'crab die-off': 1, 'RooM': 1, '-ROOM': 1, 'OPC': 1, 'DORK': 1, 'off diseases': 1, 'pinch-off Syndrome': 1, 'fall off': 1, 'ROMA': 1, 'SOTP': 1, 'Damping-off': 5, 'Damping-off disease': 6, 'run-off-road injury': 2, 'off of a cliff': 1, '-off of': 1, 'HOL': 1, 'LLO': 13, 'OLU': 6, "motor 'off": 1, '-off-necrosis': 1, 'Damping-off symptom': 1, 'TC': 1, 'ORS': 4, 'cork off-': 1, 'impairments at SO': 1, 'OCA': 1, 'OOAs': 1, 'AOS': 3, 'Cotton Damping-Off Disease': 1, 'off-resonance blurring': 1, 'off-motor symptoms': 1, 'Macula off': 2, 'Damping-Off Disease': 5, 'KO': 1, 'ORD': 2, 'POP': 2, 'off-field violence': 1, 'IOS': 1, 'Tapering off syndrome': 1, 'off-road vehicle injury': 4, 'muddy off-flavor': 1, 'Buddy off': 1, 'POTS': 2, 'Damping off': 1, 'OS': 5, 'OTs': 3, 'off-balance': 2, 'OGPS': 1, '-off disease': 6, 'OMV': 1, 'NMOS': 1, 'Non-motor off symptoms': 1, 'SFLL': 1, 'bank cordgrass die-off': 1, '-off symptoms': 1, 'Conflict of': 1, 'OLC': 1, 'OFM': 2, 'OFP': 2, 'OGF': 1, 'Rejection and Fall-Off': 1, 'BO': 1, 'off phenomenon': 1, 'NFN': 1, 'mousy off-': 1, 'licorice off': 1, "pinch-off'": 1, 'Sleeping off injury': 1, 'ORVs': 1, 'Drive falls off': 1, 'OTE': 7, 'OL medicine': 1, 'ligamentous avulsion off': 1, 'LOP': 2, 'step off deformity': 1, 'Step off Deformity': 1, 'ESTD': 1, 'CRISOT': 1, 'nocturnal motor off and sensory symptoms': 1, 'off balance': 4, 'KOIS': 1, 'ORV': 1, 'CDO': 1, 'HeTOFLI': 1, '-off symptom': 1, 'SOCS': 3, 'step off or': 1, 'Push-off': 1, 'Sandh-off': 1, 'AO': 1, 'OTC': 1, 'OTM': 1, 'on, Hands off': 1, 'OLB': 1, '- off': 1, 'pop-off syndrome': 1, 'CCOD': 1, '-off deficit': 2, 'EC': 2, 'step-off injuries': 1, 'OD': 1, '-off injuries': 1, 'ECOFFs': 2, 'dry-off': 1, 'Pinch-Off Syndrome': 2, 'MAR': 1, 'MCP': 1, 'ACP': 1, 'pheasantshell die-offs': 1, 'SRWSAm': 1, 'Pinch-off Syndrome': 3, 'ECVs': 1, 'Rheum off Gold': 1, 'damping-off disease of': 1, 'Damping-off diseases': 1, 'OBS': 2, 'SOLVE': 1, 'push-off deficits': 1, 'push-off deficit': 5, 'murre die-off': 1, 'HCO-HD': 1, 'NP-CLL': 1, 'Hands off Trinity': 1, 'off Trinity': 1, 'SORI': 1, 'CBT': 1, 'off-flavour': 3, 'SCXL': 1, 'ACXL': 1, 'freshwater drum die-offs': 1, 'new end take-off': 1, 'Push-off Deficit': 1, '-off syndrome': 1, 'emotional cut-off': 1, 'Off-': 1, 'New-end take off': 1, 'hand-off': 5, 'Hand-off': 3, 'OSS': 1, 'cut off injuries': 1, 'rancid off-flavors': 2, 'RO': 2, 'DTF': 2, 'DO disease': 1, 'avulsion off': 2, 'BOD': 1, 'natural die-off syndrome': 1, 'run-off-road': 1, 'OTOT': 1, 'Hands-off sexual violence': 1, 'Off symptoms': 1, 'off my': 1, 'HOD': 1, 'OPOTTMIS': 1, 'DOC falls': 1, 'OC': 3, 'Off disability': 1, 'OVP': 1, 'immobile (off legs': 1, 'OSLOEs': 1, 'ECOFFS': 1, 'off-track injury': 1, 'HDFI': 1, 'loss off normal functions': 1, '-off necrocisis': 1, 'SAT CURVES': 1, 'loss of push-off strength': 1, 'crap die offs': 1, 'LOL': 2, 'BCO': 1, '-off diseases': 3, 'TI': 1, 'COD': 3, 'UC': 1, 'LC': 1, 'ECOFF': 2, 'SOFA': 2, 'off-flavor disorder': 1, '-Off Distance': 1, 'SOD': 2, 'OTV': 5, '-off lesions': 3, 'OLR': 1, 'turn offs': 1, 'Turn offs': 1, 'SOL': 1, 'off-tumour toxicity': 2, 'KIO': 1, 'fell-off injuries': 1, 'UOL': 1, 'APM': 1, 'OPPs': 1, 'OGPV': 1, 'OC LPN': 2, 'CUT': 2, 'OFE': 1, 'Bi-SAT': 1, 'step-off deformities': 2, 'SWO': 1, 'Damping-off disease of cucumber': 1, 'ORV injury': 2, 'Off-road vehicle injuries': 1, 'ORV injuries': 1, 'off-road vehicle (ORV) injuries': 1, 'off injury': 1, 'off symptom': 1, 'motor off symptoms': 1, 'Off-focus': 1, 'off-focus': 1, 'OH': 1, 'OL-UL': 1, 'NYC': 1, 'RRCT': 1, 'LDVO': 1, 'veer-off': 1, 'VO': 1, 'or cut off': 1, 'CT': 1, 'RA': 1, 'SO': 3, 'ORM': 1, 'on-off': 1, 'Pinch-off-syndrome': 1, 'off-road injury': 1, 'SORI-': 1, 'WTT': 1, 'Off-road injuries': 2, 'beany off': 1, 'ocRAPN': 1, 'ocRPN': 1, 'Tet-Off': 2, 'PSATs': 1, 'foot off': 1, 'aPinch-off syndrome': 1, 'pinch-off syndromea': 1, 'FLoL': 1, 'HC': 1, 'aging off-': 1, 'off-midline': 1, 'Pinch-off" syndrome': 1, 'step-off': 1, 'Keeps off Disease': 1, 'Ridges-off': 1, 'off-balance.a': 1, 'die-Off': 1, 'Damping-off disease of beet': 1, 'blackbird die-off disease': 1, 'Pinch off syndrome': 1, 'rheumatoid off': 1, 'OSC': 1, 'TVM': 1, 'SATOs': 1, 'push-off power deficits': 1, 'ocLPN': 1, 'Chili Damping-Off Disease': 1, 'stripped-off injuries': 1, 'COPs': 1, 'COP': 4, 'OTVs': 1, 'HO': 1, 'CP': 1, 'ORA': 1, 'Off-related problems': 1, 'OTMs': 2, 'off-duty deviance': 1, 'Off-duty deviance': 1, 'ODD': 1, 'SAF': 1, 'manAOS': 1, 'cyclamen damping-off': 1, 'Generalized Fixation-off Sensitivity': 1, 'Mind-off': 1, 'HEROS': 1, 'loss off interest': 1, 'chondral shear-off lesions': 1, 'crocodile die off': 1, 'Damping-off of chilli': 1, 'Catheter Pinch Off Syndrome': 1, '-off and blight diseases': 1, 'falling off stairs': 1, 'FoS': 1, 'Falling off': 1, 'Falling off Stairs': 1, 'run-off-the-road': 1, 'CCM': 1, 'off-target toxicities': 1, 'OLP': 1, 'Damping-off syndrome': 1, 'step-off deformity of the spine': 1, 'inability to shut off mind': 1, 'off sick': 1, 'off-road injuries': 1, 'SRoT.': 1, 'non motor off symptoms': 1, 'WOD': 1, 'Njoro OS': 1, 'Pinch-off Sign': 1, 'off-flavor': 2, 'premature rip off': 1, 'SDR': 1, 'OS-TLSO': 1, 'pinch-off-syndrome': 1, 'ORE': 1, 'fishy off-flavour': 1, 'CBC': 1, 'CTC': 1, 'UCs': 1, 'difficulty getting off to sleep': 1, 'mitochondrial off': 1, 'OTTB': 2, '-Off Lesion': 1, 'damping-off of': 1, '-off and wilt disease': 1, 'off motor symptoms': 1, 'NK': 1, 'Pinch-off': 1, 'Hand offs': 1, 'off druse': 1, 'off deformity': 1, 'TTM': 1, 'Run-off-': 1, 'off concha': 1, 'foot-off': 1, 'off fire': 1, 'Off-Flavor': 1, 'push off deficit': 1, 'blackbird die-off': 1, 'DDF': 1, 'decreased push off power': 1, 'off roadway': 1, 'SATs': 1, 'off-road truck-related injuries': 1, 'EODWO': 1, 'OSCs': 1, 'Push-Off Deficiency': 1, 'Push-off impairment': 1, 'OR': 1, 'HOT': 1, 'end take-off': 1, 'POGs': 1, 'RM-OFF': 1, 'CLO': 1, 'Rancid Off': 1, 'Damping-off Disease': 1, 'MOR': 1, 'EOR': 1}
|
-off
|
Disease
|
MESH:C531755
|
{'oxalic deposits': 1, 'calcium renal deposits': 2, 'oxalate deposition': 3, 'renal oxalate crystal deposition': 3, 'CaOx renal crystal deposition': 1, 'CaOx kidney crystal': 1, 'Renal CaP': 1, 'CaOx renal deposits': 1, 'renal calcium deposition': 10, 'subretinal oxalate deposits': 1, 'oxalate deposits': 4, 'Subretinal oxalate deposits': 1, 'renal crystal calcium deposition': 1, 'renal calcium deposits': 12, 'Calcium infarction of renal tubules': 1, 'deposition of oxalate': 1, 'calcium oxalate kidney': 1, 'Renal oxalate crystal deposit': 1, 'calcium oxalate deposits nephropathy': 1, 'calcium oxalate kidney crystals': 1, 'Renal CaOx crystal deposition': 1, 'Renal calcium deposition': 2, 'Renal oxalate deposition': 2, 'oxalate deposit': 1, 'renal oxalate lithogenesis': 1, 'Renal CaP calcifications': 1, 'renal oxalate': 1, 'Renal oxalate': 1, 'abnormalities of renal calcium deposition': 1, 'renal CaOx deposition': 1, 'renal oxalate accumulation': 1, 'renal oxalate deposits': 1, 'renal phosphate homeostasis disorder': 1, 'renal oxalate deposition': 1, 'renal oxalate deposit': 1, 'OXALATE DEPOSITS': 1, 'rAOC': 1, 'CaOx crystal kidney deposition': 1, 'oxalate depositions': 1, 'Renal calcium deposits': 1}
|
renal calcium deposits
|
Disease
|
MESH:C531760
|
{'naso-oro-ocular clefts': 2, 'oro-facial deformities': 6, 'oro-maxillo-facial malignancies': 1, 'Oro-facial granulomatosis': 13, 'Oro-facial dyskinesia': 5, 'oro-facial dyskinesia': 35, 'oro-facial edema': 8, 'oro-facial dyspraxia': 6, 'oro-dental infection': 5, 'Noma Neonatorum': 4, 'oro-dental problems': 17, 'oro-facial conditions': 5, 'oro-facial abnormalities': 11, 'oro-motor dysfunction': 17, 'vertical oro-ocular facial cleft': 1, 'oro-facial gangrene': 3, 'oro-facial involvement': 2, 'oro-facial inflammatory and neoplastic diseases': 2, 'oro-facial lesions': 25, 'oro-mucosal conditions': 1, 'oro-facial trauma': 22, 'dental and oro-facial trauma': 1, 'Oro-facial injuries': 5, 'oro-facial injuries': 30, 'oro-buccal or limb apraxia': 1, 'oro-temporal cleft': 1, 'oro': 16, 'oro-facial fibrosis': 3, 'Oro-facial fibrosis': 3, 'oro-facial gangrenous infection': 1, 'oro-facial clefts': 67, 'Bola de Oro': 1, 'oro facial injuries': 1, 'noma neonatorum': 9, 'ocular, oro-facial': 2, 'oro-dental injuries': 11, 'oro facial infections': 1, 'oro-dental trauma': 19, 'oro-dental conditions': 1, 'oro-motor dysfunctions': 2, 'oro-facial impairments': 2, 'oro-facial clefting': 16, 'oro-facial congenital anomaly': 1, 'Paranasal (oro-ocular) cleft of the face': 1, 'oro-facial cellulitis': 1, 'oro-maxillo-facial disorders': 1, 'oro-dental condition': 1, 'Oro-facial trauma': 7, 'Oro-facial fascial space infection': 1, 'oro-facial fascial space infection': 1, 'oro-facial granulomatosis': 19, 'OFG': 3, 'oro-facial cleft': 22, 'oro-facial condition': 1, 'Oro-facial lesions': 6, 'hand and oro-facial deformities': 1, 'Oro-cutaneous fistulation complication': 1, 'oro/facial clefting': 2, 'oro-facial tumors': 5, 'Oro-facial clefts': 26, 'oro-': 17, 'oro-mandibulo-facial malformations': 1, 'oro-dental abnormalities': 8, 'oro-facial dyskinesias': 20, 'oro-facial disease': 6, 'oro-facial pigmentation': 1, 'oro-facial TB': 2, 'oro-buccal pigmentation': 1, 'Oro-Buccal Pigmentation': 1, 'Noma neonatorum': 13, 'oro-dental problem': 2, 'oro-buccal apraxia': 2, 'oro-dental infections': 13, 'oro-facial herpes infection': 1, 'oro-sensory disorders': 1, 'dental and oro-facial injury': 1, 'oro-facial cleft deformity': 1, 'Oro-facial malignancies': 1, 'Malignant Oro-facial Tumors': 1, 'oro-facial malignancies': 2, 'oro-facial malignant tumors': 1, 'oro-facial defects': 21, 'oro-facial structural alterations': 1, 'Oro-facial dysfunction': 1, 'Corazon de oro': 1, 'carcinomas of oro- and hypopharynx': 2, 'Oro- and hypopharynx': 1, 'oro-facial malformations': 9, 'oro-facial swelling': 13, 'oro-facial infections': 21, 'oro-facial herpes': 9, 'oro-hypopharynx carcinoma': 1, 'oro-facial sensory loss': 1, 'Oro-facial swelling': 3, 'oral and oro-facial conditions': 1, 'oral and oro-facial disorders': 1, 'oro-facial and dental defects': 1, 'Oro-genital aphthosis': 2, 'Oro-dental injuries': 3, 'abnormal oro-facial movements': 2, 'dyskinetic oro-facial movements': 1, 'oro-facial problems': 3, 'Oro-facial swellings': 1, 'oro-facial swellings': 6, 'BO': 2, 'oral and oro-facial lesions': 3, 'oro-antral defects': 2, 'Oro-motor seizures': 1, 'oro-motor seizures': 1, 'oro-dental pathologies': 2, 'oro-facial impairment': 3, 'reduced oro-facial movements': 1, 'oro-facial and systemic tumors': 1, 'oro-motor deficits': 6, 'oro-facial herpes infections': 1, 'Oro-facial and speech motor control disorders': 1, 'oro-vestibular defect': 1, 'OROs': 2, 'oro-digito-facial syndrome': 1, 'oro-lingual apraxia': 2, 'oro-dento-facial sequelae': 1, 'oral gangrene': 12, 'oro-facial pain7': 1, 'oro-facial': 4, 'Oro-Facial Infections': 2, 'oro-motor disturbances': 2, 'oro-facial movements': 2, 'oro-motor difficulties': 4, 'oro-dental': 1, 'oro-facial weakness': 2, 'oro-facial injury': 8, 'oro-cutaneous disease': 1, 'Oro-facial dyskinesias': 4, 'oro-facial dysfunctions': 5, 'oro-facial hypersensitivity': 1, 'oro-facial oedema': 2, 'asymmetric oro-facial angioedema': 1, 'Asymmetric oro-facial angioedema': 1, 'Oro-Genital Syndrome': 1, 'oral or oro-genital aphthosis': 1, 'oro-facial disorders': 8, 'oro-ocular cleft': 7, 'Oro-Ocular Cleft': 1, 'oro-cervico-facial, thoracic or abdominopelvic disease': 1, 'Oro-facial dysmorphism': 1, 'oro-facial hyperalgesia': 1, 'urinary, bowel and oro-dental problems': 1, 'dental, oral, and oro-facial disorders': 1, 'oro-facial plexiform neurofibromatosis': 1, 'oro-facial candidiasis': 1, 'oro-mucosal and orofacial swellings': 1, 'oro-mucosal and orofacial bleedings': 1, 'oro-facial noma': 2, 'Oro-facial edema': 1, 'oro-facial malignancy': 2, 'oro-facial disfigurement': 1, 'gangrene of the oral tongue': 2, 'Oro-facial noma': 2, 'oro-facial skin lesions': 1, 'oro-facial symptoms': 5, 'dento-oro-facial parafunctions': 1, 'hand and oro-facial cleft': 1, 'oro facial diseases': 1, 'oro-dental anomalies': 13, 'oro-bulbar dysfunction': 1, 'oro-bulbar involvement': 1, 'Oro-bulbar': 1, 'Oro-bulbar Involvement': 1, 'oro-facial dystonia': 6, 'oro-motor disorders': 3, 'oro-facial anomaly': 2, 'Oro-facial Dyskinesia': 1, 'Dental and oro-facial anomalies': 1, 'dental/oro-facial anomalies': 1, 'oro-facial necrotising infection': 1, 'oro-ocular clefts': 5, 'oro-facial stereotypies': 4, 'congenital oro-facial clefts': 1, 'oro-facial hypofunction': 4, 'oro-dental deformities': 1, 'oro-dental malformations': 2, 'oro-motor disorder': 1, 'oro-linguo-facial dyskinesia': 3, 'Oro-dental abnormalities': 3, 'hypofunction of oro-facial muscles': 1, 'oro-digito-facial dysostosis': 1, 'naso/oro/hypopharynxcarcinoma': 1, 'oro-facial apraxia': 2, 'Oro-facial-cervical syndromeBranchio-otic Syndrome 1': 1, 'Oro-faciodigital type VI': 1, 'Oro-palatal dysplasia Bettex-Graf': 1, 'carcinomas of the naso-, oro-, hypopharynx': 1, 'impaired oro-facial function': 1, 'oro-facial discomfort': 1, 'oro-facial tuberculosis': 3, 'Oro-facial gangrene': 2, 'oro-motor deficiencies': 2, 'of the Oro': 1, 'oro-facial infection': 7, 'oral and oro-facial diseases and disorders': 1, 'decreased oro-facial function': 1, 'oro-bucco-lingual syndrome': 1, 'gangrenous infection of the oral cavity': 3, 'oro-genital aphthosis': 2, 'Les fentes oro-faciales': 1, 'malformations oro-faciales d': 1, 'oro faciales': 1, 'oro-hypopharynx': 1, 'Oro-facial': 2, 'carcinomas of the oro-maxillo-facial region': 2, 'congenital malformations of oro-facial region': 1, 'OFCs': 4, 'oro-facial mucocutaneous disease': 1, 'dental and oro-facial abnormalities': 1, 'dento-oro-facial disorders': 1, 'dento-oro-facial problems': 1, 'oro-facial motion impairment': 1, 'oro-myofunctional impairments': 1, 'Oro-facial clefting': 1, 'oro-facial deformity': 3, 'oro-skeletal changes': 1, 'oro-nasal infection': 3, 'Oro and hypopharynx': 1, 'oro-maxillo-facial defects': 2, 'oro-facial movement disorders': 1, 'oro-facial and genital herpes': 2, 'Oro-facial and limb abnormalities': 1, 'limb and oro-facial defects': 1, 'Oro-facial infections': 2, 'Oro': 6, 'Oro-facial conditions': 1, 'Oro-facial Disorder': 1, 'Oro-facial disorder': 1, 'Oro-facial herpes': 1, 'Oro-facial Herpes': 1, 'oro-facial Herpes': 1, 'Oro- Facial Herpes': 1, 'oro-ocular facial cleft': 2, 'Oro-facial cleftsa': 1, 'oro-facial anomalies': 10, 'Congenital deformity of oro-facial region': 1, 'oro-facial disharmony': 2, 'Oro-Facial Cleft': 1, 'Oro-mucosal diseases': 1, 'oro-facial diseases': 7, 'oro-facial childhood disease': 1, 'OMF': 1, 'oro-facial dysplasia': 1, 'El Oro parakeet': 2, 'dental and oro-facial problems': 1, 'oro-facial traumas': 2, 'oro-buccal or limb': 1, 'oro-myofunctional disorders': 2, 'Oro-facial defects': 1, 'oro-facial myofunctional impairments': 1, 'systemic and oro-facial malformation': 1, 'oro-facial and other dyskinesias': 1, 'oro-facial angioedema': 1, 'oro-motor problems': 2, 'Oro-dental infections': 2, 'oro-faciales': 1, 'oro-motor delay': 1, 'Oro-buccal herpes': 1, 'oro-buccal stereotypies': 1, 'Oro-facial and dental injuries': 2, 'oro-facial paraesthesia': 1, 'oro I and II': 1, 'oro-motor disability': 1, 'oro-motor limitations': 1, 'oro-ocular cleft number 5': 1, 'oro-facial-related diseases': 1, 'oro-buccal symptoms': 3, 'genital, ocular and/or oro-facial lesions': 3, 'oro-facial herpes disease': 3, 'oro-facial malocclusions': 1, 'oro-lingual angioedema': 1, 'Oro-facial Clefting': 1, 'Oro-Facial Injuries': 2, 'congenital oro-facial anomaly': 1, 'oral cavity, oro': 1, 'Abnormal oro-buccal functions': 1, 'Oro-buccal symptoms': 1, 'oro-occular cleft': 1, 'type II oro- ocular cleft': 1, 'Oro-dental problems': 1, 'AOFM': 1, 'Congenital oro-motor disorders': 1, 'oro-motor impairment': 4, 'Oro-nasal infection': 2, 'oro-facial incoordination': 1, 'oro-facial motor dysfunction': 1, 'impaired oro-motor functions': 1, 'oro-facial bleeding': 1, 'Oro-facial impairment': 2, 'oro-facial and genital lesions': 1, 'oro-rhinocerebral disease': 2, 'oro-facial-pharyngeal-laryngeal attacks': 1, 'systemic and oro-facial granulomatous disorders': 1, 'oro-facial or facial lesions': 1, 'Oro-motor dysfunction': 2, 'oro-facial lip defects': 1, 'Oro-Facial Edema': 1, 'oro-facial defect': 2, 'Oro-Facial Defect': 1, 'oro-dental ailments': 1, 'oro-dental disorders': 5, 'Oro-facial sarcomas': 1, 'oro-facial sarcomas': 1, 'cardiac, renal and pharyngo-oro-dental abnormalities': 1, 'oro-facial syndromes': 3, 'oro-facial malformation': 3, 'oro-facial dyskinetic movements': 1, 'ONS defects': 1, 'ONS': 1, 'delay in oro-motor function': 1, 'oro-antral perforation': 2, 'Oro-facial cleft': 3, 'nonsyndromic OFC': 1, 'OFC': 1, 'NS OFC': 1, 'corneal, genital and/or oro-facial herpetic disease': 1, 'oro- and hypopharynx': 1, 'oral or oro-facial condition': 1, 'atrophic oro-pharyngopathies': 1, 'involuntary oro-facial movements': 1, 'oro-facial damage': 1, 'oro-gastrointenstinal infections': 1, 'oro-nasalftstula': 1, 'oro-ocular synkinesia': 1, 'oro-facial cleft malformations': 1, 'cardiovascular, oro-facial cleft': 1, 'dental, oral and oro-facial disorders': 1, 'oro facial dyskinesia': 2, 'Oro-faciodigital syndrome': 1, 'Oro-': 2, 'oro-mucosal abnormality': 1, 'Oro-facial Granulomatosis': 1, 'axial, limb and oro-facial abnormal involuntary movements': 1, 'oro-naso-ocular cleft': 2, 'oro-facial cleft deformities': 1, 'oro- and hypopharynx carcinoma': 2, 'oro-antral and/or oro-nasal disorders': 1, 'oro-antral defect': 2, 'deficits in oro-facial motor control': 2, 'involuntary oro-facial, limb, and truncal movements': 1, 'involuntary oro-facial, limb, or truncal movements': 1, 'oro-facial and dental anomalies': 1, 'oro-maxillo-facial tumors': 1, 'oro-maxillo-facial tumor': 1, 'oro-facial oedemas': 1, 'oro-facial syndrome': 1, 'Oro-facial cysticercosis': 2, 'gangrene of the oral cavity base': 1, 'oro-facial spasms': 1, 'Oro-digito-facial syndrome': 1, 'Oro-facial clefts defects': 1, 'Oro-facial noma-': 1, 'Oro-facial infection': 2, 'OAF\\OAC': 1, 'oro-facial myofunctional disorders': 3, 'Oro-facial tuberculosis': 2, 'oro-facial dysmorphology': 1, 'oro-facial dysmorphologies': 1, 'ODP': 1, 'Oro-dental pathologies': 1, 'Oro-dental anomalies': 1, 'oro-craniofacial diseases': 1, 'carcinoma of the oro-facial region': 1, 'obstruction of the oro and hypopharynx': 1, 'oro-dental self-injury': 1, 'oro-facial abnormality': 1, 'oro-facial cavernous haemangiomas': 1, 'carcinoma of the oro-maxillo-facial region': 1, 'febrile oculo-oro-cutaneo-acrodesquamatous syndrome': 1, 'Oro-Facial Defects': 1, 'oro-facial abscesses': 2, 'oro-bucco-lingual movements': 1, 'oro-facial granulomatous disease': 1, 'Oro-facial metastases': 2, 'oro-facial metastases': 1, 'carcinomas of the oro- or hypopharynx': 1, 'Oro-facial malignancy': 1, 'oro- facial lesions': 1, 'Gangrene of the oral tongue': 1, 'oro-faciodigital,': 1, 'oro-lingual trauma': 1, 'congenital oro-antral and/or oro-nasal diseases': 1, 'oro-lingual motor dysfunction': 1, 'Ircinia oros': 1, 'oro-dental pathosis': 1, 'oro- and hypopharynx carcinomas': 1, 'oro:facial and limb developmental abnormalities': 1, 'oro-facial TD': 1, 'oro-antral/nasal or oro-cutaneous fistula': 1, 'oro-facial-dental syndromes': 1, 'oro-facial dental syndromes': 1, 'midline oro-facial defects': 1, 'Oro-facial (tardive) dyskinesia': 1, 'oro-facial tardive dyskinesia': 2, 'oro- or hypopharynx carcinoma': 1, 'oro facial clefts': 1, 'oro-faciodigital syndromes': 1, 'oral- and oro-facial lesions': 1, 'oro- and/or craniofacial clefts': 1, 'Oro-linguo-facial dyskinesias': 1, 'oro-facial cleft defects': 1, 'oro-facial Clefting': 1, 'PMC': 1, 'oro-facial cleft region': 1, 'oro-mucosal diseases': 1, 'OFD': 5, 'oro-antral fistula1': 1, 'oro-functional': 1, 'Oro-Facial Lesions': 1, 'oro-dental injury': 2, 'OL': 1, 'oral gangrenous disease': 1, 'oro-buccal abnormal feelings': 1, 'oro-facial diskinesia': 1, 'oro-facial structural abnormalities': 1, 'ocular oro-facial and genital herpes': 1, 'oro-facial self-inflicted injuries': 1, 'Oro facial clefts': 1, 'Oro-Oto-Cardiac Syndrome': 1, 'Oro-Oto-Cardiac syndrome': 2, 'oro-lingual-facial lesions': 1, 'oro-mandibulo-otic syndrome': 1, 'Oro-facial dysfunctions': 2, 'OFDs': 1, 'oro-facial dysfunction': 4, 'Oro-maxillo-facial metastasis': 1, 'Oro-facialdystonia': 1, 'Oro-facial-lingual stereotypies': 1, 'oro-facial-lingual stereotypies': 1, 'oro-facial and dental injury': 1, 'Oro-Facial Lymphatic Malformation': 1, 'oro-facial or genital lesions': 1, 'oro-facial hypotonia': 1, 'oro-facial mutilation': 1, 'oro-facial gangrenous lesion': 1, 'OFP': 1, 'Oro-genital ulcersSinusitisRespiratory': 1, 'Oro A': 1, 'oro-dental pathology': 1, 'oro-facial trauma injuries': 1, 'ocular or oro-facial herpes': 2, 'ocular, genital, and oro-facial herpes': 1, 'and oro-facial': 1, 'oro-dento-facial problems': 1, 'oro-facial fistula': 1, 'Oro-palatal dysplasia': 1, 'Oro-facial thermal injury': 1, 'oro-facial myofunctional disorder': 2, 'OMD': 1, 'oro-sensory': 1, 'oro-praxic symptoms': 1, 'dental and oro-facial injuries': 1, 'Oro-hypopharynx': 1, 'oro-facial/craniofacial, skeletal, and limb malformations': 2, 'oro- dental injuries': 1, 'oro- dental trauma': 1, 'ODT': 1, 'Oro-Dental Trauma': 1, 'oro- -dental trauma': 1, 'oro-dental injur': 1, 'Oro-facial clefts malformations': 1, 'oro-facial movement': 1, 'oro-mucosal disease': 1, 'oro-faryngale dysfagie': 1, 'oro-facial muscle atonia': 1, 'oro-facial carcinoma': 1, 'oro-facial fibro-osseous lesions': 1, 'Oro-antral perforations': 1, 'oro-antral perforations': 1, 'oro-ocular facial clefts': 1, 'cysts of the Oro-facial region': 1, 'oro-facial cysts': 1, 'Oro-facial cysts': 1, 'Oculo-oro-genital syndrome': 1, 'Oro-facial injury': 1, 'impaired oro-lingual praxis': 1, 'Oro-facial disorders': 1, 'oro-facial burn': 1, 'oro-facial burn injury': 1, 'OMT': 1, 'Oro-facial TB': 2, 'Oro-facial sensory impairment': 1, 'oro-oto-cardiac syndrome': 1, 'Oro-facial Harm': 1, 'oro-facial harm': 1, 'Oro-dental disorders': 1, 'oro-oesophageal epithelium injury': 1, 'Oro-oto-cardiac syndrome': 1, 'OOCS': 1, 'oro-facial sensory disorders': 1, 'oro-dental illnesses': 1, 'oro-/': 1, 'Granulomatose oro-faciale': 1, 'oro-related behavioural and sexual dysfunctions': 1, 'oro-bucco-facial praxis deficit': 1, 'deficit in the Oro': 1, 'Oro parakeet': 1, 'carcinoma of the oro- and hypopharynx': 1, 'oro-dental symptoms': 1, 'oro-nasal and oro-antral fistulations': 1, 'oro-antral fistulation': 1, 'Oro-facial and limb dyskinesias': 1, 'dento-oro-craniofacial disease': 1, 'Oro-Facial Herpetic Eruptions': 1, 'oro-facial herpetic eruptions': 1, 'Oro-ocular clefts': 1, 'CDO': 1, 'Oro-dental trauma': 1, 'oro-dental disorder': 1, 'Oro-dento-facial lesions': 1, 'oro-genital infection.1': 1}
|
oro-facial clefts
|
Disease
|
MESH:C531762
|
{'Alkaptonuric arthritis': 7, 'alkaptonuric rheumatism': 4, 'alkaptonuric': 62, 'Alkaptonuric': 14, 'exogenous ochronosis': 20, 'alkaptonuric ochronosis': 68, 'Exogenous ochronosis': 9, 'Alkaptonuric ochronosis': 28, 'EO': 17, 'alkaptonuric arthropathy': 12, 'OCULAR OCHRONOSIS': 1, 'pseudo-ochronosis': 7, 'alkaptonuric disease': 2, 'Alkaptonuric rheumatism': 4, 'ALKAPTONURIC OCHRONOSIS': 1, 'alkaptonuric urolithiasis': 1, 'Ocular ochronosis': 9, 'Alkaptonuric Arthritis': 1, 'alkaptonuric arthritis': 6, 'alkaptonuric joint lesion': 1, 'alkaptonuric cartilage': 2, 'Alkaptonuric Cartilage': 1, 'ocular ochronosis': 14, 'Alkaptonuric Ochronosis': 7, 'Alkaptonuric arthropathy': 3, 'alkaptonuric prostatolithiasis': 1, 'alkaptonuric urine': 3, 'Alkaptonuric Tissues': 1, 'Pseudo-ochronosis': 1, 'ocular and ear ochronosis': 4, 'Alkaptonuric Arthropathy': 1, 'alkaptonuric osteoarthritis': 1, 'alkaptonuric hip arthritis': 2, 'Cutaneous EO lesions': 1, 'Cutaneous exogenous ochronosis': 1, 'EO lesions': 1, 'alkaptonuric ochronic osteoarthritis': 1, 'Pseudo-Ochronosis': 1, 'Ocular Ochronosis': 3, 'alkaptonuric brain': 1, 'ALKAPTONURIC ARTHROPATHY': 1, 'dyschromia of EO': 2, 'alkaptonuric amyloidosis': 1, 'alkaptonuric amyloid': 1, 'alkaptonuric polyarthropathy': 1, 'alkaptonurics': 5, 'alkaptonuric ochonosis': 1, 'alkaptonuric osteoarthropathy': 2, 'alkaptonuric man': 1, 'OCULAR ochronosis': 1, 'Alkaptonuric urine': 1, 'ocular, cutaneous and cardiovascular ochronosis': 1, 'alkaptonuric ochronotic arthropathy': 1, 'CASE OF ALKAPTONURIC OCHRONOSIS': 1, 'phenacetine pseudo-ochronosis': 1, 'alkaptonuric ocular ochronosis': 1, 'otic and ocular ochronosis': 1, 'Alkaptonuric ochronosis of the carotid artery': 1, 'Alkaptonuric ochronosis of the aorta': 1, 'DIFFERENTIAL DIAGNOSIS OF ALKAPTONURIC OCHRONOSIS': 1, 'ear and ocular ochronosis': 1}
|
alkaptonuric ochronosis
|
Disease
|
MESH:C531766
|
{'WGBS': 307, 'WB': 26, 'WHOLE': 121, 'WBRT': 41, 'WGD': 567, 'WHOLE-CELL CONFIGURATION': 1, 'WHOLE-BODY ENERGY HOMOEOSTASIS': 1, 'WTS': 30, 'WG': 72, 'WGMS': 3, 'ALL': 3, 'ALL HDC': 1, 'WBDs': 2, 'WBD': 6, 'WES': 79, 'WHOLE-GENOME RESPONSES': 1, 'WMS': 62, 'WHOLE BODY': 11, 'WB-': 1, 'WS': 55, 'WSD': 27, 'AWB': 6, 'WGs': 4, 'WCL': 84, 'EFFECT OF WHOLE BODY': 2, 'SWGA': 2, 'CHWS': 1, 'WBI': 17, 'WGDs': 44, 'WFC': 1, 'WBC': 17, 'WHOLE-EXOME': 5, 'WGP': 8, 'WM': 5, 'VD': 1, 'inflammation of the uveal tract': 11, 'SR': 1, 'WGTA': 5, 'whole brain atrophy': 1, 'WH': 15, 'WXS': 4, 'WCEs': 2, 'PWS-HFPTS': 1, 'PWS-': 1, 'PWS': 3, 'WHOLE-EXOME SEQUENCING': 11, 'WHOLE-BODY MASSAGE ON': 1, 'WGC': 3, 'WCWH': 1, 'rWES': 3, 'rWGS': 20, 'whole-brain atrophy': 25, 'WP': 3, 'WBM': 8, 'IWV': 10, 'WSCC': 30, 'S-WGA': 1, 'WMGS': 13, 'WGF': 3, 'sWGS': 14, 'AME': 1, 'LCWGS': 3, 'CWB': 5, 'WPRT': 11, 'WTSS': 4, 'WHOLE-BODY ENDOTHERMY': 1, 'WHOLE-BODY (TACHYMETABOLIC) ENDOTHERMY': 1, 'WSSD': 6, 'WHOLE-BODY IRRADIATION': 21, 'WC': 10, 'WPF': 1, 'Lyme (whole syndrome': 1, 'EFFECT OF WHOLE-BODY X-IRRADIATION ON': 1, 'WBR': 11, 'WSF': 2, 'WHOLE CELLS': 9, 'WHOLE-BODY X-IRRADIATION ON': 1, 'TRANSPLANTATION OF WHOLE JOINTS': 1, 'WHOLE BRAIN DISTRIBUTION OF FA VALUES': 1, 'WHOLE BRAIN': 5, 'WHOLE-BODY X-IRRADIATION': 14, 'WISE': 3, 'deficiency of the whole': 2, 'EFFECTS OF WHOLE-BODY X IRRADIATION': 1, 'WHOLE CELL SUSPENSIONS': 1, 'whole-brain disease': 10, 'loss of whole brain volume': 1, 'WHOLE-BODY': 22, 'WHOLE CELL': 5, 'loss of the whole': 2, 'LPWGS': 1, 'WVI': 9, 'WBNAA': 3, 'WHOLE BLOOD': 41, 'WGA': 29, 'WHOLE SERUM': 1, 'WBRI': 1, 'whole brain disease': 3, 'TPG': 1, 'WCX': 1, 'WHOLE-BODY COUNTING': 3, 'inflammation of the uveal tract of the eye': 3, 'WHOLE-BODY COUNTING OF I-131-LABELED THYROXINE': 1, 'WRIC': 4, 'WGT': 3, 'wEB': 1, 'OWH': 7, 'WMC': 1, 'TGD': 7, 'WHOLES': 1, 'WHOLE-BODY IMPULSE': 1, 'WHOLE-BODY X-IRRADIATION ON': 1, 'TLS': 1, 'WBMD': 1, 'BF': 1, 'GP': 2, 'WBP': 2, 'abnormalities of whole brain': 1, 'WMG': 1, 'WHOLE-': 13, 'EFFECT OF WHOLE-BODY IRRADIATION ON': 2, 'Uveal tract inflammation': 2, 'WTC': 4, 'WBV': 12, 'WTL': 2, 'ERA OF WHOLE-GENOME SEQUENCING': 1, 'damage to the whole brain': 2, 'WBDM': 1, 'WHS': 2, 'WGTS': 3, 'WW': 3, 'PBVC': 1, 'IPI.WBTLG': 1, 'SIB': 1, 'WBOs': 1, 'WPTA': 1, 'Whole globe anomalies': 4, 'WGR': 1, 'WHOLE LIFE': 1, 'FWB': 3, 'whole-limb swelling': 1, 'WHOLE-CELL': 10, 'WHOLE-BODY CRYOSTIMULATION': 1, 'SWS': 13, 'WHOLE-BODY NEUTRON IRRADIATION': 1, 'WHOLE CELL EXTRACT PREPARATION': 1, 'PCAWG': 3, 'MLWD': 2, 'GSOS': 1, 'WLLM': 1, 'WSAs': 3, 'WHOLE-FIELD SEQUENTIAL INTENSITY-MODULATED': 1, 'Central and whole brain atrophy': 1, 'WHOLE BODY COUNTER': 2, 'WCE': 2, 'loss of whole body function': 1, 'WHOLE-CELL SYSTEMS': 1, 'WHOLE BODY COUNTING': 2, 'WHOLE POPULATION': 4, 'WHOLE CELL RECORDINGS': 1, 'atrophy of the whole brain': 10, 'WHOLE POPULATION NON-RESPONDERS RESPONDERS': 1, 'whole-brain (WB) atrophy': 1, 'loss of a sense of wholeness': 1, 'CALF RECEIVING WHOLE': 1, 'neuronal and whole-brain defects': 1, 'to the whole brain': 1, 'hemispheric and whole brain abnormalities': 1, 'Heroin abuse': 1, 'WHOLE-BRAIN': 5, "Wham's SV": 1, 'WPC': 5, 'SFWS': 1, 'WHOLE-BODY COUNTER': 6, 'EXAMPLES OF WHOLE-HEART MODELS': 1, 'WAs': 1, 'WA': 7, 'whole globe anomalies': 4, 'whole globe anomaly': 4, 'HWCL': 1, 'WHOLE-CELL MODELS': 1, 'WHOLE-CELL MODELING': 1, 'WSA': 5, 'whole globe abnormalities': 3, 'WHOLE ORGANS': 5, 'WHOLE-TRANSCRIPTOME ANALYSIS': 2, 'WHOLE BLOOD TR ANSFUSION': 1, 'WL': 2, 'WCMD': 1, 'WBHL': 2, 'WGAIM': 2, 'CES': 1, 'EFFECT OF WHOLE-BODY X-IRRADIATION': 1, 'WUSF': 1, 'WHOLE EXOME SEQUENCING': 9, 'WHOLE-BODY X-IRRADIATIONS': 1, 'ERYTHROPOIETIN PRODUCTION BY WHOLE-BODY IRRADIATION': 1, 'WCV': 4, 'WBGD': 2, 'WBPC': 2, 'atrophy of the whole brain,': 1, 'WD': 5, 'uveal tract inflammation': 5, 'HANFORD WHOLE BODY COUNTER': 1, 'UWS': 1, 'WHOLE-GENOME': 4, 'USE OF WHOLE': 2, 'sRB': 1, 'FOOD': 1, 'CLS': 1, 'WHOLE JOINTS': 1, 'WHOLE TRUTH': 1, 'WHOLE BRAIN SHIMMING': 1, 'Whole-brain atrophy': 9, 'WATSON': 1, 'fWBI': 10, 'hypofunction of the whole pituitary': 1, 'WT': 5, 'WHOLE-BRAIN PERFUSION SCAN': 1, 'WGM': 6, 'WCF': 1, 'PCI': 1, 'HS': 1, 'WBH': 4, 'CE': 1, 'WHOLE CELL MECHANICS': 1, 'whole-body aches': 1, 'WHOLE BODY IRRADIATION': 3, 'WHOLE ITEMS OVERVIEW': 1, 'WTHSs': 1, 'WHOLE-GENOME SEQUENCING': 4, 'EWB': 1, 'WHOLE HEART': 1, 'WHOLE OF ME': 1, 'sWBCT': 1, 'WTA': 13, 'aches in the whole body': 1, 'WHOLE BODIES': 1, 'WAP': 3, 'impaired whole-body metabolism': 1, 'CSWB': 1, 'WWA': 1, 'WOM': 6, 'BFA': 1, 'hemicerebral or whole brain abnormalities': 1, 'WHOLE BRAIN INPUT MAPPING': 1, 'WHOLE-BODY GLYCOGEN STORES': 1, 'HA-WBRT': 5, 'loss of wholeness': 2, 'WSS': 10, 'WHOLE COLONY': 1, 'soreness of the whole body': 1, 'MWHD': 1, 'MECHANICS OF WHOLE-CELL': 1, 'wOFC': 1, 'wOFC lesions': 1, 'TSGD': 1, 'WBSE': 1, 'WHOLE NUCLEOSOMES': 1, 'MT': 1, 'WBA': 2, 'WHOLE CELL VACCINES': 1, 'WHOLE LIFE-CYCLE COSTS': 1, 'WMSs': 1, 'HME': 1, 'WHOLE SEEDLINGS': 1, 'WHOLE-CELL RECORDINGS': 2, 'WN': 1, 'WHOLE TRANSCRIPTOME': 2, 'LCS': 1, 'NSWSF': 1, 'WHOLE BODY X-IRRADIATION': 1, 'WHOLE-BODY-IRRADIATED RATS': 1, 'WBCU': 1, 'WHOLE DIETARY INTERVENTIONS': 1, 'WET': 5, 'WTLs': 1, 'AWBT': 3, 'WCCE': 1, 'GWBM': 1, 'WHC': 1, 'WS-FDP': 1, 'WHOLE SALIVA': 3, 'WKV': 1, 'whole-globe anomaly': 1, 'EFFECT OF WHOLE-BODY': 1, 'whole-globe disease': 1, 'WHOLE BODY PERFUSION': 1, 'MF': 2, 'WHOLE-BRAIN LEVEL': 1, 'Atrophy of whole brain': 1, 'WORD': 2, 'EFFECTS OF WHOLE BODY': 1, 'WMA': 1, 'PREDESIGNED WHOLE-GENOME': 1, 'MORE DISSIMILAR THAN MATCHED WHOLE CELLS': 1, 'WHOLE-BODY X-IRRADIATION': 1, 'EFFECT OF WHOLE-BODY IRRADIATION WITH CO60': 1, 'WHOLE-ORGANISM CELLULAR': 1, 'WHOLE GENE DELETION': 1, 'DWD': 1, 'WHOLE-SYSTEM': 1, 'VTT': 1, 'WHOLE FOODS': 2, 'WHOLE BONE EXTRACT': 1, 'WHOLE CELLS TRUMP': 1, 'WSP': 1, 'WCC': 3, 'WSDs': 1, 'WHOLE MUSCLES': 1, 'WHOLE MICA SURFACE': 1, 'WHOLE BLOOD INCUBATION': 1, 'PRESERVATION OF WHOLE BLOOD': 1, 'ES': 1, 'WoP': 1, 'atresia of the whole': 1, 'WHOLE CELL PROTEIN': 1, 'whole-brain': 2, 'IHWBC': 1, 'paroxysmal involuntary whole': 1, 'whole': 4, 'WRD': 1, 'WBLLs': 1, 'WB atrophy': 1, 'WCLs': 1, 'WHOLE FRESH BLOOD': 1, 'WBSL': 1, 'WHOLE-BODY IRRADIATED MICE': 1, '3DWH': 1, 'WGLF': 1, 'WE': 1, 'wastage of whole blood': 1, 'AWGD': 1, 'WHOLE MILK': 1, 'WSL': 1, 'WbPS': 2, 'impaired whole-body energy metabolism': 1, 'RWBC': 1, 'alopecia whole scalp': 1, 'WBFI': 1, 'Whole': 1, 'WVRT': 3, 'WHOLE ORGAN PERSUFFLATION': 1, 'WHB': 1, 'DWB': 1, 'swelling of the whole fingers': 1, 'WBSR': 1, 'WLP-A': 1, 'urWGS': 1, 'WHOLE BLOOD CLEARANCE': 1, 'inflammation of the anterior uveal tract': 1, 'PART - WHOLE': 1, 'WHOLE VIRIONS': 1, 'WHOLE DISC TISSUE ENGINEERING': 1, 'WHOLE-BODY IRRADIATED': 1, 'whole-joint degeneration': 1, 'WHOLE-BODY X-IRRADIATION TO': 1, 'tremulousness of the whole': 1, 'UNIT FOR SECTIONS OF WHOLE ORGANS': 1, 'POST-TRAUMATIC REGENERATION OF WHOLE MUSCLES': 1, 'iWGA OF CANDIDATE CELLS': 1, 'WHOLE-BODY PET': 1, 'WHOLE BLOOD PRESERVATION': 1, 'wADC': 1, 'WHOLE FAMILY': 1, 'WMM': 1, 'wgMLST': 1, 'WHOLE-PIPELINE BENCHMARKING': 1, 'WTT': 2, 'WCS': 1, 'WHOLE EXOME': 3, 'WPC-LA': 1, 'EFFECTS OF WHOLE-': 1, 'whole-': 2, 'type I WGD': 1, 'II WGD': 1, 'WBIM': 1, 'Deterioration of the whole': 1, 'WRI': 1, 'WHOLE MANUSCRIPT': 1, 'WMGSD': 1, 'WTI': 1, 'EFFECTS OF WHOLE-BODY': 3, 'WHOLE-ORGANISM LEVELS': 1, 'WHOLE-BODY NEUTRON': 1, 'WHOLE-BODY PHOTON': 1, 'WRF': 1, 'Hexaploid WEC': 1, 'papilionoid WGD': 1, 'WGAS': 3, 'WGL-MPS': 1, 'WBPS': 2, 'PART-WHOLE': 1, 'INGESTED WHOLE PROTEINS': 1, 'WBCEB': 1, 'TBI': 1, 'WGCF': 1, 'WBPA': 4, 'WBBP': 3, 'atrophy in the whole brain': 1, 'trisomy of whole': 1, 'IWC': 4, 'TARGET ORGANIZATION]?:whole': 1, 'WSI': 3, 'WHOLE-ORGANISM THERMOGENIC': 1, 'wilting of whole': 1, 'WBRT - Y/N': 1, 'WBRT-30': 1, 'WHOLE-GENOME AMPLIFICATION': 1, 'WF': 3, 'WHOLE-GRAIN': 1, 'WBRT-HA': 1, 'WHOLE PROTEOME OVERLAP': 1, 'WSE': 2, 'WHOLE CEREAL': 1, 'USWS': 1, 'WACCM': 1, 'WHOLE-BODY IRRADIATION ON': 1, 'OF WBRT': 1, 'NBS-rWGS disorders': 1, 'NBS-rWGS': 1, 'NBS-rWGS disorder': 1, 'WMHP lesions': 1, 'WHOLE HEART COVERAGE': 1, 'WMHP lesion': 1, 'WHOBUS': 1, 'SCAD-CJ-WF': 1, 'WORMS lesion': 1, 'WORMS': 1, 'WHOLE-CELL PATCH-': 2, 'mitochondrial or whole-cell deficiency': 1, 'WP-C': 1, 'WS-CAM': 4, 'WHOLE JOINT': 1, 'WHOLE GENOME SEQUENCING': 1, 'EWH': 2, 'stiffness of whole body': 1, 'loss of whole foot function': 1, 'WDS': 1, 'WOR': 1, 'WHOLE PERSON': 1, 'WCI': 1, 'MI WHOLE': 1, 'Structural damage in the whole brain': 1, 'structural damage in the whole brain': 1, 'WBDV': 1, 'WHOLE BODY X IRRADIATION': 1, 'ORIGINS OF WHOLE': 1, 'WHOLE LINEAGES': 1, 'WHOLE-BODY CRYOTHERAPHY': 1, 'WHOLENESS': 1, 'reduction of whole brain and': 1, 'FAT': 1, 'WHOLE GENOME': 1, 'CWC': 1, 'WHOLE-BODY ENDURANCE': 2, 'COMPARISON OF WHOLE': 1, 'whole-body achiness': 1, 'WHV': 1, 'WTFS': 1, 'GS': 3, 'WHOLE POPULATIONS': 1, 'WHOLE-BODY IRRADIATED RATS': 1, 'WHOLE-BODY OESTROGEN SUPPRESSION': 1, 'NOSOLOGY OF THE WHOLE': 1, 'WMF': 1, 'WNB': 1, 'WSp': 3, 'PIV': 1, 'blurring of whole visual field': 1, 'WPA': 1, 'swelling of whole body': 1, 'WAB': 1, 'WRC': 1, 'WHOLE BONE': 1, 'whole-brain abnormalities': 2, 'Congenital whole-globe malformations': 1, 'whole-globe malformation': 1, 'FWET': 1, 'WBMS': 1, 'EFFECTS OF WHOLE-BODY X-IRRADIATION': 2, 'WHOLE-BODY METABOLIC ECONOMY': 1, 'WHOLE-MEAL BREAD': 1, 'aloe vera WLE carcinogenicity': 1, 'WHOLE-BODY X-IRRADIATED GERMFREE': 1, 'whole brain volume': 2, 'WHOLE ORGANS : II': 1, 'WHOLE ORGANS :': 1, 'abnormality in the whole brain': 1, 'WHOLE-BODY MRI MAGNET': 2, 'OF': 1, 'WVB': 2, 'WHOLE-BODY COUNTING GEOMETRY': 1, 'WHOLE LENGTH': 1, 'WHOLE PROTEIN': 1, 'EFFECTS OF WHOLE': 1, 'WHOLE-BRAIN ANALYSIS': 1, 'whole body disorder': 1, 'EFFECTS OF WHOLE-BODY PROTON IRRADIATION': 1, 'WBRT-Mel': 1, 'WBRT-': 1, 'OWHM': 1, 'sWGS ANALYSES': 1, 'WHOLE SYSTEMS AYURVEDA': 1, 'WBIA': 1, 'LWGS': 1, 'erythema of the whole body': 1, 'WBMS-CT': 1, 'DANGER FOR THE WHOLE WORLD': 1, 'MWEVD': 1, 'WBLD': 1, 'WHOLE LOT': 1, 'MODIFIED VASCULARIZED WHOLE': 1, 'WUS': 1, 'CURRENT DIAGNOSTIC APPLICATIONS OF HUMAN WHOLE SALIVA': 1, 'WG-MPS': 1, 'WBCST': 1, 'DOR': 1, 'WHOLE NEW WORLD': 1, 'abnormalities of whole body movements': 1, 'WIOP': 1, 'impaired UWS': 1, 'WHOLE-BODY NEUROPROSTHETIC': 1, 'anhedonia': 1, 'WG-ADC': 1, 'whole brain': 1, 'WBL': 1, 'Whole globe anomaly': 1, 'WBH injury': 1, 'WK': 1, 'WHOLE HEART EXTRACT ON': 1, 'WHOLE BODY PERIODIC ACCELERATION': 1, 'whole globe abnormality': 1, 'inflammations of the uveal tract': 1, 'SS': 1, 'impaired whole body balance': 1, 'WHOLE-BONE MECHANICAL PROPERTIES': 1, 'EFFECT OF WHOLE-BODY IRRADIATION': 1, 'WHOLE-BODY GAMMA IRRADIATION': 1, 'fracture of the whole body': 1, 'WPG': 1, 'WIE': 1, 'WHOLE-ORGAN': 1, 'WHOLE-BODY METABOLISM': 1, 'WV': 2, 'WVM': 1, 'WHOLE-BODY AUTORADIOGRAPHY': 1, 'WHI': 1, 'WHOLE-BODY MECHANISMS': 1, 'INDICES OF WHOLE CELLS': 1, 'MIXED WHOLE GRAIN DIETS': 1, 'RRL': 1, 'wdVD': 1, 'Inflammation of the uveal tract': 2, 'WHOLE-ORGANISM': 1, 'WSB': 1, 'WHOLE KILLED ARTHROSPORES': 1, 'WHOLE SEQUENCING': 1, 'inflammation of uveal tract': 1, 'WHOLE BLOOD COLLECTED ON': 1, 'WHOLE-BRAIN RADIOTHERAPY': 1, 'WHG': 1, 'WHOLE-BRAIN MODELING': 1, 'WIV': 1, 'whole inactivated virus': 1, 'WME': 1, 'ROLE OF WBRT': 1, 'EVOLUTION OF WHOLE BRAIN': 1, 'WHOLE TEXT': 1, 'WHOLE TEST': 1, 'WHOLE BONE 4-POINT': 1, 'Whole-Brain Atrophy': 1, 'BWBP': 2, 'SGD': 1, 'DCWL': 1, 'WBIR': 1, 'WBIR injury': 1, 'WHOLE BRAIN DA': 1, 'WHP': 2, 'WHOLE NUCLEUS': 1, 'WSCC MODEL': 1, 'TYPING FROM WHOLE-GENOME SEQUENCING': 1, 'impaired WBV': 1, 'WHOM': 1, 'unilateral whole nerve palsies': 1, 'LWC': 1, 'swelling of the whole body': 1, 'ILMN': 1, 'WHOLE-CELL RECORDING FROM ELp': 1, 'WHOLE-EXOME SEQUENCING OF BLOOD-DERIVED': 1, 'WHOLE ORGANISMS': 3, 'A. shenzhenica WGD': 1, 'WHOLE-CELL BASED APPROACH': 1, 'WES-CAPN3het': 1, 'ABWGC': 1, 'WBN': 1, 'WHOLE CORN': 1, 'WMSP': 1, 'atrophy of whole brain volume': 1, 'WGHM': 1, 'loss of orbicularis wholeness': 1, 'A-SWS': 2, 'WVR': 1, 'LDWBI': 1, 'WHOLE-BODY HEAT LOSS': 1, 'WMS-S': 1, 'cancer of the whole pancreaticobiliary system': 1, 'tingling of whole body': 1, 'WDF': 1, 'WHOLE APPLE FRUIT': 1, 'BWF': 1, 'WHOLE PHAGE': 1, 'WHOLE RETICULOCYTES': 1, 'WMNC': 1, 'EFFECT OF WHOLE BODY IRRADIATION': 1, 'WCA': 1, 'Whole-globe anomalies': 1, 'cWGS': 1, 'atrophy of both whole-brain and hippocampus': 1, 'WHOLE-BODY COUNTERS': 2, 'WHOLE-BODY CRYOTHERAPY': 1, 'WGGS': 1, 'WHOLE FEATHER EXTRACTS': 1, 'WB loss': 1, 'WFDM': 1, 'FB': 1, 'FB UP': 1, 'WHOLE PIGEON': 1, 'WAS': 2, 'WHOLE-BRAIN CONTRASTS': 1, 'UTILIZATION OF WHOLE EXOME SEQUENCING': 1, 'ATO-VAC': 1, 'deficient in whole complement': 1, 'CH-SWS': 1, 'PNEUMOCOCCIDAL POWER OF WHOLE BLOOD': 1, 'WSV': 1, 'EFFECT OF WHOLE-BODY ALPHA-IRRADIATION ON': 1, 'WHOLE-REPORT ASSESSMENT': 1, 'WHOLE SAMPLE': 1, 'WPH': 1, 'damage to the whole hippocampus': 1, 'WHM': 1, 'WHOLE PATIENT': 1, 'sNGS': 1, 'inflammatory disorders of the uveal tract': 1, 'WHOLE-GENOME DUPLICATION': 1, 'DIAZO REPLICATION OF THICK SECTIONS OF WHOLE LUNG': 1, 'whole globe disorder': 1, 'WHOLE_GENOME': 1, 'WBPBPK': 1, 'WHOLE-CELL SUSPENSION': 1, 'WHOLE-BRAIN CORRELATIONS': 1, 'EFFECT OF WHOLE': 1, 'WHPC': 1, 'WAI': 1, 'WHOLE TRANSCRIPTOME ANALYSIS': 1, 'WHOLE-CELL HYDROLYSATES': 1, 'WHOLE LEAF RESPONSE': 1, 'wHS': 1, 'WMT': 1, 'atrophy of the whole brain and hippocampus': 1, 'WMCs': 1, 'WHOLE BRAIN VOLUME': 1, 'WHOLE-CELL VACCINE': 1, 'INACTIVATED WHOLE-VIRUS VACCINES': 1, 'impairment of whole body metabolism': 1, 'whole-body injuries': 1}
|
WGD
|
Disease
|
MESH:C531777
|
{'islet': 831, 'Islet': 251, 'islet dysfunction': 819, 'islet cell dysfunction': 114, 'Chromaffinoma': 2, 'hIAPP': 204, 'familial PPGL': 2, 'familial pheochromocytoma/paraganglioma': 4, 'islets': 123, 'Familial pheochromocytomas': 12, 'familial pheochromocytomas': 12, 'Islet dysfunction': 47, 'Islet Dysfunction': 21, 'IA': 5, 'hypoplastic islets': 6, 'Islet cell dysfunction': 4, 'Familial pheochromocytoma': 50, 'Familial pheochromocytoma/paraganglioma': 2, 'islets dysfunction': 12, 'TPIAT': 67, 'Islet autoimmunityN': 1, 'islet abnormalities': 31, 'familial PCC': 10, 'impaired islet': 2, 'familial pheochromocytoma': 101, 'TARGETED ISLET-': 1, 'dysplastic islets': 10, 'islet neuropathy': 5, 'familial pheochromocytoma and/or paraganglioma syndrome': 1, 'familial pheochromocytoma syndromes': 3, 'in islet': 1, 'diffuse abnormality of islets': 2, 'familial pheochromocytoma and': 1, 'islet cell tumor syndromes': 1, 'familial pheochromocytomas and paragangliomas': 10, 'UKITC': 2, 'islet impairment': 13, 'islet cellular impairment': 1, 'hIAPP aggregation': 18, 'chromaffinoma': 24, 'islet toxicity': 40, 'ISLETS FOR': 1, 'IAT': 21, 'islet adenomas of the pancreas': 2, 'extrasuprarenal chromaffinoma': 1, 'cytoplasmic islet': 1, 'islet abnormality': 6, 'Islets': 6, 'Medullary suprarenal chromaffinoma': 1, 'monogenic islet disorders': 1, 'islet cytotoxicity': 10, 'familial pheochromocytoma and paraganglioma': 5, 'HIP': 23, 'Islet Neogenesis': 6, 'sympathetic islet neuropathy': 5, 'islet pathology': 1, 'hIAPP amyloidogenesis': 5, 'hIAPP cytotoxicity': 1, 'hypertrophic islets': 4, 'islet inflammatory': 8, 'damage of pancreas islet': 1, 'islets dysfunction and': 1, 'familial pheochromocytoma-paraganglioma (PCC-PGL) syndrome': 1, 'Angiogenic islets': 1, 'HIAPP': 1, 'Familial nonsyndromic pheochromocytoma': 1, 'IDS': 2, 'MIT': 1, 'sporadic and familial islet-cell tumors': 1, 'IE': 16, 'islet necrosis': 35, 'Impairment of islet beta-': 1, 'islet aggregation': 2, 'isletitis': 16, 'ISLET ALLOTRANSPLANTATION': 1, 'familial pheochromocytoma or paraganglioma': 1, 'Islet graft': 1, 'of the islet': 1, 'islet hyperactivity': 1, 'Familial PHEOs': 2, 'damage to islets of pancreas': 1, 'familial pheochromocytoma and paraganglioma syndromes': 1, 'impairment of islet function': 4, 'Ferroptosis of islet': 1, 'islet insulitis': 4, 'ISLET': 8, 'STANDARDIZED ISLET': 1, 'pheochromocytoma-chemodectoma familial syndrome': 1, 'islet malformations': 1, 'malignant or familial pheochromocytoma': 1, 'MIS': 3, 'sporadic and familial pheochromocytoma': 4, 'islet malformation': 2, 'islet maldevelopment': 1, 'Familial PHEO': 2, 'IID': 1, 'POST': 6, 'HIs': 1, 'dysplastic islet': 2, 'Dysplastic islets': 1, 'extraadrenal chromaffinomas': 1, 'islet neogenesis': 1, 'PANCREATECTOMY WITH ISLET AUTOTRANSPLANTATION': 2, 'Islet inflammatory': 3, 'Post-TPIAT': 1, 'post-TPIAT': 8, 'inflammatory islet': 9, 'islet dysmorphogenesis': 2, 'Islet Dysmorphogenesis': 1, 'EVALUATE CLINICAL ISLET TRANSPLANTATION': 1, 'Islet toxicity': 2, 'Neo-Islet': 2, 'NI': 3, 'CITR': 1, 'Islet Pathology': 1, 'familial adrenal pheochromocytoma': 2, 'Familial Pheochromocytomas': 2, 'Familial pheochromocytomas and paragangliomas': 3, 'and familial pheochromocytoma': 2, 'islet macroadenomas': 1, 'islet of': 5, 'AIT': 5, 'Brun islet': 1, 'TRANSPLANTED ISLETS': 2, 'IEQ': 2, 'islets and': 1, 'familial isolated paraganglioma-pheochromocytoma syndrome': 1, 'islet amyloids in the pancreas': 1, 'PIAT': 1, 'islet transplantation': 1, 'chromaffinomas': 7, 'Impairment of islet': 2, 'Familial Pheochromocytoma Syndromes': 1, 'FUNCTIONAL ISLET': 5, 'Islet Hypervascularization': 1, 'Islet hypervascularities': 1, 'islet-': 6, 'impaired islet function': 10, 'Islet adenoma of pancreas': 1, 'Islet amyloidis': 1, '-atrophic islets': 1, 'atrophic islets': 10, 'IPN': 4, 'and islet dysfunction': 1, 'pancreas/islet injury': 1, 'familial noradrenergic pheochromocytoma': 1, 'IT': 2, 'islets of': 3, 'islet amyloidogenesis': 7, 'islet function': 5, 'Islet cytotoxicity': 3, 'familial ectopic pheochromocytoma': 1, 'ectopic familial pheochromocytoma': 1, '-islet': 3, 'islet of the pancreas': 1, 'CIT': 13, 'atrophy of pancreas islet': 1, 'ISLET XENOTRANSPLANTATION': 2, 'Adrenal Gland Chromaffinoma': 1, 'gland chromaffinoma': 1, 'HIPP': 2, 'pancreas islet injury': 4, 'TP-IAT': 9, 'CADAVERIC ISLET': 1, 'angiogenetic islets': 1, 'familial pheochromocytomas/paraganglioma': 1, 'irritation of islets': 1, 'islet-cell dysfunction': 8, 'HIT': 1, 'islet central': 1, 'islet disorders': 2, 'ISLET OF': 1, 'islet sclerosis': 1, 'Dysfunctional islets': 1, 'islet dysfunctions': 7, 'atrophic islet': 2, 'familial pheochromocytoma/paraganglioma syndrome': 6, 'familial Pheo': 1, 'B-islet dysfunction': 1, 'dysfunction of the islet': 1, 'Dysfunction of islet cells': 1, 'islet functional impairment': 1, 'PAI': 2, 'HUMAN ISLETS': 1, 'benign familial pheochromocytoma': 1, 'familial pheochromocytoma syndrome': 2, 'familial paraganglioma-pheochromocytoma syndromes': 4, 'sIAT': 1, 'familial pheochromocytoma/paragangliomas': 1, 'familial pheochromocytoma/paraganglioma syndromes': 4, 'FAMILIAL PHEOCHROMOCYTOMA': 1, 'Familial PPGLs': 1, 'Familial pheochromocytoma/paraganglioma syndrome': 1, 'Familial pheochromocytoma/paraganglioma syndromes': 1, 'eSIN': 5, 'CHARACTERISTICS OF ISLET PATHOLOGY': 1, 'or islet': 1, 'Isletitis': 5, 'benign chromaffinoma': 1, 'islet of regeneration': 1, 'CITC': 3, 'Pancreas Islet': 1, 'Pancreas islet damage': 1, 'IMPROVING SUCCESS OF ISLET AUTOTRANSPLANTATION': 1, 'islet-dysfunction': 1, '-islet cell dysfunction': 4, 'Familial Pheochromocytoma': 6, 'Familial paraganglioma/pheochromocytoma': 1, 'to the Islets': 1, 'Multiple familial pheochromocytomas': 1, 'multiple familial pheochromocytoma': 1, 'ITA': 8, 'islet dysregulation': 2, 'islet,': 1, 'dysfunction of islet cells': 1, 'familial or syndromic PPGLs': 1, 'ISLETS': 5, 'islet graft': 1, 'abnormalities of islet': 1, 'PI': 2, 'ISLET TRANSPLANTATION': 6, 'necrosis of islet': 2, 'Islet-cell Dysfunction': 1, 'to islet': 1, 'VEIN-ISLETS': 1, 'Familial paraganglioma and pheochromocytoma syndrome': 1, 'ON ISLET': 1, 'AFTER ISLET TRANSPLANTATION': 1, 'CHALLENGES OF ISLET TRANSPLANTATION': 1, 'Islet Cell Dysfunction': 3, 'Pancreas and Islet': 1, 'dysfunction of islets': 7, 'pheochromocytoma familial paraganglioma': 2, 'extra-adrenal chromaffinomas': 1, 'of islets': 1, 'IMPROVING SUCCESS OF ISLET AUTO-TRANSPLANTATION': 1, 'Islet-': 2, 'Islet insulitis': 8, 'Familial Pheochromocytoma/Paraganglioma syndromes': 1, 'Bilateral familial pheochromocytoma': 1, 'Islet neuropathy': 1, 'Sympathetic Islet Neuropathy': 1, 'intra-islet necrosis': 1, 'islet hyperplasia6': 1, 'OVERVIEW OF ISLET TRANSPLANTATION': 1, 'Islet abnormalities': 3, 'dysregulation of islet function': 1, 'islet transplant': 3, 'FAMILIAL PHEOCHROMOCYTOMA WITH EPENDYMOMA': 1, 'familial and sporadic PCC': 2, '-islets': 1, 'Pancreas Islet Dysfunction': 1, 'Islet hypervascularization': 1, 'ISC': 1, 'injury to the islet of pancreas': 1, 'ALLOGENEIC ISLET': 1, 'AUTOLOGOUS ISLET TRANSPLANTATION': 1, '-islet necrosis': 1, 'Auto-antibody associated islet of the pancreas': 1, 'familial PCC syndromes': 1, 'familial pheochromocytoma-paraganglioma syndromes': 2, 'toxicity of islet': 1, 'islet ischaemia': 1, 'pancreas islets injury': 1, 'ITR': 1, 'Familial Paraganglioma and Pheochromocytoma Syndrome': 1, 'lung metastases of chromaffinoma': 1, 'islet antibodies': 2, 'Islet antibodies': 1, 'islet hypotrophy': 1, 'IIDP-HIPP': 2, 'Familial pheochromocytoma and paraganglioma syndromes': 2, 'functional islet cell tumor syndrome': 1, 'hIAPP;Hspg2Delta3': 1, 'familial paraganglioma-pheochromocytomas syndrome': 1, 'to the islet of the pancreas': 1, 'hIAPP-Tg': 1, 'dysmorphic islet': 1, 'islet allograft': 2, 'TPAIT': 3, 'IPIT': 1, 'anti-islet autoimmunity33': 1, 'familial PHEO syndrome': 1, 'of islet': 2, 'islet adenoma in the pancreas': 1, 'necrosis of the islet': 1, 'islet loss and dysfunction': 2, 'ISLET AUTOTRANSPLANTATION': 1, 'Islet pathology': 1, 'Islet Graft': 1, 'familial PPGL syndromes': 2, 'ILT': 1, 'HI': 2, 'Paraganglioma-Pheochromocytoma Family Syndrome': 1, 'Islet Allograft': 1, 'ISLET RECEPTORS': 1, 'sporadic and familial syndromic Pheo': 1, 'NON-ISLET': 1, 'angiogeneic islet': 1, 'familial Pheochromocytoma': 1, 'impairment of islets': 1, 'Familial islet cell tumors': 1, 'Familial paraganglioma-pheochromocytoma syndrome': 1, 'familial pheochromocytoma-paraganglioma syndrome type 4': 1, 'familial pheochromocytoma-paraganglioma syndrome': 4, 'IVM': 1, 'MI': 1, 'Islet Endothelial Dysfunction': 1, 'Medullary chromaffinoma': 1, 'inflammatory islet dysfunction': 1, 'pseudo-atrophic islets': 1, 'ICA': 1, 'necrosis of islets': 1, 'fibrotic islets': 1, 'IEI': 1, 'insulitic islets': 1, 'injury of islet cells of pancreas': 1, 'Islet MPS': 1, 'pancreas islet damage': 2, 'islet antibody': 1, 'familial paraganglioma-pheochromocytoma syndrome': 3, 'islet derangements': 1, 'syndromic and nonsyndromic ICTs': 1, 'ISLETS OF': 3, 'Islet atrophic': 1, 'of the islets': 1, 'Islet fibrogenesis': 1, 'PIs': 2, 'ILCs': 2, 'ILC': 2, 'Familial isolated pheochromocytoma': 1, 'islet inflammation20': 1, 'Hypertrophic islet': 1, '-hIAPP': 1, 'Sporadic and familial pheochromocytomas': 1, 'sporadic or familial pheochromocytoma and paraganglioma': 1, 'Islet neuronal abnormalities': 1, 'familial and sporadic PC': 1, 'islet vasculopathy': 1, 'AIC': 1, 'atrophy of the pancreas islets': 1, 'hypoglycemia2.Islets': 1, 'pancreas islet loss': 1, 'dysmorphic and fibrotic islets': 1, 'familial PHEO': 1, 'Familial pheochromocytoma-paraganglioma syndromes': 1, 'FP-linked tumors': 1, 'FP': 1, 'IAS': 1, 'Islet autoimmune syndrome': 1, 'pancreas islets': 1, 'CI': 1, '-islet dysfunction': 2, 'Islet necrosis and': 1, 'NIs': 1, 'abnormality of islet': 1, 'inflammatory islets': 1, 'F-PHEO': 1, 'non-syndromic familial pheochromocytoma': 1, 'islet autoimmunity in pancreas': 1, 'HIP-': 1, 'Dysfunction of islet': 1, 'Islet T2DM': 1, 'islet cell dysfunctions': 1, 'UPDATE ISLET ALLOGRAFT REGULATIONS': 1, 'ALLO-ISLETS': 1, 'AUTO-ISLETS REGULATED': 1, 'intra-islet': 2, 'SOT': 2, 'ISLET CELL ADENOMAS OF THE PANCREAS': 1, 'Familial PCPGs': 1, 'familial PCPGs': 1, 'familial pheochromocytoma and/or paraganglioma': 4, 'familial pheochromocytoma-paraganglioma': 2, 'FPG': 2, 'familial pheochromocytoma-associated tumor': 1, 'islets impairment': 1, 'chromaffinoma of the adrenal': 2, 'islet xenograft': 1, 'pancreas islet beta cells dysfunction': 1, 'pancreas islet': 2, 'sporadic or familial pheochromocytoma/paraganglioma': 1, 'Familial Bilateral Pheochromocytoma': 1, 'familial bilateral pheochromocytoma': 1, 'islets affection': 1, 'Islet Stroma': 1, 'Islet CE': 1, 'islet CE': 1, 'non-familial pheochromocytomas': 1, 'Islet Shipment': 1, 'IPITA': 3, 'islet celltumor': 1, 'TARGETS ISLET DYSFUNCTION': 1, 'ISLET DYSFUNCTION': 1, 'TARGETING ISLET DYSFUNCTION': 1, 'Islet neuropathology': 1, 'ectopic pancreas islet': 1, 'pancreas and islet damage': 1, 'islet endothelial cell dysfunction': 1, 'islet endocrine cell dysfunction': 1, 'islet microadenomatosis': 1, 'impairment of islet': 1, 'Islet CHIP': 1, 'Sacia Islet': 1, 'Islet glucotoxicity': 1, 'islet and pancreas': 1, 'Islet and Pancreas': 1, 'Islet and Pancreas-': 1, 'malignant chromaffinoma': 1, 'islet disorder': 2, 'adrenal and familial pheochromocytomas': 1, 'adrenal chromaffinomas': 1, 'Islet entrapment': 1, 'islet entrapment': 1, 'familial and sporadic pheochromocytoma and paraganglioma': 1, 'Islet-Cell Dysfunction': 1, 'systemic and islet': 1, 'Islet Invasion': 1, 'islet invasion': 1, 'SIs': 1, 'SI': 1, 'Islet amyloidogenesis': 1, 'TP-IAT OPERATIVE': 1, 'FAMILIAL PHEOCHROMOCYTOMA PRESENTING': 1, 'PORCINE ISLET XENOTRANSPLANTATION': 1, 'islet function impairment': 2, 'islet autoimmunty': 1, 'islet autoimmunit': 1, 'islet fibrogenesis': 1, 'dysfunction of the islets': 1, 'islet adenomata': 1, 'islet adenomata with': 1, 'familial PCC/PGL syndromes': 1, 'hIAPP aggregations': 1, 'HILOs': 1, 'pheochromocytoma/paraganglioma Familial pheochromocytoma/paraganglioma (PPGL) syndromes': 1, 'Dysfunction of the islets': 1, 'familial pheochromocytoma disease': 1, 'non-familial pheochromocytoma and paraganglioma': 1, 'familial PC': 1, 'Familial PPGL': 1, 'glucolipotoxic islet': 1, 'SAFETY OF CLINICAL ISLET XENOTRANSPLANTATION': 1, 'familial chromaffinoma': 1, 'beta-islets dysfunction': 1, 'Islet Stellate': 1, 'islet stellate': 1, 'anti-islet': 1, 'Familial and sporadic PPGLs': 1, 'isolated familial syndromes of pheochromocytomas and paragangliomas': 1, 'pancreas islet dysfunction': 1, 'islet deterioration': 1, 'abnormalities of islets': 1, 'hyperplasic islet': 1, 'Islet cartilago': 1, 'islet injure': 1, 'dysplasias of pancreas islets': 1, 'Islet Allogenic Rejection': 1, 'Islet Neovascularization': 1, 'Chromaffinoma of the adrenal medulla': 1, 'peri-islet pancreas lesion': 1, 'NICTH syndrome': 1}
|
islet
|
Disease
|
MESH:C531782
|
{'Tp': 14, 'TD': 9, 'treponema': 27, 'treponematosis': 137, 'MHA-TP': 3, 'Td': 46, 'TP': 75, 'TPPA': 5, 'TPE': 23, 'TPA': 21, 'T. pallidum': 10, 'TPE CDC 2575': 1, 'Treponema pallidum (': 4, 'Treponema': 104, 'Treponema pallidum': 7, 'TREPONEMA PALLIDUM': 27, 'TPHA': 101, 'TREPONEMA AGGLUTINATION': 1, 'endemic treponematosis': 12, 'TREPONEMA PALLIDUM IMMOBILIZATION TEST': 3, 'TREPONEMA': 10, 'Dyschromic treponematosis': 1, 'Endemic treponematosis': 4, 'TREPONEMA PALLIDUM IMMOBILIZATION REACTION': 1, 'treponema pallidum': 3, 'carateum': 4, 'TdEno': 1, 'TPI': 3, 'TREPONEMA PALLIDUM IMMOBILIZATION': 3, 'Treponema pallidumHemagglutination': 1, 'anti-treponematosis': 1, 'OTEB': 1, 'Treponematosis': 28, 'TREPONEMATOSIS': 4, 'GAEHTGENS TREPONEMA PALLIDUM REACTION': 1, 'treponemas': 5, 'NHP TPE': 1, 'Td-CTLP': 1, 'treponema+pallidum': 1, 'treponema-pallidum': 1, 'TEN': 1, 'Dyschromia in treponematosis': 1, 'Treponema-associated hoof disease': 1, 'TREPONEMA SUSPENSIONS': 1, 'TP-PA': 1, 'treponema disease': 1, 'KILLED TREPONEMA': 1, 'TPeC Cuniculi A': 1, 'TPeC': 2, 'TPD': 1, 'TREPONEMA IMMUNOFLUORESCENCE TEST APPLIED TO': 1, 'TPLC': 1, 'Treponema pallidum(': 1, 'TREPONEMA PALLIDIUM BY': 1, 'TP bacterium': 1, 'TREPONEMA PALLIDUM AGGLUTINATION': 1, 'CULTIVATION OF PATHOGENIC TREPONEMA PALLIDUM': 1, 'TREPONEMA PALLIDUM PATHOGENIC': 1, 'TPA SEA81-4': 1, 'PATHOGENIC VARIATIONS IN TREPONEMA PALLIDUM': 1, 'SUSPENSIONS OF KILLED TREPONEMAS': 1, 'TREPONEMAS': 1, '-TP': 1, 'anti-TP': 1, 'TREPONEMA MUCOSUM': 1, 'CULTIVATION OF TREPONEMA CALLIGYRUM': 1, 'Td FDP': 1, 'Treponema paraluiscuniculi': 1, 'Treponema saccharophilum': 1, 'Treponema and': 1, 'ULTRA-THIN SECTIONS OF TREPONEMA': 1, 'GUINEAN ENDEMIC FOCUS OF TREPONEMATOSIS': 1, 'Tpal': 1, 'Treponema primitia': 2, 'Treponema -associated diseases': 1, 'Hare treponematosis': 1, 'hare treponematosis': 1, 'Treponemas': 2, 'treponematosis-like': 1, 'treponema pallidema': 1, 'Treponema 2': 1, 'Tp pallidum': 1, 'Tp pertenue': 1, 'Treponema?': 1, 'Treponema associated hoof disease': 1, 'Treponema-associated diseases': 1, 'Treponema phagdenis': 1, 'TREPONEMA FLUORESCENCE TEST': 1, 'congenital treponematosis': 1, 'Treponema pallidum subsp pallidum (': 1, 'TREPONEMA IMMOBILIZATION REACTION': 1, 'TPHA;Treponema Pallidum': 1, 'TREPONEMA AS APPLIED': 1, 'Congenital Treponema pallidum': 1, "TREPONEMA PALLIDUM PATHOGE'NE": 1, 'TPE Fribourg-Blanc': 1, 'TPE CDC-2': 1}
|
treponematosis
|
Disease
|
MESH:C531783
|
{'gluteal mass': 85, 'gluteal': 58, 'gluteal cleft mass': 2, 'gluteal abscess': 259, 'tooth socket': 124, 'Gluteal': 9, 'gluteal abscesses': 49, 'Granuloma gluteale adultorum': 2, 'granuloma gluteale adultorum': 6, 'granuloma gluteale infantum': 23, 'Granuloma gluteale infantum': 27, 'gluteal cleft': 48, 'gluteal fold asymmetry': 1, 'gluteal lesion': 52, 'loss of gluteal': 1, 'damage to the superior gluteal nerve': 3, 'Damage to the superior gluteal nerve': 3, 'Gluteal sarcoid lesions': 1, 'gluteal enthesitis': 1, 'Gluteal erythema': 1, 'GLUTEAL': 8, 'deep gluteal syndrome': 70, 'GGI': 4, 'infection of bilateral gluteal fissure': 1, 'gluteal trauma': 13, 'gluteal nerve injury': 23, 'gluteal skin necrosis': 5, 'tooth sockets': 15, 'pulsatile gluteal mass': 3, 'Porokeratosis of gluteal region': 1, 'SGS': 1, 'gluteal or perianal erythema': 1, 'gluteal atrophy': 21, 'gluteal hemorrhage': 4, 'gluteal tears': 15, 'Gluteal Cleft': 1, 'gluteal claudicatio': 2, 'gluteal lymphoedema': 1, 'Gluteal lymphoedema': 1, 'gluteal swelling': 51, 'Gluteal necrotizing myofasciitis': 1, 'gluteal pain': 250, 'gluteal aneurysms': 5, 'gluteal tear': 6, 'tooth extraction socket': 24, 'gluteal tendon compression': 1, 'Hip socket impingement': 1, 'Gluteal abscess': 47, 'gluteal injectitis': 1, 'gluteal granulomata': 2, 'gluteal artery lesion': 2, 'gluteal artery injury': 27, 'Superior gluteal artery injury': 5, 'superior gluteal artery injury': 4, 'groin and gluteal pain': 2, 'Gluteal dermitis': 1, 'gluteal granulomas': 2, 'granuloma gluteale infantum/ adultorum': 1, 'gluteal and thigh pain': 5, 'SGN lesions': 2, 'gluteal tendon tear': 8, 'gluteal varicosities': 4, 'Granuloma Gluteale Infantum': 3, 'gluteal lump': 3, 'gluteal artery aneurysm': 26, 'gluteal discharge': 1, 'gluteal tumor': 22, 'GP': 2, 'Gluteal pain': 19, 'DGS': 31, 'gluteal and radicular pain': 1, 'Deep gluteal syndromes': 1, 'Gluteal Pain': 5, 'Granuloma gluteale infantum Crusted': 1, 'gluteal fibrosis': 14, 'gluteal tendon tears': 38, 'gluteal vessel injury': 6, 'gluteal injuries': 12, 'gluteal cleft skin': 1, 'gluteal hypoplasia': 6, 'SGAP': 13, 'Gluteal weakness': 4, 'tooth root socket': 2, 'GAAs': 2, 'Gluteal Arteries Aneurysms': 1, 'Gluteal artery aneurysms': 10, 'gluteal or thigh pain': 2, 'Gluteal Ptosis': 4, 'Gluteal ptosis': 3, 'gluteal ptosis': 13, 'gluteal fold lesions': 1, 'gluteal haematoma': 5, 'gluteal lesions': 21, 'gluteal lipoma': 12, 'Gluteal necrosis': 11, 'gluteal necrosis': 51, 'gluteal weakness': 19, 'Gluteal artery injuries': 1, 'gluteal artery injuries': 7, 'gluteal pain syndrome': 2, 'damage of superior gluteal nerve': 1, 'SGN injury': 4, 'Injury to the SGN': 1, 'SGN': 7, 'SGN injuries': 3, 'superior gluteal nerve (SGN) injury': 2, 'injury to the SGN': 1, 'gluteal concave deformities': 2, 'SGA injury': 5, 'SGA injuries': 2, 'tuberculous gluteal abscess': 2, 'tears of the gluteal tendon': 1, 'tears of the gluteal tendons': 2, 'gluteal neuralgia': 2, 'pleomorphic gluteal sarcoma': 1, 'gluteal sarcomas': 3, 'painful gluteal mass': 1, 'gluteal ulcers': 4, 'gluteal cleft ulcers': 1, 'and gluteal ulcers': 1, 'Gluteal Abscess': 9, 'gluteal nerve palsy': 4, 'gluteal crease': 6, 'Verrucous porokeratosis of the gluteal cleft': 1, 'wallet neuritis': 8, 'wallet-neuropathy': 1, 'gluteal deep ache': 1, 'Wallet neuritis': 3, 'wallet sciatica': 2, 'fatty wallet': 1, 'Wallet Neuritis': 2, 'fat wallet syndrome': 2, 'Wallet': 2, 'wallet': 6, 'tooth extraction socket hemorrhage': 1, 'hip socket dysplasia': 1, 'gluteal erythema': 3, 'aneurysm of the superior gluteal artery': 4, 'hip, thigh, and gluteal pain': 1, 'gluteal abcess': 1, 'Gluteal tear': 1, 'gluteal amyotrophy': 1, 'deep gluteal pain': 13, 'Deep gluteal pain': 4, 'gluteal or posterior thigh pain': 2, 'Gluteal and posterior thigh pain': 1, 'gluteal and posterior thigh pain': 4, 'hip and gluteal abscesses': 1, 'Aneurysm of the superior gluteal artery': 1, 'Injuries to the superior gluteal nerve': 1, 'gluteal mononeuropathy': 1, 'SGN lesion': 1, 'gluteal nerve lesion': 1, 'Gluteal nerve damage': 1, 'perineal, gluteal, or labial swelling or mass': 1, 'Gluteal Defects': 1, 'gluteal defects': 11, 'gluteal defect': 11, 'Gluteal lesions': 2, 'gluteal amnesia': 1, 'Superior gluteal injury': 1, 'SGA': 14, 'gluteal skin infection': 1, 'gluteal aneurysm': 5, 'Gluteal aneurysms': 3, 'Gluteal atrophy': 1, 'damage of the superior gluteal nerve': 1, 'gluteal tendons abnormality': 1, 'hip/gluteal and ankle pain': 1, 'gluteal muscular deficits': 1, 'SGD': 3, 'gluteal dermatoses': 2, 'gluteal cleft lesion': 4, 'gluteal deformities': 7, 'infantile gluteal granuloma': 3, 'gluteal masses': 13, 'GLADI': 1, 'gluteal region traumas': 1, 'deep gluteal paresthesia': 1, 'gluteal itchiness': 1, 'Gluteal fibrosis': 8, 'gluteal granuloma': 7, 'gluteal or lower extremity symptoms': 3, 'Gluteal soreness': 1, 'gluteal dermatosis': 4, 'gluteal skin eruptions': 1, 'gluteal asymmetry': 8, 'deep gluteal pain syndrome': 3, 'Gluteal skin injuries': 1, 'gluteal skin injury': 1, 'gluteal injury': 7, 'gluteal or pelvic abscesses': 1, 'Gluteal Noninvoluting Hemangioma': 1, 'Gluteal infection': 1, 'gluteal syndrome': 7, 'Gluteal Aneurism': 1, 'Restricted gluteal function': 1, 'Gluteal injuries': 1, 'gluteal avulsion': 2, 'tears of gluteal tendons': 1, 'gluteal tendon lesions': 2, 'injury to the superior gluteal artery or nerve': 1, 'gluteal tendon abnormalities of the hip': 1, 'GA': 3, 'gluteal aponeurosis': 1, 'gluteal cutaneous lesions': 1, 'gluteal soreness': 1, 'gluteal-tendon tears': 2, 'decreased gluteal sensation': 1, 'decreased gluteal region': 1, 'gluteal muscular fibrosis': 1, 'posterior gluteal pain': 6, 'gluteal myositis': 4, 'gluteal abscesses)': 1, 'tissue (gluteal) abscess': 1, '(gluteal) abscess': 1, 'gluteal) abscess': 1, 'Gluteal fistula': 3, 'gluteal fistula': 6, 'gluteal vein injuries': 1, 'gluteal/inguinal nodosum-like lesions': 1, 'gluteal lacerations': 1, 'Gluteal tendon tears': 7, 'palsy of the superior gluteal nerve': 1, 'GTT': 1, 'Gluteal mass': 3, 'gluteal pressure pain': 1, 'lumbar and/or gluteal pain': 2, 'gluteal and/or anorectal necrosis': 1, 'gluteal and scrotal necroses': 1, 'gluteal (gluteus minimus) dysfunction': 1, 'pelvic and gluteal tuberculous abscesses': 1, 'gluteal/spinal ischaemia': 1, 'Gluteal tumor': 1, 'Injury to the superior gluteal artery': 2, '-gluteal mass': 1, 'Unilateral Gluteal Necrosis': 1, 'senile gluteal dermatosis': 2, 'Senile gluteal dermatosis': 6, 'gluteal region deformities': 1, 'redundant gluteal skin': 1, 'gluteal deformity': 2, 'gluteal myospherulosis': 1, 'gluteal and groin pain': 3, 'gluteal Vx2-carcinomas': 1, 'injury of the superior gluteal artery and nerve': 2, 'loss of gluteal projection': 1, 'tooth socket defect': 4, 'Deep gluteal syndrome': 27, 'DGS disease': 1, 'coccygeal and gluteal pain': 1, 'pseudosciatica': 5, 'intra-gluteal infection': 1, 'Sacral/gluteal pain': 1, 'sacral/gluteal pain': 1, 'hip and gluteal pain': 3, 'gluteal artery aneurysms': 11, 'gluteal infections': 2, 'gluteal and leg haematomas': 1, 'gluteal haematomas': 1, 'gluteal nodule': 1, 'perineal and gluteal abscesses': 1, 'gluteal ulcer': 12, 'gluteal compression': 1, 'gluteal hypotrophy': 2, 'Gluteal cleft': 3, 'SGVs': 1, 'Superior gluteal vein syndrome': 1, 'gluteal neuropathy': 2, 'fat-wallet syndrome': 2, 'GME': 1, 'palmoplantar and gluteal inflammatory lesions': 1, 'gluteal venous malformation': 2, 'perianal and gluteal lesion': 1, 'fatty gluteal infiltration': 1, 'fatty gluteal atrophy': 1, 'fatty gluteal degeneration': 1, 'Gluteal pseudophallus': 1, 'deviated gluteal furrow': 1, 'DGF': 2, 'gluteal artery thrombosis': 1, 'gluteal pain syndromes': 3, 'superior gluteal artery aneurysm': 3, 'lumbar/gluteal pain': 3, 'Gluteal Hand': 1, 'Wallet attacks': 1, 'SGN) injury': 1, 'LGP': 1, 'Deep gluteal': 1, 'Deep gluteal syndrome 2': 1, 'pelvic or gluteal mass': 1, 'gluteal arteries aneurysms': 1, 'gluteals/hip abductor weakness': 2, 'Gluteal creases': 1, 'gluteal creases': 1, 'Painful Gluteal Mass': 1, 'gluteal/buttock pain': 1, 'Asymmetric gluteal folds': 1, 'gluteal nerve palsies': 1, 'gluteal aponeurotic fascia injury': 1, 'Gluteal Swelling': 1, 'gluteal and lumbar pain': 2, 'lumbar and gluteal pain': 2, 'gluteal and femoral tumors': 1, 'bifid gluteal crease': 1, 'asymmetrical gluteal folds': 1, 'asymmetry of the gluteal folds': 3, 'fistula to the gluteal cleft': 1, 'S-GAP': 2, 'gluteal minimus tears': 1, 'Gluteal Fibrosis': 4, 'GF': 6, 'gluteal sarcoma': 6, 'Gluteal asymmetry': 3, 'Gluteal and lower extremity hypoplasia': 1, 'Aneurysms of the gluteal': 2, 'gluteal fatigue': 1, 'GEM-A': 1, 'Gluteal Artery Extravasation': 1, 'lumbar or gluteal pain': 2, 'Tooth Sockets': 1, 'TES': 2, 'gluteal gait': 2, 'the superior gluteal nerve': 2, 'gluteal and inguinal abscesses': 1, 'gluteal/ upper thigh abscess': 1, 'infected gluteal haematoma': 1, 'gluteal calcification': 3, 'gluteal cyst': 4, 'Tooth socket': 3, 'Traumatic aneurysm of the superior gluteal artery': 1, 'gluteal tendon avulsion': 2, 'GL': 1, 'penile to gluteal fistula': 1, 'gluteal-penile fistula': 1, 'perineal and/or gluteal abscess': 1, 'gluteal and penoscrotal abscess': 1, 'Gluteal maximus atrophy': 1, 'Deep Gluteal Syndrome': 8, 'deep gluteal region pain': 1, 'gluteal vein injury': 3, 'gluteal depressions': 2, 'pits of the gluteal cleft': 1, 'to the SGNB': 1, 'Giant gluteal lipoma-like': 1, 'gluteal skin damage': 1, 'gluteal herpetic infection': 1, 'gluteal herpes': 1, 'hip, thigh or gluteal pain': 1, 'superior gluteal artery (SGA) or vein (SGV) injury': 1, 'deep gluteal syndromes': 4, 'tears of the gluteal musculature': 1, 'lateral gluteal deficiency': 1, 'gluteal cleft elongation': 1, 'gluteal pressure injuries': 1, 'gluteal nerve block': 2, 'Gluteal ulcer': 2, 'retroperitoneal and gluteal abscesses': 2, 'Conjunctival , thigh, elbow and gluteal infections': 1, 'gluteal follicular occlusive disease': 1, 'weakness of the gluteals': 1, 'gluteal hyperintensities': 1, 'Granuloma gluteale aldutorum': 1, 'Granuloma gluteale infantum/adultorum': 2, 'granuloma gluteal infantum': 4, 'Gluteal Sinus': 1, 'gluteal tumors': 3, 'gluteal sores': 1, 'gluteal sore': 2, 'buttock or gluteal pain': 2, 'gluteal fatty atrophy': 2, 'perianal or gluteal injuries': 1, 'recto-gluteal fistula': 2, 'Recto-gluteal fistula': 1, 'GS': 2, 'gluteal pseudoaneursym': 1, 'Gluteal abscesses': 2, 'gluteal angioma': 1, 'nodulocystic gluteal acne': 1, 'to the SGN': 1, 'injury to the superior gluteal nerve': 4, 'SGN damage': 1, 'Injury to the superior gluteal nerve': 1, 'paraspinal or gluteal pain': 1, 'III gluteal fibrosis': 1, 'Gluteal myositis': 1, 'gluteal or hip pain': 2, 'gluteal-sacral skin defects': 1, 'gluteal-sacral defects': 2, 'gluteal cleft asymmetry': 1, 'gluteal skin depression': 1, 'gluteal muscular necrosis': 2, 'lumbar, gluteal, and thigh pain': 1, 'perineal and gluteal lesions': 1, 'paralysis of the superior gluteal nerve': 2, 'hypoplastic gluteal cleft': 1, 'gluteal cleft disease': 2, 'genital and gluteal vesicular lesions': 1, 'deep gluteal cleft': 1, 'Lumbar and Gluteal Defects': 2, 'deep gluteal and hamstring syndromes': 2, 'deep gluteal syndrome of the hip': 1, 'Gluteal Pain Syndrome of the Hip': 1, 'Injury of the superior gluteal artery': 2, 'erosion of gluteal skin': 1, 'Gluteal cleft deviation': 1, 'injury to gluteal vessels': 1, 'Perianal and gluteal burns': 1, 'gluteal abscess and sinus': 1, 'gluteal and perianal disease': 1, 'infected gluteal': 1, 'infected tooth sockets': 2, 'Gluteal Tendon Tears': 2, 'gluteal volume defect': 1, 'asymmetry of gluteal folds': 1, 'thigh and gluteal injuries': 1, 'SGA aneurysms': 2, 'SGA aneurysm': 1, 'gluteal artery pseudo-aneurysms': 1, 'gluteal swellings': 3, 'superior gluteal artery (SGA) aneurysms': 1, 'aneurysms of the gluteal artery': 1, 'gluteal pseudoampulla': 1, 'Gluteal artery aneurysm': 1, 'axillary and gluteal lesions': 1, 'gluteal veins': 1, 'cutaneous gluteal mass': 1, 'gluteal region': 2, 'swelling of the gluteal artery': 1, 'gluteal arteritis': 1, 'gluteal damage': 1, 'gluteal motor weakness': 1, 'deviation of the gluteal crease': 1, 'gluteal palpable mass': 1, 'gluteal myofascitis': 1, 'WACI': 1, 'Gluteal Necrosis': 1, 'tooth extraction socket bleeding': 1, 'gluteal nodules': 1, 'gluteal and perineal swelling': 1, 'gluteal,': 2, 'gluteal, genital injury Disposition': 1, 'gluteal impalement injuries': 1, 'gluteal region impalement injury': 1, 'gluteal and perineal rhabdomyosarcoma': 1, 'granuloma gluteal adultorum': 1, 'injuries of the gluteal arteries': 1, 'deep gluteal space syndrome': 1, 'Cold Wallet': 1, 'hip socket injuries': 1, 'gluteal ischaemia': 3, 'Wallet Friendliness': 1, 'Superior gluteal artery injuries': 1, 'gluteal weakness and dysfunction': 1, 'tubercular gluteal sinuses': 1, 'deep gluteal nerve syndrome': 1, 'perineal and gluteal defect': 1, 'gluteal irritation': 1, 'gluteal rhabdomyosarcoma': 1, 'gluteal involuntary movements': 1, 'gluteal dyskinesia': 1, 'Bilateral gluteal dyskinesia': 1, 'Gluteal Dyskinesia': 1, 'deviated gluteal fold': 1, 'sub-gluteal pain': 1, 'SGA lesion': 1, 'injury of the superior gluteal artery': 3, 'Gluteal skin necrosis': 1, 'Painful Gluteal Purpura': 1, 'gluteal, thigh, and calf pain': 1, 'gluteal fold mass': 1, 'gluteal cleft deviation': 4, 'Gluteal dysfunction': 2, 'hypoplastic gluteal musculature': 1, 'gluteal depression': 1, 'hip socket': 2, 'gluteal lipoatrophy': 3, 'gluteal and sacral': 1, 'granuloma gluteal infantum/adultorum': 1, 'Granuloma gluteal adultorum': 1, 'DGO': 1, 'deep gluteal muscle damage': 1, 'DGT': 1, 'gluteal tendon pain': 1, 'gluteal tendon abnormalities': 2, 'asymmetry of the gluteal fold': 1, 'gluteal disease': 2, 'deep gluteal, and piriformis syndromes': 1, 'genital and gluteal lesions': 2, 'gluteal and genital lesions': 1, 'gluteal-genital lesions': 1, 'gluteal obstruction': 1, 'gluteal tendon enthesitis': 1, 'SGV bundle injury': 1, 'gluteal-swelling': 1, 'palsy of the gluteal nerve': 1, 'gluteal fibrous mass': 1, 'gluteal contour abnormalities': 1, 'pseudoradicular (gluteal) pain': 1, 'Gluteal granuloma': 4, 'scalp and inter-gluteal lesions': 1, 'gluteal nerve injuries': 1, 'disability of GF': 1, 'gluteal area necrosis': 1, 'gluteal cysts': 2, 'Gluteal pigmentation': 1, 'gluteal pigmentation': 1, 'gluteal and perineal': 1, 'gluteal hypermalacia atrophicans syndrome': 1, 'Wallet depigmentation': 1, 'gluteal cleft trichoblastic carcinoma': 1, 'Gluteal, and Perianal Abscesses': 1, 'Gluteal-artery aneurysm': 1, 'gluteal disorders': 5, 'gluteal amyloidoma': 1, 'gluteal wound': 1, 'abscess of gluteal region': 1, 'gluteal fold abscess': 1, 'ischiorectal and gluteal abscesses': 1, 'gluteal dermatitis': 2, 'Superior gluteal artery steal syndrome': 1, 'and inferior gluteal neuropathies': 1, 'atherosclerotic gluteal artery aneurysm': 1, 'Aneurysm of the gluteal artery': 4, 'GAA': 2, 'granuloma gluteale': 2, 'deformed gluteal clefts': 1, 'gluteal clefts': 3, 'Deformed gluteal clefts': 1, 'Senile Gluteal Dermatosis': 2, 'Gluteal Dermatosis': 2, 'granuloma gluteale infantum/adultorum': 1, 'gluteal dimpling': 1, 'gluteal crease asymmetry': 1, 'deep gluteal pain syndromes': 1, 'Gluteal Artery Injury': 1, 'tear of the gluteal tendon': 1, 'Aneurysms of the gluteal artery': 1, 'gluteal region abnormalities': 1, 'paraspinal/gluteal abscesses': 1, 'The Deep Gluteal Syndrome': 1, 'Deep gluteal disorders': 1, 'perianal and gluteal abscesses': 1, 'GTR': 1, 'gluteal nerve paralysis': 1, 'gluteal impairment': 1, 'Gluteal amyotrophy': 1, 'supra-gluteal cutaneous neuralgia': 1, 'gluteal fold lesion': 1, 'gluteal symptoms': 2, 'gluteal pathology': 1, 'gluteal schwannoma': 1, 'gluteal and sacral tumors': 1, 'perineal/gluteal avulsion': 1, 'LSGAP': 1, 'porokeratosis of the gluteal cleft': 2, 'Gluteal sores': 1, 'lumbosacral and gluteal pain': 2, 'gluteal ulcerations': 1, 'Gluteal Artery Pseudo Aneurysm': 1, 'gluteal artery pseudo aneurysm': 1, 'gluteal deficiencies': 1, 'Damage of the superior gluteal nerve': 1, 'gluteal induration': 2, 'superior gluteal artery (SGA) lesions': 1, 'proximal and gluteal weakness': 1, 'gluteal artery laceration': 1, 'bleeding tooth socket': 2, 'GLUTEALS': 1, 'lumbar and gluteal defects': 1, 'gluteal and lumbar defects': 1, 'Gluteal cleft asymmetry': 1, 'tooth socket bleeding': 1, 'Tuberculous gluteal abscess': 3, 'iliacus and gluteal myositis': 1, 'idiopathic deep gluteal syndrome': 1, 'Idiopathic Deep Gluteal Syndrome': 1, 'gluteal region swelling': 1, 'GFF': 1, 'paraspinal-gluteal mass': 1, 'gluteal vessel damage': 4, 'gluteal calcinosis': 1, 'gluteal and "retrotrochanteric" pain syndromes': 1, 'gluteal and thigh abscess': 1, 'Gluteal Abscesses': 1, 'gluteal infection': 3, 'gluteal space disorders': 1, 'Gluteal cyst': 1, 'gluteal/hip abductor weakness': 1, 'tooth socket infection': 1, 'Gluteal neuralgia': 1, 'Gluteal syndrome': 2, 'injury of the superior gluteal Artery': 1, 'gluteal artery syndrome': 1, 'gluteal AVM': 2, 'sacro-gluteal AVM': 1, 'Gluteal cirsoid aneurysm': 1, 'the gluteal medius': 1, 'atrophic gluteal changes': 1, 'gluteal hernia': 1, 'gluteal concave deformity': 1, 'DGP': 1, 'gluteal/perineal necrosis': 1, 'gluteal metastatic lesion': 1, 'injury to the superior gluteal artery': 1, 'gluteal papulo-erosive dermatitis': 1, 'gluteal cuff lesions': 1, 'gluteal lipoinjection': 1, 'Gluteal Lipoinjection': 2, 'Gluteal Syndrome': 3, 'gluteal ulceration': 1, 'thigh, gluteal and trunk': 1, 'hip, deep gluteal, and groin pain': 1, 'tooth socket loss': 1, 'Gluteal necrotizing myofascitis': 1, 'loss of gluteal musculature': 1, 'superior gluteal artery (SGA) injury': 2, 'buttock (deep gluteal) pain': 1, 'gluteal or perineal necrosis': 1, 'gluteal and skin necrosis': 1, 'gluteal-sacral defect': 1, 'the gluteal region': 1, 'Gluteal Lipoma': 1, 'gluteal deficiency': 2, 'gluteal and/or groin pain': 1, 'gluteal or inguinal pain': 1, 'gluteal hip pain': 1, 'gluteal syndrome of Steindler': 1, 'Adult gluteal granuloma': 1, 'AGG': 1, 'pudendal, gluteal pain': 1, 'Cruro-vesico gluteal dystrophy': 1, 'gluteal tears of the hip': 1, 'tooth extracted socket': 1, 'superior gluteal neuropathy': 1, 'gluteal tendinopathyHuman': 1, 'Gluteal tendon abnormalities': 1, 'Gluteal Tendon Disease': 1, 'gluteal tendon disease': 1, 'Utero-gluteal fistula': 1, 'asymmetry of gluteal creases': 1, 'gluteal varicosis': 1, 'rectal/gluteal abscess': 1, 'dry gluteal necrosis': 1, 'Gluteal comp syndrome': 1, 'gluteal nerve damage': 3, 'gluteal cleft deviations': 1, 'gluteal nerve': 1, 'gluteal fatty': 1, 'gluteal fatty infiltration': 1, 'gluteal or back trauma': 1, 'sigmoido-gluteal fistula': 1, 'Sigmoido-gluteal fistula': 1, 'avulsion injury of the gluteal aponeurosis': 1, 'gluteal tophi': 1, 'gluteal hyperkeratotic plaques': 1, 'gluteal, thigh and calf pain': 1, 'Gluteal Muscular Fibrosis': 1, 'spinal cutaneous or gluteal cleft malformation': 1, 'gluteal injection injury': 1, 'GLUTEAL REGION': 1, 'quadricipital and gluteal muscular hypotrophy': 1, 'Postoperative Deep Gluteal Syndrome': 1, 'Postoperative Deep Gluteal Syndromea': 1, 'ano-gluteal fistula': 1, 'sacral/gluteal tumors': 1, 'gluteal calcifications': 1, 'gluteal-perineal abscess': 1, 'Senile gluteal dermatoses': 1, 'SGD ulcers': 1, 'WALLET OPERATION': 1, 'gluteal abductor deficiency': 1, 'Sacral and gluteal defects': 1, 'gluteal or skin necrosis': 1, 'multicystic gluteal lesion': 1, 'lumbar gluteal myofasciitis': 1, 'gluteal lipodystrophy': 1, 'to the superior gluteal nerve': 1, 'gluteal pits': 1, 'gluteal dysfunction': 2, 'Gluteal aneurysm': 2, 'Gluteal infections': 1, 'Sciatica and pseudosciatica': 1, 'sciatica and pseudosciatica': 1, 'ulcerated gluteal mass': 1, 'gluteal folds': 1, 'sacral/gluteal tissue injury': 1, 'atrophy of the gluteal musculature': 1, 'gluteal dystrophic calcification': 1, 'gluteal tendon dysfunction': 1, 'Gluteal artery injury': 1, 'Injury and dysfunction of the gluteals': 1, 'ocular socket': 1, 'Gluteal tears': 1, 'Buttock (gluteal) pain': 1, 'lumbo-gluteal pain': 1, 'GLUTEAL SPACE DEFINITION': 1, 'gluteal subcutaneous tumor': 1, 'AGB': 1, 'posttraumatic gluteal mass': 1, 'Gluteal Injuries': 1, 'gluteal skin infections': 1, 'hypotrophy of the gluteal musculature': 1, 'inguinal or gluteal pain': 1, 'mesenteric and gluteal lesions': 1, 'Injury of the superior gluteal nerve': 1, 'colo-gluteal fistula': 1, 'gluteal and lower limb hypoplasia': 1, 'gluteal hemangioma': 1, 'gluteal heamangioma': 1, 'gluteal tendinopathyLong': 1, 'gluteal or buttock pain': 1, 'gluteal tearing': 1, 'deep gluteal mycosis': 1, 'aneurysm of the gluteal artery': 1, 'gluteal or anal pain': 1, 'lumbar and gluteal fibrositis': 1, 'Gluteal fistulo-gummatous syndrome': 1, 'gluteal or sciatic symptoms': 1, 'gluteal cleft DTPI': 1, 'gluteal lipodistrophy': 1, 'gluteal and hip pain': 1, 'gluteal aches': 1, 'aneurysm of the right gluteal artery': 1, 'posterior and gluteal pain': 1, 'deep gluteal piriformis syndrome': 1, 'gluteal neurovascular injury': 1, 'Gluteal sore': 1, 'deformity of the hip socket': 1, 'gluteal cleft anomalies': 1, 'gluteal syndromes': 1, 'Wallet hip': 1, 'Gluteal tendionpathy': 1, 'gluteal tendon': 1, 'Hip socket wear': 1, 'gluteal/rectal psoriasis': 1, 'gluteal MU': 1, 'GLU': 1, 'gluteal tendinobursitis': 1, 'gluteal hip extensor weakness': 1, 'gluteal area pain': 1, 'gluteal and inguinal pain': 1, 'Gluteal angioma': 1, 'gluteal mass lesion': 1, 'gluteal artery lesions': 1, 'gluteal painful mass': 1, 'Gluteal dermatitis': 1, 'Gluteal Pain Syndrome': 1, 'Tooth Socket': 1, 'gluteal flattening': 1, 'Perforating gluteal artery': 1, 'and gluteal': 1, 'gluteal lines asymmetry': 1, 'gluteal, thigh, or lateral pain': 1, 'gluteal irregularities': 1, 'Gluteal sarcoma': 1, 'hip socket arthroplasties': 1, 'gluteal artery': 1, 'Gluteal lipodystrophy': 1, 'gluteal oedema': 1, 'Gluteal Tendon Tear': 1, 'gluteal and bladder necrosis': 1, 'pulsatile gluteal masses': 2, 'gluteal and coccygeal pain': 1, 'gluteal subcutaneous lipoma': 1, 'unilateral gluteal hypoplasia': 1, 'SGR': 1, 'gluteal purpuric lesions': 1, 'gluteal myonecrosis': 1, 'gluteal fascia injury': 1, 'gluteal pressure asymmetry': 1, 'gluteal papules': 1, 'and gluteal epitheliolyses': 1, 'SGN terminal branch lesions': 1, 'buttock/gluteal pain': 1, 'Buttock/Gluteal Pain': 1, 'Gluteal Artery Aneurysm': 1, 'Gluteal trauma': 1, 'thigh and gluteal swelling': 1, 'gluteal, perineal, and scrotal burns': 1, 'gluteal and/or hip pain': 1, 'hip socket wear': 1, 'PPD': 1, 'posterior gluteal (buttock) pain': 1}
|
gluteal abscess
|
Disease
|
MESH:C531784
|
{'type I PRP': 12, 'PRP type VI': 1, 'PRP type I': 5, 'Type III (classic juvenile) PRP': 1, 'pityriasis rubra pilaris type V': 3, 'pityriasis rubra pilaris (PRP) type V': 4, 'pityriasis rubra pilaris type III': 2, 'PRP (type 4)': 1, 'pityriasis rubra pilaris type IV': 2, 'Familial Pityriasis Rubra Pilaris': 1, 'type II pityriasis rubra pilaris': 3, 'type I pityriasis rubra pilaris': 4, 'type-II PRP': 1, 'circumscribed pityriasis rubra pilaris (type IV)': 1, 'Familial pityriasis rubra pilaris': 11, 'familial pityriasis rubra pilaris': 8, 'Type II PRP': 1, 'type II PRP': 5, 'type III PRP': 5, 'type-I PRP': 1, 'PRP type II': 1, 'Pityriasis rubra pilaris type V': 2, 'type III pityriasis rubra pilaris': 1, 'PRP (type I)': 1, 'PRP type I and type IV': 1, 'Pityriasis Rubra Pilaris Type V': 1, 'PRP type V': 6, 'type V PRP': 7, 'juvenile (type III) PRP': 1, 'PRP type I.': 2, 'pityriasis rubra pilaris type I': 1, 'type 1/type 2 PRP': 1, 'PRP, type IV': 2, 'adult type 1 PRP': 1, 'pityriasis rubra pilaris variant type III': 1, 'pityriasis rubra pilaris type VI': 1, 'PRP (type V)': 1, 'PRP type V.': 1, 'Type I PRP': 1, 'PRP types III-V': 2, 'pityriasis rubra pilaris type I.': 1, 'pityriasis rubra pilaris (PRP) type I': 1, 'Pityriasis rubra pilaris, type IV': 1, 'Type III PRP': 1, 'familial PRP': 5, 'PRP type III': 1, 'erythrodermic PRP type I': 1, 'type I and IV pityriasis rubra pilaris': 1, 'type IV pityriasis rubra pilaris': 2, 'type VI PRP': 2, 'Pityriasis rubra pilaris type IV': 1, 'Type I pityriasis rubra pilaris': 2, '(type I) PRP': 1, 'type 3 PRP': 1, 'type III (classic juvenile) PRP': 1, 'Familial PRP': 3, 'pityriasis rubra pillaris type 1': 1, 'Adult pityriasis rubra pilaris (PRP) type 1': 1, 'Pityriasis rubra pilaris (type I)': 1, 'Type V Pityriasis Rubra Pilaris': 1, 'type V Pityriasis rubra pilaris': 1, 'type I and type II PRP': 1, 'type III juvenile pityriasis rubra pilaris': 1, 'type IV juvenile pityriasis rubra pilaris': 1, 'PRP (type IV': 1, 'type IV PRP': 3, "Griffiths' type IV PRP": 1, 'type III) pityriasis rubra pilaris': 1, 'Type 4 PRP': 1, 'type 4 PRP': 1, 'eczematous type II PRP': 1}
|
type I PRP
|
Disease
|
MESH:C531791
|
{'familial idiopathic priapism': 1, 'Idiopathic priapism': 19, 'Familial idiopathic priapism': 1, 'idiopathic priapism': 36, 'Idiopathic neonatal priapism': 2, 'Idiopathic Stuttering Priapism': 1, 'Idiopathic recurrent priapism': 1, 'idiopathic recurrent priapism': 1, 'IIP disease': 1, 'IIP': 1, 'Idiopathic ischemic priapism': 1, 'idiopathic neonatal priapism': 1, 'Idiopathic stuttering priapism': 2, 'idiopathic stuttering priapism': 2, 'Idiopathic Low-Flow Priapism': 1, 'Idiopathic HF priapism': 1}
|
idiopathic priapism
|
Disease
|
MESH:C531795
|
{'IIHWOP': 33, 'IIH without papilledema': 8, 'idiopathic intracranial hypertension without papilledema': 17, 'hypertensive papilledema': 3, 'IIIWP': 1, 'papilledema IH': 1, 'intracranial hypertensive papilledema': 1, 'Idiopathic Intracranial Hypertension Without Papilledema': 2, 'PIIHWOP': 1, 'Idiopathic Intracranial Hypertension without Papilledema': 1, 'Idiopathic intracranial hypertension without papilledema': 3, 'IIHWP': 2, 'idiopathic intracranial hypertension with papilledema': 1, 'intracranial hypertension without papilledema': 1, 'IHWOP': 1, 'IIHWOP headache': 1, 'IIH WOP': 1, 'Papilledema of intracranial hypertension': 1, 'IIH-WOP': 1}
|
IIHWOP
|
Disease
|
MESH:C531816
|
{'Adenosine deaminase (ADA) deficiency': 84, 'SNSF': 15, 'adenosine deaminase deficiency': 681, 'gas bubble disease': 47, 'Hubble-bubble': 2, 'ADA': 2852, 'adenosine deficiency': 40, 'cytosine deaminase': 9, 'Ada deficiency': 2, 'TE-ADA': 6, 'ADA hyperactivity': 1, 'ADA- SCID': 6, 'ADO': 127, 'double-bubble deformity': 27, 'AMP deaminase deficiency': 32, 'CD': 96, 'ADA-SCID': 470, 'adenosine-deaminase SCID': 1, 'Spherocytosis, type 1 AD': 1, 'AD': 49, '3 AD': 1, 'ADA-d': 1, '- or poly(ADP-ribosyl)ation': 1, 'bCPAP': 40, 'hyperactive urinary bubble': 1, 'ADENOSINE TRIPHOSPHORIC': 1, 'CAVITATION BUBBLES': 1, 'ADENOSINE RECEPTORS A2A AND A2B': 1, 'ADAR editome': 1, 'TD': 10, 'Deficiency of ADA': 2, 'ADA deficiency': 539, 'ADENOSINE RECEPTORS': 19, 'BPL': 2, 'ADA.CM': 2, 'Adenosine deaminase deficiency': 109, 'Coracao-de-Boi': 1, 'OBL': 17, 'dry bubble disease': 25, 'BOIs': 4, 'SPHN': 16, 'ADA-': 30, 'ADA-deficiency': 37, 'ADA-deficient': 138, 'deficiency of Ado deaminase': 1, 'ascites adenosine deaminase': 1, 'SW': 2, 'ADA-deficient SCID': 42, 'deficiency in adenosine deaminase': 2, 'ADA SCID': 45, 'BE': 3, 'SHP II': 1, 'SHP I': 1, 'SHP': 32, 'ADENOSINE': 96, 'ADA) deficiency': 14, 'Deficiency of adenosine desaminase': 1, 'Adenosine Desaminase (': 1, 'ADA deficient SCID': 6, 'Adenosine Deaminase (ADA) Deficiency': 2, 'swiss': 4, 'adenosine': 78, 'IBS': 1, 'eye bubble': 1, 'congenital deficiency of ADA': 1, 'Adenosine-': 3, 'ADA type IV stones': 1, 'Air bubbles': 3, 'SNB': 2, 'NAD': 1, 'adenosine deaminase immunodeficiency': 3, 'ADENOSINE MYOCARDIAL': 1, 'adenosine deaminase-deficient': 50, 'adenosine deaminase (ADA) deficiency': 188, 'ADP receptor abnormality': 1, 'Nk': 6, 'Adenosine Deaminase-deficient Severe Combined Immunodeficiency': 1, 'Adenosine Deaminase': 2, 'adenosine deaminase deficient': 14, 'VB': 2, 'ADA enzyme deficiency': 5, 'SPA': 2, 'mADA': 1, 'adenosine deaminase': 81, 'adenosine deaminase-severe combined immunodeficiency': 14, 'ADA-SCID GT': 1, 'deficiency of adenosine deaminase': 54, 'NECA': 23, 'deficiency of porhobilinogen (PBG) deaminase': 1, 'BUBBLE': 2, 'adenosine deaminase (ADA)-deficient': 11, 'venous bubbles': 6, 'ADENOSINE DEAMINASE': 11, 'FGD Boys': 1, 'bubbles': 38, 'ADO deficiency': 3, 'NSA': 2, 'activation-induced cytidine deaminase (AID) deficiency': 5, 'AID TARGETS': 1, 'inherited adenosine deaminase deficiency': 5, 'adenosine deaminase (ADA) deficient': 6, 'pADA': 3, 'adenosine deaminase (ADA)-deficiency SCID': 1, 'curetage du bois': 1, 'Deficiency of red-blood-cell adenosine deaminase': 1, 'Adenosine-deaminase deficiency': 5, 'BFFT': 1, 'SNC': 24, 'bubble': 55, 'Adenosine Deaminase Deficiency': 17, 'deficiency of ADA': 13, 'adenosine deaminase deficiency-induced SCID': 1, 'AID deficiency': 78, 'Adenosine deaminase severe combined immunodeficiency': 1, 'ADA-SCID NBS': 1, 'MSI2-ADA': 2, 'adenosine deaminase-deficient severe combined immune deficiency syndrome': 1, 'Deficiency of Adenosine Deaminase': 1, 'Adenosin desaminase deficiency': 1, 'ADAR-related type I interferonopathy': 1, 'ADA-2 Deficiency': 1, 'ADAR': 44, 'GBD': 24, 'adenosine deaminase (ADA-SCID) deficiency': 1, 'ADP': 42, 'AMPD deficiency': 9, 'AMP Deaminase': 1, 'SLFS': 3, 'BC': 5, 'Adenosine deaminase': 8, 'bubble palate': 2, 'A3 deficiency': 1, 'Boy Sleep': 1, 'activation-induced cytidine deaminase deficiency': 5, 'gas bubble': 1, 'SAH': 9, 'Adenosine Dysfunction': 3, 'gas bubble disease of': 1, 'Adenosine-deaminase': 1, '1 BB': 3, '2 BB': 4, 'BB': 14, 'Type 1 BB': 1, 'Type 2 BB': 2, 'STCS': 21, 'SPAC': 2, 'double-bubble and waterfall deformity': 1, 'Double-bubble deformity': 2, 'Boy': 48, 'subretinal bubbles': 2, 'SENSITIVITY OF THREONINE DEAMINASES': 1, 'ADENOSINE COUNTERS': 1, 'ADENOSINE EFFECTS': 1, 'Adenosine deaminase (ADA; EC 3.5.4.4) deficiency': 1, 'SNCTP': 3, 'Bubble Hair-Deformed': 2, 'Adenosine deaminase deficiency severe combined immunodeficiency': 1, 'BN': 31, 'Bois noir': 23, 'Deficiency of adenosine deaminase': 15, 'ADA-2 deficiency': 4, 'SSN': 3, 'Adenosine dysfunction': 3, 'ADA disease': 1, 'deficiency of the enzyme adenosine deaminase': 3, 'deaminase': 8, 'Bois noir disease': 9, 'Pipette boy': 3, 'ado': 1, 'Ado': 5, 'CDA deficiency': 17, 'Adenosine': 13, 'ADA deficient': 31, 'bubble trauma': 2, 'ARs': 37, 'ADENOSINE ANALOGS': 1, 'PPAD': 1, 'adenosine deaminase-deficient SCID': 8, 'SWISS': 30, 'SHS': 24, 'STPHI': 1, 'BTMP': 1, 'CDA enzyme deficiency': 1, 'ADA-F': 1, 'ADA-R': 1, 'Boys': 14, 'deficiencies of adenosine deaminase': 4, 'Adenosine deaminase (ADA)-deficient': 3, 'STI': 6, 'congenital defect of adenosine deaminase 1': 1, 'SCID-ADA': 11, 'pela deficiencia de adenosine deaminase': 1, 'bubble disease': 16, 'Bubble Boy Disease': 1, 'threonine deaminase': 7, '-ADP': 5, 'BSD': 4, 'Bois Noir': 7, 'ARF': 8, 'APS': 35, 'adenosine allergy': 1, 'Deficiency of ADAR': 1, 'Junction Boys syndrome': 1, 'SPSU': 2, 'ADA Deficiency': 15, 'autosomal recessive activation-induced cytidine deaminase (AID) deficiency': 1, 'eADA': 8, 'lack of adenosine deaminase': 1, 'bois noir"': 2, 'congenital adenosine deaminase deficiency': 1, 'bOIS': 1, 'ADA type II periodontitis': 1, 'ADA types II-IV periodontitis': 1, 'ADA type I)': 1, 'ADA type III-IV periodontitis': 1, 'Bubble': 6, 'Aicda': 2, 'adenosine deaminase (ADA': 6, 'bubble boy syndrome': 2, 'ALM': 13, 'ADPbetaS': 1, 'Air - bubble': 1, 'adenosine deaminase (ADA)-SCID': 3, 'SCID ADA': 3, 'OF ADENOSINE': 2, 'DBs': 1, 'NKs': 5, 'Adenosine system deficiencies': 1, 'Adenosine deaminase deficiency-SCID': 1, 'ADENOSINE DIPHOSPHATE': 27, 'deficiency of AMPD1': 1, 'AMPD1 deficiency': 1, 'iPA': 2, 'Bois-': 1, 'Boy Scouts': 15, 'TCD bubble': 1, 'BS': 22, 'APLs': 3, 'cytosine deaminases': 3, 'Adenosine Deaminase Severe Combined Immunodeficiency': 1, 'Bois': 14, 'AICDA': 22, 'Mara des Bois': 2, 'APSe': 2, 'AR': 10, 'MECA': 2, 'BURSTING THE BUBBLE': 1, 'Adenosine Deaminase-SCID': 1, 'adenosine deaminase deficient-SCID': 1, 'Danny Boy': 1, 'ADP aggregation': 5, 'ADA-/-': 2, 'cerebral vascular bubbles': 1, 'double bubble': 13, 'BIS': 1, 'SCID ADA deficient': 1, 'adenosine deaminase (ADA) enzyme deficiency': 2, 'cAID': 1, 'bubble tea': 2, 'deoxycytidylate deaminases': 1, 'ADA deficiency 6': 1, 'Pipette Boy': 1, 'ADAC': 7, 'Type IV ADA': 1, 'ADA Antidrug antibody': 1, 'Bubble hair deformity': 1, 'bubble hair deformity': 2, 'mC deaminase': 3, 'bubble boy disease': 9, 'adenosine deaminase deficiency SCID': 5, 'adenosine, cytosine, and guanine deaminases': 1, 'BOMA': 1, 'ADA;USPI': 1, 'leaf bubbling': 1, 'tADA': 3, 'ADAR deficiencies': 1, 'AMP deaminase-': 1, 'CB': 1, 'MB': 5, 'Swiss type agammaglobulinemia': 1, 'adenosine-deaminase deficiency': 11, 'SIPEI': 1, 'STS': 1, 'CLASS OF ADENOSINE DEAMINASE': 1, 'SIB': 10, 'CCA': 1, 'nK': 5, 'BMNs': 1, 'Deficiency of muscle AMP deaminase': 1, 'ADenosine Vasodilator': 1, 'AVS': 2, 'CD deficiency': 1, 'ADP-HPD': 2, 'Air bubble': 11, 'ADA-VI-1': 1, 'FSP': 2, 'Ade': 2, 'A-TTE': 1, 'adenosine deaminase severe combined immunodeficiency': 22, 'Adenosine deaminase (ADA) deficiency 1': 1, 'PB': 1, 'HIV-ADA infected': 1, 'ADA-C.': 1, 'ADA-C': 1, 'TPBT': 3, 'ADA dysfunction': 4, 'ALLOSTERIC PROPERTIES OF BIOSYNTHESIZED L-THREONINE DEAMINASE': 2, 'poly(ADP-ribosyl)ation': 1, 'PARylation': 2, 'SWISS-PROT': 5, 'block of the adenosine receptor': 1, 'adenosine deaminase-deficient severe combined immune deficiency': 7, 'bois noir disease': 10, 'bois noir': 25, 'Boy Scout': 6, 'SB': 2, 'ADA deficients': 1, 'ABD': 2, 'T-B-NK- ADA deficiency': 1, 'ADENOSINE-5': 3, 'ARRI': 1, 'ADA genetic deficiency': 2, 'AID-deficient': 23, 'ALLOSTERIC PROPERTIES OF BIOSYNTHETIC L-THREONINE DEAMINASE': 2, 'ASYMMETRIC BUBBLE EXPANSION': 1, 'BoB': 1, 'bois de rose': 1, 'Speech bubble': 2, 'AMP deaminase-deficient': 1, 'Ecto-adenosine-deaminase': 1, 'ADAs': 2, 'N6-methyladenine deaminase': 1, 'pian-bois': 1, 'CDA deficiency syndrome': 1, 'adenosine deaminase-deficient severe combined immunodeficiency': 22, 'CDD': 7, 'dry bubble': 6, 'Boy 2': 1, 'congenital Swiss-type agammaglobulinemia': 1, 'Cerebellar soap bubble lesions': 1, 'Type-1 BB': 1, '-2 BB': 1, 'ADA 4': 1, 'FEBs': 1, 'pian bois': 3, 'adenosine deaminase (EC 3.5.4.4) deficiency': 1, 'CCPA': 1, 'Adenosine deaminase (': 6, 'inherited deficiencies of adenosine deaminase and': 1, 'Adenosine deaminase SCID': 2, 'Dry Bubble Disease': 3, 'DBD': 1, 'Dry bubble disease': 5, 'Dry bubble': 2, 'Congenital deficiency of the enzyme adenosine deaminase': 2, 'adenosine ADA deficiency': 1, 'Bois Noir disease': 5, 'Bubble-': 1, 'venous bubble': 4, 'bubble syndrome': 2, '-ADA': 1, 'Deficiency of AMPD': 1, 'soap-bubble lesion': 3, 'CDA': 3, 'SDPI': 1, 'Bubble-Wrapping Halloween': 1, 'ADENOSINE DIPHOSPHATE POOL': 1, 'inherited deficiency of adenosine deaminase': 1, 'Boi-PH': 1, 'air bubble': 5, 'ADA- SCIDs': 1, 'AID TARGETING': 1, 'adenosine deaminase (': 5, 'ADA)': 2, 'bois noir (BN)': 1, 'Bois Noir Disease': 1, 'BN symptom': 1, 'OPLS-AA': 1, "bois noir'": 1, 'Bubbling Cell Death': 2, 'type 1 BB': 2, 'type 2 BB': 4, 'ADN': 4, 'bubble lesions': 4, 'Boys and Girls': 1, 'ADA 3': 1, 'ADA-B': 4, 'adenosine deaminase [ADA] deficiency': 1, 'fixationACC-deaminase': 1, 'MBs': 6, 'Adenonsine-deaminase': 1, 'hAID': 9, 'ADA-deficit': 2, 'SMASS': 1, 'dry-bubble': 2, 'adenosine deaminasedeficiency': 1, 'adenosine deaminase deficient severe combined immunodeficiency': 7, 'Adenosine deaminase (ADA) deficient': 2, 'CVB': 1, 'AG': 1, 'NAG': 1, 'SCC': 6, 'PBG deaminase deficiency': 1, 'adenosine-deaminase-linked severe combined immunodeficiency': 1, 'GBS': 1, 'A(1)AR': 2, 'ADA-EASD': 1, 'ABF': 2, 'BF': 1, 'adenosine deaminase deficiency-severe combined immunodeficiency': 6, 'ADA disability': 2, 'ADA-SCIDMapping': 1, 'Bubble Boy Syndrome': 1, 'ABP': 1, 'SLS': 9, 'Adenosine carcinoma': 2, 'Aphis nerii Boy': 1, 'SLS-2': 1, 'soap bubble': 6, 'bOI': 2, 'adenosine deaminase (ADA) deficiency SCID': 3, 'Adar-related disease': 1, 'BUBBLING LAVA CHALLENGE': 1, 'late-onset adenosine deaminase deficient SCID': 1, 'Swiss agammaglobulinemia': 2, 'SCQM': 16, 'cytidine deaminase': 2, 'SWI': 1, 'ADENOSINE A2A': 3, 'Adenosine deficiency': 5, 'ADENOSINE RECEPTOR-DEPENDENT': 1, 'ADENOSINE TRIPHOSPHORIC ACID IN ANESTHESIA RESUSCITATION': 1, 'ISOLATION OF ADENOSINE DIPHOSPHATE': 1, 'nk': 15, 'adenosine-deaminase-deficient': 2, 'poly(ADP-ribosyl)': 2, 'MAADP': 3, 'deficiency in adenosine deaminase enzyme 1': 1, 'ADA1': 2, 'AID-deficiency': 11, 'feijao-de-boi': 1, 'TISSUE DISTRIBUTION OF ADENOSINE DEAMINASE': 1, 'inborn muscle AMP deaminase deficiency': 1, 'adenosine-deaminase-deficient severe combined immunodeficiency': 1, 'FBs': 1, 'FB': 1, 'Purple bubble': 1, 'hereditary deficiency of adenosine deaminase': 1, 'SCID1': 5, 'Double-Bubble Deformity': 2, 'SPAM': 2, 'Adenosine deaminase 1 deficiency': 2, 'SCID-adenosine deaminase (ADA) deficiency': 1, 'ADA-SCIDAdenosine': 1, 'activation induced cytidine deaminase': 2, 'adenosine phosphoribosyltransferase (APRT) deficiency': 1, 'ADP deficiency': 2, 'Boys & Girls': 2, 'SCID-adenosine deaminase': 1, 'Sissy Boy Syndrome': 2, 'CT.AMPD': 1, 'AMPD deficiencies': 2, 'BL': 4, 'IMPROVED AUTOMATIC BUBBLE FLOWMETER': 1, 'myoadenilate deaminase deficiency': 2, 'adenosine-deaminase deficient SCID': 2, 'ADA-deficient SCIDs': 3, 'Inherited Adenosine Deaminase (ADA) deficiency': 1, 'adenosine deaminase [ADA] deficient': 1, 'inborn adenosine deaminase deficiency': 1, 'Hereditary adenosine deaminase deficiency': 3, 'Bubble palate': 1, 'ALLOSTERIC PROPERTIES OF L-THREONINE DEAMINASE': 1, 'BIOSYNTHETIC L-THREONINE DEAMINASE': 2, 'Boys Toxicant': 1, 'AMPS': 2, 'AID-indep': 1, 'air bubbles': 5, 'Boy A': 1, 'BN-infected': 2, 'Mara des bois': 3, 'SHIS': 2, 'X-linked- or adenosine deaminase-deficient severe combined immunodeficiency': 1, 'SWISS INTEGRATION': 1, 'Deficiency of AMP deaminase': 2, 'Double Bubble': 1, 'ADA Omenn syndrome': 1, 'ADA defect': 1, 'ADA deficiency SCID': 3, 'ADA SCID Pt': 1, 'Adenosine deaminase (ADA)-deficient disease': 1, 'ADENOSINE PHOSPHATE-ISOPENTENYLTRANSFERASE': 1, 'water bubble disease': 2, 'Water Bubble Disease': 1, 'WBD': 2, 'Swiss-type agammaglobulinemia': 3, 'BCASD': 1, 'AMPD': 11, 'adenosine deaminase-SCID': 2, 'Crippled Boy': 1, 'bubble baby': 1, 'type-2 BB': 5, 'PURIFICATION OF CEREBRAL ADENOSINE DEAMINASE': 1, 'BBI': 1, 'CUB nk': 1, 'ADA-DAD': 1, 'Sal-AMS': 1, 'AID deficient': 2, 'deficiency of adenosine deaminase enzyme': 1, 'SO bubble': 1, 'STP': 4, 'Bubbling': 4, 'bubbling': 2, "ADENOSINE-5'-MONOPHOSPHORIC": 1, 'absence of ADA': 2, 'ADENOSINE DEAMINASE ACTIVITY': 1, 'gastrointestinal bubbles': 2, 'ADA occlusion': 1, 'adenosine deaminase-deficient immunodeficiency': 2, 'EPB': 2, 'EPBs': 2, 'Primary and Coincidental AMPD deficiency': 2, 'BML': 1, 'CIB': 1, 'neonatal onset adenosine deaminase-deficient severe combined immunodeficiency': 1, 'adenosine deaminase 1 deficiency': 1, 'deficiency of human ADA': 1, 'Girl Boy': 4, 'Venous bubble': 1, 'activation-induced cytidine deaminase': 6, 'adenosine deaminase-severe combined immunodeficiency disease': 1, 'ADA.DG': 1, 'ADA-deficiency SCID': 1, 'Bois-Tak': 1, 'boy': 2, 'bubble CPAP': 2, 'DSRAD': 1, 'adenosine deaminase (ADA) deficient SCID': 3, 'CDAs': 2, 'HB1.F3.CD': 1, 'PARG': 2, 'Adenosine Deaminase Type II Deficiency': 1, 'adenosine deaminase deficient combined immunodeficiency disease': 1, 'adenosine deaminase deficiency disease': 2, 'type-II bubbles': 1, '-1 BB': 1, 'ADA-Cog': 1, 'inherited or acquired adenosine deaminase deficiency': 1, 'inherited or acquired deficiency of adenosine deaminase': 1, 'EVOLUTION OF AID PHOSPHORYLATION': 1, 'AID ACCESS': 1, 'DNA deaminase': 11, 'subretinal bubble': 3, 'AID': 8, 'adenosine-deaminase': 4, 'adenosine deaminase or': 1, 'Adenosine Deaminase Deficiency-related Severe Combined ImmunoDeficiency': 1, 'SWISS NATIONAL SCIENCE FOUNDATION': 4, 'AMs': 1, 'AMP deaminase (AMPD3) deficiency': 1, 'Adenosine deaminase (ADA)-deficient severe-combined immunodeficiency': 1, 'Adenosine Deaminases Acting on RNA': 1, 'adenosine deaminases acting on RNA': 1, 'CADO': 1, 'Soap bubble': 6, 'adenosine deaminase deficiency severe combined immune deficiency': 1, 'ADA deficiency ADA 1/1': 1, 'AICDA impairment': 1, 'bois - Virus du papillome humain': 1, 'ADA- T': 1, 'Poly(ADP-ribosyl)ation': 1, 'MARylation': 2, 'Mono(ADP-ribosyl)ation': 1, 'Boy Bleeding': 1, 'Boy Biederstein': 1, 'MBP': 1, 'depressed boys': 1, "ADENOSINE-5'-DIPHOSPHATE": 1, "ADENOSINE-5'-METHYLENEDIPHOSPHONATE": 1, 'adenosine deaminase SCID': 5, 'Bois Noir"': 1, 'CTAD': 7, 'ADAT3 deficiency': 2, 'ADA-SCID 1': 1, 'Pericardial effusion adenosine deaminase': 1, 'adenosine deaminase (ADA)-deficiency': 5, 'precordial bubble': 1, 'OVERVIEW OF ADENOSINE RECEPTORS': 1, 'ADENOSINE RECEPTOR ACTIVATION': 1, 'AID-ON': 1, 'ANO': 1, 'adenosine desaminase deficiency': 1, 'BGC': 2, 'adenosine deaminase deficiencies': 4, 'Adenosine deaminase deficient': 2, 'ANP': 1, 'or A2A AR': 1, 'ADA-deficient SCID 1': 1, 'SDSC': 1, 'ADA defects': 1, 'A deaminase': 1, 'AID-': 3, 'AR-AID-deficient': 1, 'AD-AID': 2, 'SARON': 1, 'ADENOSINE NEGATIVE': 1, 'Inherited deficiency of adenosine deaminase': 2, 'Adenosine deaminase deficient-severe combined immunodeficiency': 1, 'X-linked and adenosine deaminase severe combined immunodeficiency': 1, 'INVESTIGATIONS ON ADENOSINE DIPHOSPHATE': 2, 'BI': 1, 'Lewy boies': 1, 'boys': 10, 'THEM BUBBLING AWAY': 1, 'DD': 9, 'GAS BUBBLE DISEASE': 1, 'langue de bois': 1, 'ADA"': 1, 'PCD': 1, 'Adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4': 1, 'ADA-COVID': 1, 'Bubbling brain': 2, 'ADENOSINE 5': 3, 'Severe Combined Immunodeficiency due to adenosine deaminase deficiency': 1, 'AMP deaminase (AMPD) deficiency': 1, 'AMPD-deficient': 2, 'BUBBLING HYDROGEN': 1, 'ADA infection': 5, 'hemorrhagic bubbles': 1, 'ARTs': 1, 'gas bubble lesions': 2, 'deficiency in the adenosine deaminase enzyme': 1, 'Deaminase': 1, 'Bois noir" (': 1, 'BN disease': 7, 'BN)': 2, 'Delinquent Boys': 1, 'double bubble deformity': 5, 'MICROSCOPY OF BUBBLE DYNAMICS': 1, 'Adenosine Deaminase deficiency': 5, 'BStac': 1, 'ADA anti-': 2, 'SHCS': 1, 'ADA-SP': 1, 'bubble defects': 1, 'BSW': 2, 'bad boy syndrome': 1, 'mCA': 1, 'SFOS': 1, 'deficiency of red cell adenosine deaminase': 1, 'type-1 BB': 2, 'adenosine-deficiency': 2, 'adenosine deaminase enzyme deficiency': 1, 'AUS': 1, 'Pian bois': 2, '-bubble': 4, 'Duchenne boy': 1, 'deficiency of AMP deaminase 1': 1, 'AMPD1': 1, 'NL-ADA-Lib': 1, 'pNL-ADA-Lib': 1, 'pNL-ADA': 1, 'Adora2b deficiency': 1, 'STPH': 1, 'adenosine deaminase (ADA) or gammac deficiencies': 1, 'adenosine-deaminase (A.D.A.) deficiency': 1, 'Swiss-': 1, 'SHURP': 1, 'adenosine deaminase deficiency-SCID': 2, 'ADENOSINE TRI-PHOSPHATE': 1, 'ATP': 2, 'pSEB-CD': 1, 'deficiency of ADP': 1, 'Adenosine Deaminase Deficient': 1, 'SPRR': 1, 'AID/AICDA': 1, 'adenosine diphosphate (ADP) receptor': 1, "Boy's": 1, "boy's": 1, 'adenosine deaminase (ADA-) deficient': 1, 'BAMs': 1, 'Adar hypomorphs': 1, 'Boy Labour': 1, 'ADA.C1': 1, 'ARL': 1, 'adenosine-to-inosine deaminase': 1, 'double-bubble': 3, 'Double-bubble': 1, 'Double-Bubble': 1, 'ADA1 deficiency': 2, 'bubble diseases': 2, 'A(1) ARs': 2, 'Air Bubble Defects': 1, 'Adenosine deaminiase': 1, 'Deficiency of adenosine': 1, 'deficiency of adenosine': 1, 'AMP-deaminase deficiency': 3, 'adenosine deaminase deficiency-related severe combined immunodeficiency': 3, 'ADENOSINE PATHWAY': 1, 'Bubble disease': 1, 'type 1 and type 2 BB': 1, 'X-linked or ADA SCID': 1, 'Severe combined immunodeficiency due to adenosine deaminase (ADA) deficiency': 1, 'SJL disease': 1, 'SAMS': 3, 'adenosine-deaminase-deficient SCID': 1, 'ADA[n': 1, 'Bois a grater': 1, 'bois a grater': 1, 'DEOXYCYTIDYLATE DEAMINASE': 2, 'adenosine diphosphate deficiency': 1, 'severe combined adenosine deaminase immunodeficiency': 1, 'Erythrocyte adenosine deaminase deficiency': 1, 'adenosine dysfunction': 6, 'SBg': 1, 'SBP': 1, 'Adenosine deaminase (ADA) deficiency': 1, 'Deficiency of red cell and lymphocyte adenosine deaminase': 1, 'adenosine deaminase deficient-severe combined immunodeficiency': 3, 'Combined immunodeficiency with adenosine deaminase (ADA) deficiency': 1, 'Activation-induced cytidine deaminase deficiency': 4, 'Adenosine deaminase-deficient severe combined immunodeficiency': 3, 'bubble boy"': 2, 'Adenosine Deaminase Deficiency15': 1, 'T-B-NK- Adenosine deaminase (': 1, 'Bubbles': 2, 'PCDs': 1, 'SDC': 1, 'ADA-Titerbestimmung': 1, 'X-linked and ADA-deficient SCID': 1, 'deaminase-deficient': 1, 'ADA-1-deficient': 1, 'ADA-1 deficiency': 1, 'Adenosine deaminase 1 (ADA-1) deficiency': 1, 'auditory bubble': 1, 'hearing bubble defect': 1, 'Bias Boy': 1, 'ONAB': 1, 'T-ADA': 1, 'bubble boy" syndrome': 1, "ADENOSINE-5'-N-METHYLURON": 1, 'ADENOSINE RECEPTOR': 13, 'AMP-deaminase-deficiency': 1, 'DYPD deficiency': 1, 'Dihydropyridine deaminase (DYPD) deficiency': 1, 'DPD deficiency': 1, 'Boy Stroke': 1, 'Speech bubbles': 1, 'SFOPH': 2, 'AMP deaminase': 3, 'gas-bubble lesion': 1, 'DCD': 3, 'DCD-DUT': 1, 'ADA-SCID disease': 2, 'SCO': 1, 'MDR-ADA': 1, 'BD': 1, 'BUBBLES': 1, 'adenosine diphosphate aggregation': 1, 'cytidine deaminase deficiency': 2, 'ADA-Def SCIDs': 1, 'ADA-Def': 2, 'ADA deficiencies': 3, 'ADA sealants': 1, 'adenosine hyperaemia': 2, 'ADARs': 3, 'Handicapped Boy': 1, 'OBLs': 1, 'bois noir infection': 2, 'bois noir-': 1, 'bois noir symptoms': 1, 'bois': 1, 'adenosine deaminases': 1, 'Cytidine deaminase deficiency': 3, 'hubble-bubble': 6, 'ORIGIN OF BUBBLES': 1, 'OF BUBBLES': 1, 'EFFECTS OF ADENOSINE': 4, 'ADA-deficient immunodeficient': 2, 'Adenosine Deaminase (ADA) deficient': 2, 'SPAC STUDY TEAM': 1, "PERMEABILITY OF 5'-METHYLTHIO-ADENOSINE": 1, 'hereditary deficiency of the enzyme adenosine deaminase': 1, '(ADP-ribosyl)': 1, 'deficiency of activation-induced cytidine deaminase': 2, 'bubble-eye goldfish': 1, 'Bubble-eye goldfish': 1, 'adenosine deaminase (ADA)-deficient severe combined immunodeficiency': 3, 'Adenosine Deaminase-deficient': 1, 'ADENOSINE DIPHOSPHATE': 1, 'Boy victims': 1, 'ADAR Deficiency': 1, 'adenosine deaminiase': 1, 'adenosine-deaminase-deficient severe combined immunodeficiency disease': 1, 'Swiss wrestling': 1, 'SSR': 1, 'cardiac bubbles': 1, 'Air-bubble': 1, 'ADA-severe combined immunodeficiency': 1, 'Bois-Reymond': 1, 'SN': 2, 'ADENOSINE PRECONDITIONING': 1, 'CDD-deficient': 1, 'AVSN': 1, 'adenosine deaminase deficiency severe combined immunodeficiency': 2, 'Adenosine Deaminase Deficiency Severe Combined Immunodeficiency': 1, 'congenital adenosine deaminase deficiency in severe immunodeficiency': 1, 'Bois noir (': 1, 'Bois noir (BN)': 1, 'Pian-bois': 1, 'PREDICT NASCENT BUBBLES': 1, 'ADENOSINE INFLUENCE': 1, 'ADENOSINE ORIGIN': 1, 'AEGL': 1, 'adenosine deaminase 2deficiency': 1, 'inherited deficiency of the adenosine deaminase': 1, 'adenosine deaminase-severe combined immunodeficieny': 1, 'Bois canot': 1, 'SPS': 2, 'adenosine deaminase deficiency severe combined immunodeficiency disease': 1, 'porphobilmogen deaminase (PBGD) deficiency': 1, 'SWICOS': 1, 'adenosine deaminase (ADA)-deficient SCID': 2, 'X-SCID1': 1, 'RS-SCID': 1, 'RS-SCID1': 1, 'X-linked form of SCID': 1, 'SCID': 1, 'X-linked SCID': 1, 'X-SCID': 1, 'AICDA Deficiency': 1, 'Adenosine Deaminase (': 1, 'ACID DEAMINASE': 1, 'deficiency of PBGD': 1, 'ADA(-/-)': 2, 'AF ADA': 1, 'NTB': 1, 'SBL': 1, 'Boy-to-Girl violence': 1, '-to-Boy violence': 1, 'adenosine deaminase deficiency-severe combined immunodeficiency disease': 1, 'Deficiency of cytidine deaminase': 1, 'adenosine MPS': 1, 'Activation-induced cytidine deaminase (': 1, 'adenosine deaminase (ADA)': 2, 'adenosine deaminase-': 4, 'Soap bubble lesion': 1, 'soap bubble lesion': 1, 'THREONINE DEAMINASE': 2, 'AID- and Ung-deficient': 1, 'ADA seroconversion': 1, 'Crohn ADA': 1, 'ADA case type 4': 1, 'adenosine deaminase severe combined immunoeficiency': 1, 'DCTD': 2, 'DCD-deficient': 1, 'DCD deficiency': 2, 'adenosine deaminase deficiency (ADA)-SCID': 1, 'ADA-deficiency SCIDS': 1, 'ADA (adenosine deaminase) deficiency': 1, 'CYTOSINE DEAMINASE': 1, 'gas bubble trauma': 2, 'GBT': 2, 'Sunrise Boys': 1, 'ADA severe combined immunodeficiency': 1, 'DROSOPHILA ADAR': 1, 'Boy scout': 1, 'SJES': 1, 'dADAR': 1, 'ADENOSINE-RELATED': 1, 'Bubbles in the brain': 2, 'ADOR': 2, 'Fruta-olho-de-boi stroke': 1, 'Urtiga boi': 1, 'BN infection': 3, 'NONSYNAPTIC ADENOSINE RECEPTORS': 1, 'EFFECT OF ADENOSINE ON': 1, 'Boy with seizures': 1, 'D. aurelianenseNeuville-aux-Bois': 1, 'SJNT': 1, 'air-bubbles': 1, 'CLD II': 1, 'Complete adenosine deaminase (ADA) deficiency': 1, 'pulmonary adenosine toxicity': 1, 'adenosine deaminase severe combined immune deficiency': 2, 'ADA-associated combination immunodeficiency': 1, 'ADA ID SCID': 1, 'bubble degeneration': 1, 'Adenosin deaminase (ADA) deficiency': 1, 'adenosine receptor': 1, 'Bois sign Infection': 1, 'ADAT': 2, 'Boys Girls': 1, 'APL': 6, 'Swiss syndrome': 3, 'ADA stenosis': 1, 'adenosine deaminase--deficiency severe combined immune deficiency syndrome': 1, 'adenosine deaminase [ADA]-SCID': 1, 'Isocytosine Deaminases': 1, 'AICD': 3, 'aicda': 1, 'ADA-SCIDS': 1, 'PROPERTIES OF BRAIN ADENOSINE DEAMINASE': 1, 'adenosine deaminase-deficient severe combined immunodeficiency disease': 2, 'ANC': 1, 'VITAMIN CONTROL OF THE ACTIVITY OF HEPATIC AND TESTICULAR ADENOSINE DEAMINASE': 1, 'AS': 2, 'Helium Bubble Damage': 1, 'helium bubble damage': 1, 'Helium bubble damage': 1, 'bubbly tail': 1, 'Bubbly tail': 1, 'adenosine deaminase and dihydropyrimidine dehydrogenase deficiencies': 1, 'CDUR': 1, 'Girl-Boy': 1, 'PDA': 1, 'Deficiency of activation-induced cytidine deaminase': 1, 'Aicda deficiency': 1, 'ADP dysfunction': 2, 'adenosine deaminase insufficiency': 1, 'Epileptic Boy': 1, 'AdoD': 1, 'Swiss-syndrome': 1, 'aggressive boys': 1, 'Adenosine deaminase-deficient severe combined immunodeficiency disease': 1, 'Adenosine Deaminase-Deficient Severe Combined Immunodeficiency Disease': 1, 'CCAAT': 3, 'ACCD': 1, 'Girl Boy': 1, 'Bubble Cooling': 1, 'AMP deaminase enzyme deficiency': 1, 'ADENOSINE DEAMINASES': 1, 'adenosine deaminase (ADA)-': 1, 'haus boi': 1, 'ADA deficiency 1': 1, 'Adenosine deaminase 1 (ADA1) deficiency': 1, 'EFS-ADA': 1, 'ADP receptor defect': 3, 'cerebral bubble': 1, 'ROLE OF ADENOSINE DIPHOSPHATE': 2, 'dry bubble symptoms': 1, 'GSDA': 1, "boys' lacrosse": 1, "Boys' lacrosse": 1, 'ADP-': 1, 'ADA 2 deficiency': 1, 'Inherited adenosine deaminase (ADA) deficiency': 2, 'DEAMINASE': 1, 'ADA- -SCID': 1, 'TadA-7.10': 1, 'ATP deficiency': 1, 'bubble related illness': 1, 'Bubbly bowel': 1, 'absence of adenosine deaminase': 2, 'Girls and Boys': 1, 'HIV-ADA': 2, 'Gas Bubble Disease': 1, 'CBC': 1, 'Gas bubble disease': 5, 'Adenosine deaminase-deficiency': 1, 'SMI': 1, 'swiss franc': 1, 'FUNCTION OF ADENOSINE': 1, 'Bois noir"': 1, 'ADS': 1, 'ADA-Mangel': 1, 'ADA partial deficiency': 1, 'X-linked and ADA SCID': 2, 'deficiency of the purine catabolic enzyme adenosine deaminase': 1, 'BLA': 1, 'SWISS NATIONAL': 1, 'UC ADA': 1, 'ADA deficit': 1, 'ADAR dependence': 1, 'ADAR deficiency': 2, 'Baby Boy': 1, 'ARH': 2, 'adenosine deaminase (A.D.A.) deficiency': 1, 'bubble baby syndrome': 1, 'adenosine deaminase deficiency-severe combined immune deficiency': 1, 'dCDA': 1, 'deficiency of AMP deaminase': 3, 'RA': 1, 'adenosine deaminase deficiency immunodeficiency': 1, 'SNC avalanche': 1, 'A2A-R': 1, 'BND': 1, 'Akita-CD': 1, 'ADENOSINE TRIPHOSPHORIC ACID': 3, 'AT': 1, 'adenosine deaminase deficient-severe combined immunodeficiency disease': 1, 'boy"': 1, '-NKs': 1, 'UC-NKs': 1, 'SFP': 1, 'ACC deaminase': 1, 'mono-ADP-ribosylation': 1, 'deficient in adenosine deaminase': 1, 'Adenosine depolarisation': 1, 'Swiss Agammaglobulinemia': 1, 'inherited ADA deficiency': 1, 'inherited adenosine deaminase (ADA) deficiency': 1, 'N-hAID': 1, 'hAID-BE': 1, 'Subretinal bubbles': 1, 'ADENOSINE TRIPHOSPHOCREATINE PHOSPHOTRANSFERASE': 1, 'cytidine deaminases': 2, 'SVNHC': 1, 'hyperactivity of adenosine deaminase': 1, 'nK-': 1, 'EFFECT OF ADENOSINE DIPHOSPHATE': 1, 'immunodeficiency-associated activation-induced deaminase': 1, 'adenosin deaminase deficiency': 2, 'ADENOSINE RECEPTOR AGONISTS': 1, 'CBS': 1, 'AM.ADP': 1, 'Adenosine deaminase Deficiency': 1, 'MAC': 1, 'fat boy': 1, 'PE-ADA': 1, 'Boy with muscular disease': 1, 'GAS BUBBLE': 1, 'inherited deficiency in adenosine deaminase': 1, '-ADP-': 1, 'Cytidine Deaminase Deficiency': 1, 'Haploinsufficiency of activation-induced deaminase': 1, 'Haploinsufficiency of Activation-Induced Deaminase': 1, 'SWISS NATIONAL SCIENCE': 1, 'Bubble blowing': 1, 'A-to-I deaminase': 1, 'IA': 1, 'Bubble Wrap': 1, 'ADA-SCID) disease': 1, 'I. INHIBITION OF ADENOSINE DEAMINASE BY': 1, 'ASEA': 1, 'deficiency of lymphocyte adenosine deaminase': 1, 'Bois de Bouis estate': 1, 'Bois de Bouis': 1, 'ADA-SCID liver disease': 1, 'adenosine diphosphate': 1, 'Boys and incest': 1, 'des Bois': 1, 'ADE': 3, 'ACSM': 1, 'CYTIDINE AS SUBSTRATES FOR DEAMINASES': 1, 'ROLE OF ADENOSINE': 3, 'ADENOSINE PRODUCTION': 3, 'Autosomal recessive activation-induced cytidine deaminase deficiency': 1, 'ADENOSINE-TRIPHOSPHORIC': 1, 'AMP': 1, 'ADENOSINE-5-MONOPHOSPHORIC': 1, 'ADENOSINE ACTIVATES A2b': 1, 'BFR': 1, 'N-CDA': 1, 'adenosine deamenase deficiency': 1, 'Boy brouhaha': 1, 'BASA': 1, 'bubble heart': 1, 'Adenosine deaminase-deficient severe combined immune deficiency': 1, 'Adenosine Deaminase-Deficient Severe Combined Immune Deficiency': 1, 'ICD/5': 1, 'adenosine-deaminase-deficiency': 1, 'cytosine/cytidine deaminase': 1, 'Severe-combined-immunodeficiency-due-to-adenosine-deaminase-deficiency&title': 1, 'adenosine deaminase deficient SCID': 2, 'Severe-combined-immunodeficiency-due-to-adenosine-deaminase-deficiency&search': 1, 'Boy with': 1, 'RB': 1, 'SWV': 1, 'Du Bois': 1, 'ADENOSINE MOIETIES': 1, 'Aggressive Hyperactive Boys': 1, 'aggressive hyperactive boys': 1, 'adenosine-': 2, 'Liberty boy': 1, 'Boys Girls': 1, 'CBPD': 1, 'ADENOSINE RECEPTOR-INDEPENDENT EFFECTS': 1, 'Adenosine Deaminase-Deficient': 1, 'deficiency of AICDA': 1, 'AICDA deficiency': 2, 'BCD': 3, 'Activation-Induced Cytidine Deaminase Deficiency': 1, 'AID and UNG deficiencies': 1, 'AID and': 1, 'ADA-linked immunodeficiency': 1, 'dry bubbles': 1, 'DEAMINASES OF ADENYLIC ACID AND ADENOSINE': 1, 'Activation-induced cytidine deaminase': 1, 'gas-bubble disease': 2, 'ADAR1 deficiency': 3, 'of ADA': 1, 'BMLs': 1, 'bCPAP complication': 1, 'bCPAP complications': 1, 'Emil du Bois-Reymond': 1, 'ADA Type III and IV periodontitis': 1, 'Duchenne boys': 2, 'deficiency of enzyme prophobilinogen deaminase': 1, 'skin bubbles': 1, 'ADA--SCID': 1, 'ADA.CM.V4': 1, 'ADA pseudovirus': 1, 'ADA.CM.755': 2, 'CA': 2, 'ADA-CTD': 1, 'SJISS': 1, 'ETN ADA': 1, 'adenosine deaminase deficient severe combined immune deficiency': 1, 'mADPRT': 1, 'MOVING FROM BUBBLE TO': 1, 'RESTITUTION OF ADENOSINE PHOSPHATES': 1, 'PAR': 2, 'activation-induced cytidine deaminase (AICDA/AID) deficiencies': 1, 'cADA': 1, 'ARHs': 2, 'poly-ADP': 1, 'ESTIMATION OF SERUM ADENOSINE DEAMINASE': 1, 'adenosine generating enzyme deficient': 1, 'Soap bubble lesions': 1, 'ADP-induced aggregation': 3, 'aEach bubble': 1, 'SWISS INVESTIGATION': 1, 'BR': 1, 'SF': 2, 'ADA Noa': 1, 'ADAAG': 1, 'LDB': 1, 'SMR': 1, 'ADA.IL-27': 1, 'Grutters and du Bois': 1, 'AID deficiencies': 1, 'Severe combined immune deficiency adenosine deaminase (ADA SCID) deficiency': 1, 'and cardiac bubbles': 1, 'SWISS-AMI': 1, 'Autosomal-Dominant Activation-Induced Cytidine Deaminase Deficiency': 1, 'CDs': 1, 'Boy 12': 1, 'deficiencies of AMP-D': 1, 'Adenosine deaminase-deficient': 1, 'AICDA deficient': 1, 'ADENOSINE DIPHOSPHORIC ACID': 1, 'Coracao de boi': 1, 'SAC': 1, 'long bubble': 1, 'Adenosine deaminase deficiency-associated severe combined immunodeficiency': 1, 'adenosine phosphoribosyltransferase deficiency': 1, 'deficiency of aggregation to ADP': 1, 'SND': 1, 'm1A.': 1, 'm1A': 1, 'CD virus': 1, 'adenosine deaminase-deficiency': 5, 'adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4) deficiency': 1, 'Adenosine-Deaminase (ADA)-deficiency': 1, 'adenosine deaminas': 1, 'MTADA': 1, 'CoBE': 1, 'Celebrations Boys': 1, 'ADENOSINE RIBOSYLATION FACTOR (ARF) 6': 1, '-1 bb': 1, 'Type-1 bb': 1, '-2 bb': 1, 'and Deaminases': 1, 'Gas-bubble lesions': 1, 'inborn deficiency of adenosine deaminase': 1, 'REMOVAL OF ADENOSINE': 1, 'EFFECTS OF ADENOSINE ON': 1, 'bubble deformity': 1, 'activation-induced deaminase (AID) deficiency': 1, 'II BB': 1, 'Type II BB': 1, 'I BB': 1, 'ADA,106': 1, 'SwN': 1, 'deoxycytidine deaminase': 1, 'LEVEL OF ADENOSINE PHOSPHORIC': 1, 'ADA BUREAU': 1, 'Adenosine-deaminase-deficient SCID': 1, 'adenosine deaminase-deficient, severe combined immunodeficiency': 1, 'PRODRUGS FOR CYTOSINE DEAMINASE': 1, 'Boys Do Cry suicide': 1, 'Boys Do Cry': 1, 'ROLE OF ADENOSINE RECEPTORS': 1, 'PRIBS': 1, "Mama's boy": 1, 'intraretinal bubble': 1, 'CDDs': 2, 'Chelsea Boy': 1, 'Handicapped Boys': 1, 'ADENOSINE INFLUENCES': 1, 'dry-bubble disease': 1, 'RC-ADA': 1, 'CDA deficiencies': 1, 'Cytidine deaminase (CDA) deficiency': 1, 'adenosine hypometabolism': 1, 'ADA SIE': 1, 'swiss-type agammaglobulinemia': 1, "boys' disorder": 1, 'ADA) SCID': 1, 'Bubble ulcers': 1, 'CSA': 1, 'SHIs': 1, 'Golden Boy': 1, 'cerebral bubbles': 1, 'soap bubble lesions': 1, 'AADs': 1, 'swiss fire': 1, 'Hereditary deficiency of adenosine deaminase': 1, 'hereditary adenosine deaminase deficiency': 5, 'ADA 2-deficiency': 1, 'AFSB': 1, 'soap bubbles': 1, 'DBM': 2, 'pleural ADA': 1, 'Hubble bubble': 2, 'ORIGIN OF GAS BUBBLES': 1, 'DEPHOSPHORYLATION OF ADENOSINE DIPHOSPHATE': 1, 'Adenosine Deaminase (ADA) deficiency': 5, 'deficiency of cytidine deaminase': 1, 'Boy drinking': 1, 'boy syndrome': 1, 'X-linked and ADA deficient SCID': 1, 'PEG-ADA': 2, 'ADA Type II': 1, 'adenosine deaminase (deficiency': 1, 'adenosine deaminase dificiency disease': 1, 'Adenosin': 1, 'Adenosine deaminase deficiency (ADA) deficiency': 1, 'of adenosine desaminase': 1, 'SSM': 1, 'grapevine disease bois noir': 1, 'bois noir)': 1, 'adenosine disorders': 1, 'BWA': 2, 'ADA-PC': 1, 'PFO bubble': 1, 'Web bubble disease': 1, 'adenosine deaminase (ADA) deficiency-SCID': 1, 'Adenosine Hyperaemia': 1, 'UC-ACD': 1, 'ACD': 2, 'ADA-07': 1, 'AID Deficiency': 1, 'AID-deficiencies': 1, 'AR-AID': 1, 'BDH': 1, 'BDNH': 1, 'EFFECT OF ADENOSINE TRIPHOSPHORIC': 1, 'dcd': 2, 'Activation-Induced Cytidine Deaminase deficiency': 1, "'bubble boy' syndrome": 1, 'AID IN': 1, 'Muscle AMP deaminase deficiency': 2, 'ADA-SCID DFSP': 1, 'deficiency of deaminase adenosine': 1, 'ADASCID': 1, 'Girls Boys': 1, '-induced cytidine deaminase': 1, 'BIOSYNTHESIZED L-THREONINE DEAMINASE': 1, 'adenosine deaminase-SCID deficiency.33': 1, "boy's disorder": 1, 'Vapor bubble': 1, 'BMoC': 1, 'BMoC.': 1, 'APRT-deficient': 1, 'PTBs': 1, 'adenosine deaminase (ADA1) deficiency': 1, 'Boy Lover': 1, 'AF': 1, 'CBB': 1, 'adenosine deaminase (ADA2) deficiency': 1, "bubble boy' disease": 1, 'ROLE OF ADENOSINE DEAMINASE': 1, 'ARFs': 1, 'SLW': 1, 'bubble-TCD': 1, 'PAPS': 1, 'ADENOSINE-THEOPHYLLINE ADMINISTRATION': 1, 'pfADA': 1, 'ADP-MEA': 1, 'Gas bubble trauma': 1, 'ADA-BP': 1, 'Baby Boy A': 1, 'SFOJ': 1, 'impairment of adenosine diphosphate-': 1, 'Gas-Bubble Disease': 1, 'Gas-bubble disease': 2, 'ADENOSINE DIPHOSPHOGLUCOSE': 1, 'Adenosine deaminase (ADA)-deficient severe combined immunodeficiency': 1, 'boy crisis': 1, 'Boy Crisis': 1, 'deficiency of AID': 2, 'bubble weed': 1, 'monoadenylate deaminase deficiency': 1, 'congenital hyperactive ADA hemolytic disorder': 1, 'BUBBLE ISOLATES': 1, 'CyD': 1, 'ADAD': 1, 'Adenosine deaminase-severe combined immunodeficiency': 1, 'SPSP': 1, 'Boy Poisoned': 1, 'SRC': 1, 'Adenosine Deaminase deficient': 1, 'bubble hair abnormality': 1, 'adenosine desaminase-deficiency': 1, 'ADA-T': 1, 'porphobobilinogen deaminase': 1, 'swiss-type immune deficiency': 1, 'AID.Cre': 1, 'GENERATION OF ADENOSINE': 1, 'deficit of adenosine deaminase': 1, 'ADMMP': 1, 'ADENOSINE OPTIONS': 1, 'Bubble Boy"': 1, 'PAD': 1, 'ADENOSINE PHOSPHORIBOSYL': 1, 'BCPAP': 1, 'ADA DAD': 1, 'ADPRi': 1, 'AR-AID deficiency': 1, 'bubble-soccer': 1, 'Bubble-Soccer': 1, 'Bubble-soccer': 1, 'deficiency of adenosine deaminase type2': 1, '-bubble deformity': 1, 'double bubbled': 1, 'of adenosine deaminase': 1, 'adenosine triphosphatasis': 1, 'ADA deficiency 3': 1, 'deficiencies of the AMPD': 1, 'ADORA': 1, 'ADORs': 1, 'SWR': 1, 'T-B-BK- Adenosine deaminase deficiency': 1, 'SPC': 1, 'EP': 1, 'swiss-prot': 1, '-bubble-baby-syndrome': 1, 'bois noir-related diseases': 1, 'ADP aggregates': 1, 'adenosine-deaminase-deficient severe combined immune deficiency': 1, 'Congenital deficiency of ADA': 1, 'EG': 1, 'ADATs': 1, 'adenosine and cytidine': 1, '1-ADA': 1, 'ABG': 1, 'activation-induced cytidine deaminase deficiencies': 1, 'THE BEHAVIOR OF ADENOSINE TRIPHOSPHATEPHOSPHOHYDROLASE': 1, 'ADENOSINE DEAMINATION': 1, 'AMS': 1, 'DOSING OF ADENOSINE': 1, 'USES OF ADENOSINE': 1, 'Bubble-blowing': 1, 'bubble-blowing': 1, 'Boys Handedness': 1, 'SPM': 1, 'Adenosine deaminas': 1, 'ADA virus': 1, 'bubble injury': 1, 'BDS': 1, 'adenosine deaminase deficiency': 1, 'ADA-deficient lung': 1, 'adenosine deaminase deficiency-': 1, 'SGP': 1, 'Sweat bubble': 1, 'False gas bubble disease': 1, 'Moku-boi-to': 1, 'Moku-boi-': 1, 'MBT': 1, 'adenosine deaminase anemia': 1, 'Adenosine DeAminase deficiency': 1, 'UC 5-ADA-- 1': 1, 'PAP': 1, 'deficiency of activation induced deaminase': 1, 'Com bubble': 1, 'boy Prematurity': 1, 'Boy Prematurity': 1, 'HC': 1, 'ADA enzyme': 1, 'H-bubble': 1, 'congenital adenosine deaminase (ADA) deficiency': 1, 'ADA disorders': 1, 'ADA deficiency diseases': 1, 'ABYM disease': 1, 'myo-AMPD deficiency': 1, 'myo-AMPD deficient': 1, 'EFS-BC': 1, 'MONOVALENT-CATION-STIMULATED ADENOSINE': 1, 'ADA 7-11-CD-08': 1, 'ADENOSINE ANTIMETABOLITES': 1, 'CB-SCID1': 1, 'CDA-deficient': 1, 'CDA deficient': 1, 'AIDCA': 1, 'ADA-Deficient SCID': 1, 'ADA-deficient severe combined immunodeficient': 1, 'Swiss defects': 1, 'NOBLs': 1, 'AMPDA': 1, 'Deficiency of erythrocytic and lymphocytic adenosine deaminase': 1, 'BUBBLING OF CELL SUSPENSIONS': 1, 'ADA)-SCID': 1, 'adenosine deaminase deficiency (': 1, 'SCID-ADA deficiency': 1, 'deficiency of the purine salvage enzyme adenosine deaminase': 1, 'SWSS': 1, 'LA-APL': 1, 'CV-APL': 1, 'Diver bubble': 1, 'Primary AMPD deficiency': 1, 'AMPD Deficiency': 1, 'Oligophrenic Boy': 1, "'Bois Noir' disease": 1, 'myoadenylat-deaminase deficiency': 1, 'Bubble Swelling': 1, 'adenosine de aminase deficiency': 1, 'Subretinal bubble': 1, 'AGONISM OF THE ADENOSINE A2A': 1, 'ABC ALLELE': 1, 'SMD': 1, 'ADA Type III': 1, 'ADENOSINE SENSORS - SENSING': 1, 'Air bubble trauma': 1, 'air bubble trauma': 1, 'PUTATIVE ROLE FOR ADENOSINE IN PROPHYLACTIC': 1, 'ADENOSINE SYSTEM': 1, 'ADENOSINE REGULATION': 1, 'cytidine deaminase-deficiency syndrome': 1, 'OB': 1, 'PEA': 1, 'ADENOSINE TRANSPORT': 1, 'ADA-deficient severe combined immunodeficiency disease': 1, 'Bubbling Brain': 1, 'ADA@CD': 1, 'HUMAN ADENOSINE RECEPTOR': 1, 'ADENOSINE REGULATES': 1, 'ADAR hyperactivity': 1, 'bubble stroke': 1, 'ADD': 1, 'BEHAVIOR OF ADENOSINE TRIPHOSPHORIC ACID (ATP)': 1, 'deficient for ADA': 1, 'Hyperactive Boys': 1, 'Adenosine Deaminase(': 1, 'Autosomal recessive severe combined immunodeficiency due to adenosine deaminase deficiency': 1, 'Bubble Hair': 1, 'double-bubble deformity of': 1, 'double-bubble deficiency': 1, 'double-bubble deformities': 1, 'bubble deformities': 1, 'double-bubble deficiencies': 1, "bubble baby' disease": 1, 'MAPDA': 1, 'deficiency of human adenosine deaminase': 1, 'swiss pear': 1, 'Partial adenosine deaminase deficiency': 1, 'EXOSOME PROMOTES AID': 1, 'adenosine deaminase defects': 1, 'AP-IPTs': 1, 'DEAMINASES': 1, 'WITH DEAMINASE-': 1, 'SAM': 1, 'CHA': 1, 'Maxilla Manible Boys': 1}
|
ADA
|
Disease
|
MESH:C531821
|
{'bacteraemia': 12453, 'Bacteraemia': 1552, 'bacteraemias': 622, 'Stenotrophomonas maltophilia bacteraemia': 1, 'Stenotrophomonas maltophilia infection': 68, 'Stenotrophomonas maltophilia skin infection': 1, 'MRSA bacteraemia': 52, 'Bacteraemias': 30, 'XDR-Stenotrophomonas maltophilia infection': 1, 'Stenotrophomonas maltophilia': 34, 'Stenotrophomonas maltophilia infections': 59, 'S. maltophilia': 179, 'S maltophilia': 33, 'MSTM': 1, 'Stenotrophomas maltophilia': 4, 'VRE bacteraemia': 8, 'Enterococcal bacteraemia': 15, 'Capnocytophaga canimorsus bacteraemia': 2, 'Micrococcus sedentarius bacteraemia': 1, 'stenotrophomonas maltophilia': 9, 'SM endocarditis': 1, 'SM': 26, 'CoNS bacteraemia': 18, 'maltophilia': 82, 'MRSAB': 1, 'gallolyticus bacteraemia': 2, 'Sm': 7, 'Sm infection': 1, 'Capnocytophaga bacteraemia': 3, 'MS': 1, 'Stenotrophomonas': 15, 'Rothia mucilaginosa bacteraemia': 1, 'P maltophilia': 3, 'enterococcal bacteraemia': 72, 'Aeromonas bacteraemia': 3, 'Stenotrophomonas maltophilia Infections': 17, 'anaerobic bacteraemia': 20, 'NTS bacteraemia': 4, 'urogenic bacteraemia': 1, 'Butyricimonas virosa bacteraemia': 3, 'febrile bacteraemia syndrome': 1, 'Zero Bacteraemia': 1, 'S. capitis bacteraemia': 1, 'holarctica bacteraemia': 1, 'L. adecarboxylata bacteraemia': 4, 'Actinomycotic bacteraemia': 2, 'enterococcus bacteraemia': 4, 'febrile bacteraemia': 6, 'Haematology Bacteraemia': 1, 'SMB': 2, 'Stenotrophomonas maltophilia Bacteremia': 7, 'TigR-Kp bacteraemia': 1, 'C. gleum bacteraemia': 1, 'hepatic lesion Bacteraemia': 1, 'Axc and Sm infections': 1, 'Sm infections': 2, 'infection with SM': 1, 'bacteraemia*[TIAB': 1, 'E. meningoseptica bacteraemia': 4, 'Elizabethkingia meningoseptica bacteraemia': 4, 'MDRO bacteraemia': 1, 'ESBL bacteraemia': 5, 'MAL bacteraemia': 1, 'bacteraemia disease': 1, 'BSAC Bacteraemia': 3, 'P. maltophilia': 2, 'A. dhakensis bacteraemia': 1, 'intraerythrocytic bacteraemia': 4, 'S_maltophilia': 1, 'S. Maltophilia': 4, 'MAC bacteraemia': 2, 'Postoperative Bacteraemia': 1, 'postoperative bacteraemia': 4, 'gonococcal bacteraemia': 3, 'CRAB bacteraemia': 3, 'bacteraemia, not otherwise specified': 1, 'enterobacter bacteraemia': 1, 'N. meningitidis bacteraemia': 3, 'SPN bacteraemia': 1, 'LLac bacteraemia': 1, 'VREF bacteraemia': 4, 'ECC bacteraemia': 1, 'ECCB': 1, 'ESBL-E bacteraemia': 4, 'X maltophilia': 8, 'bolletii bacteraemia': 1, 'bacteraemiae': 3, 'A. urinae bacteraemia': 2, 'bacteraemia focal disease': 1, 'Enterococcal Bacteraemia': 1, 'ESBL-Kp bacteraemia': 1, 'P. maltophilia infections': 1, 'stenotrophomonas maltophilia bacteremia': 1, 'Enterobacter bacteraemia': 5, 'Bacteraemia ia': 1, 'VREfm bacteraemia': 2, 'Xanthomonas) maltophilia': 2, 'Stenotrophomas(Xanthomonas)maltophilia 4': 1, 'Stenotrophomonas Bacteremia': 1, 'Stenotrophomonas maltophilia Infection': 6, 'anaerobic bacteraemias': 4, 'mycobacterial bacteraemia': 1, 'Mycobacterial bacteraemia': 1, 'S.maltophilia': 3, 'bacteraemia CLD': 1, 'Coliform bacteraemia': 2, 'SMA': 8, 'SMA infections': 5, 'sternotrophomonas bacteraemia': 1, 'enterococcal bacteraemias': 11, 'Butyricimonas bacteraemia': 1, 'CRE bacteraemia': 3, 'MRSA-B': 2, 'Streptoccocal bacteraemia': 1, 'stentotrophomonas maltophilia': 1, 'Rothia bacteraemia': 1, 'bacteraemia-like': 1, 'bacteraemia-like syndrome': 1, 'Stenotrophomonas maltophilialower': 1, 'S maltophilia bacteremia': 2, 'pseudo-bacteraemia': 2, 'postoperative bacteraemias': 1, 'Citrobacter bacteraemia': 1, 'STENOTROPHOMONAS MALTOPHILA': 1, 'SM bacteremia': 10, 'Elizabethkingia anophelis bacteraemia': 1, 'E. anophelis bacteraemia': 1, 'Anaerobic bacteraemia': 5, 'Achromobacter bacteraemia': 1, 'achromobacter bacteraemia': 1, 'S. pyogenes bacteraemia': 1, 'BSAC bacteraemia': 2, 'BActeraemia': 1, 'St. maltophilia': 4, 'SAGB': 1, 'S. anginosus group bacteraemia': 1, 'CNS bacteraemia': 2, 'Stenotrophomas bacteraemia': 1, 'Bacteraemia Bacteraemia': 1, 'LTSRSM infection': 1, 'LTSRSM infected': 1, 'bacteraemia"[All': 3, 'Selenomonas bacteraemia': 1, 'coliform bacteraemia': 5, 'Bacteraemia Macedonia': 1, 'Myalgia Bacteraemia': 1, 'SMB infection': 1, 'S. MALTOPHILIA': 3, 'ISOLATION OF S. MALTOPHILIA': 1, 'S. MALTOPHILIA RECIPIENT FROM': 1, 'SM keratitis': 1, 'enterococci bacteraemia': 1, 'stenotrophomonas bacteremia': 2, 'Stenotrophomonas Maltophilia Infection': 1, 'GAS bacteraemia': 4, 'bacillary bacteraemia': 2, 'BDE': 1, 'Transient Bacteraemia': 1, 'SM bacteraemia': 2, 'SM infection': 15, 'UTI Bacteraemia': 1, 'melioid bacteraemia': 1, 'C. subterminale bacteraemia': 1, 'pneumoccoccal bacteraemia': 1, 'A. defectiva bacteraemia': 1, 'X. maltophilia': 3, 'Ste maltophilia': 1, 'Stenotrophomonas Maltophilia Keratitis': 1, 'Stenotrophomonas maltophilia keratitis': 1, 'CA-MRSA bacteraemia': 1, 'bacteraemia.mp': 1, 'Clostridial bacteraemia': 3, 'clostridial bacteraemia': 1, 'SMA infection': 5, 'SM infections': 12, 'EF bacteraemias': 1, 'Stenotrophomonas maltophilia (': 4, 'non-bacteraemia': 1, 'bacteraemia and': 2, 'central line associated bacteraemia': 1, 'CLAB': 4, 'Central Line Associated Bacteraemia': 1, 'SMP': 1, 'Brevibacterium bacteraemia': 1, 'Psychrobacter bacteraemia': 1, 'ALS bacteraemia': 1, 'Non-bacteraemia': 2, 'CONS bacteraemia': 2, 'renal bacteraemia': 1, 'bacteraemia.21': 1, 'post-extraction bacteraemia': 2, 'PEB': 1, 'Post-tooth extraction bacteraemia': 1, 'negative bacteraemias': 1, 'NOVC bacteraemia': 1, 'Primary bacteraemia': 2, 'Smc': 1, 'SMA bacteremia': 1, 'haemoplasma bacteraemia': 1, 'H. kunzii bacteraemia': 1, 'PB': 4, '-acquired bacteraemia': 3, 'TSRSM infection': 1, 'EKP bacteraemia': 1, 'Neisseria meningitidis bacteraemia': 3, 'BACTERAEMIA': 7, 'KB': 1, 'PDR-Kp bacteraemias': 1, 'bacteraemia complex': 1, 'H. aphrophilus bacteraemia': 1, 'NFE bacteraemia': 1, 'Stenotrophomonas Maltophilia Pneumonia': 1, 'bacteraemia of': 1, 'bacteraemia UTIs': 1, 'post-bacteraemia': 2, 'bacteraemia,1': 1, 'Acetobacter tropicalis bacteraemia': 1, 'Maltophilia': 4, 'bacteraemia et cetera': 1, 'SVG bacteraemia': 1, 'NBHS bacteraemia': 1, 'SMA bloodstream infection': 1, 'MRSA bacteraemias': 5, 'SM respiratory infection': 1, 'respiratory SM infections': 1, 'SM hemorrhagic pneumonia': 2, 'thrombocytopenic SM': 1, 'A. nosocomialis bacteraemia': 1, 'stenotrophomonas maltophilia infection': 2, 'Yes Bacteraemia': 1, 'S. maltophilia Bacteremia': 2, 'ESBL-KP bacteraemia': 1, 'SM-': 1, 'Pneumonia Bacteraemia Bacteraemia': 1, 'Elizabethkingia bacteraemia': 1, 'Providencia bacteraemia': 2, 'SM) infections': 1, 'Stenotrophomonas maltophilia (SM) infections': 1, 'urinary and bacteraemia': 1, 'THE IDENTIFICATION OF STENOTPHOMONAS MALTOPHILIA': 1, 'Pneumococcus bacteraemia': 1, 'Chronic Stenotrophomonas maltophilia infection': 1, 'TSRSM': 1, 'SM-BSIs': 1, 'EB': 1, 'relapsing bacteraemia': 1, 'Relapsing Bacteraemia': 1, 'Stenotrophomonas maltophilia endocarditis': 1, 'STM': 1, 'bacteraemia.11': 1, 'Sneathia amnii bacteraemia': 1, 'Stenotrophomonas maltophilia pneumonia': 2, 'Capnocytophaga bacteraemia': 1, 'Ruminococcus gnavus bacteraemia': 1, 'Leclercia adecarboxylata bacteraemia': 3, 'Bac': 1, 'persistent bacteraemia': 2, 'Persistent bacteraemia': 1, 'bacteraemia.16': 1, 'Dialister pneumosintes bacteraemia': 2, 'BMD Bacteraemia': 1, 'Leuconostoc bacteraemia': 2, 'SMS': 1, 'SMO': 1, 'N/A Bacteraemia': 1, 'Ps maltophilia': 1, 'stenotrophomonas-maltophilia': 2, 'ESBL-PE bacteraemia': 1, 'stenotrophomonas maltophilia bacteriemia': 1, 'enterobacter cloacae bacteraemia': 1, 'Enterobacter cloacae bacteraemia': 1, '13TU bacteraemia': 1, 'A. butzleri bacteraemia': 1, 'A. butzleri bacteraemia': 1, 'Bacteraemia pyocyaneus': 1, 'strenotrophomas maltophilia': 1, 'P maltophilia bacteremia': 1, 'SMA-infection': 1, 'SM pneumonia': 2, 'Stenotrophomonas bacteremia': 2, 'CC22 bacteraemia': 1, 'P. maltophilia infection': 1, 'Pseudomonal bacteraemia': 1, 'pseudomonal bacteraemia': 1, 'Enterobacterales bacteraemia': 3, 'HACEK bacteraemia': 1, 'stenotrophomonas.html': 1, 'SO maltophilia': 1, 'PA maltophilia plant-associated maltophilia': 1, 'HU maltophilia': 1, 'HU maltophilia maltophilia': 1, 'SO maltophilia maltophilia': 1, 'aerococcal bacteraemia': 1, 'H. phocaeensis bacteraemia': 1, 'BiOstic Bacteraemia': 1, 'PHE bacteraemia': 2, 'C jeikeium bacteraemia': 1, 'Stenotorophomonous maltophilia': 1, 'ESBL-EK bacteraemia': 1, 'Epilepsy Bacteraemia': 1, 'CSB': 1, 'coagulase-negative bacteraemia': 1, 'S. dysgalactiae Bacteraemia': 1, 'BAC00Strenotrophomonas_maltophilia': 1, 'berkhoffii bacteraemia': 1, 'bacteraemia.1': 1, 'Stenotrophomonas maltophilia discitis': 1, 'STENOTROPHOMONAS MALTOPHILIA ENDOPHTHALMITIS 1': 1, 'stenotrophomonas (xanthomonas) maltophilia': 1, 'Central line-associated bacteraemia': 1, 'central line-associated bacteraemia': 1, 'ESKAPEc bacteraemia': 1, 'Stenotrophomonas maltophilia bacteremia': 2, 'p-EB': 1, 'bacteraemia.4': 1, 'bacteraemia.3': 1, 'haematogenous bacteraemia': 1, 'SMAG': 1, 'maltophilia GTAG': 1, 'Dysgonomonas capnocytophagoides bacteraemia': 1, 'ESBL-EC bacteraemia': 1, 'Enterococcal bacteraemias': 1, 'ANB': 1, 'Helicobactercinaedi bacteraemia': 1, 'SM pulmonary exacerbations': 1, 'SM colonization': 2, 'bacteraemia orviraemia': 1, 'O266 Bacteraemia': 1, 'Burkolderia cenocepacia bacteraemia': 1, 'Stenotrophomonas Maltophilia': 1, 'ESBL-positive bacteraemia': 1, 'Citrobacter freundii bacteraemia': 1, 'BUO': 1, 'bacteraemia of urinary origin': 1, 'CD bacteraemia': 1, 'A.defectiva bacteraemia': 1, 'Pseudo-bacteraemia': 1, 'CREC bacteraemia': 1, 'Stenotrophomonans maltophilia': 1, 'SMA-infected': 1, 'venerealis Bacteraemia': 1, 'Xanthomonas maltophilia': 1, 'ESKAPEE bacteraemia': 1, 'pneumococcus bacteraemia': 1, 'salmonellal bacteraemia': 1, 'SMA pneumonia': 1, 'SMA pulmonary infection': 1, 's.maltophilia': 1, '-Acquired Bacteraemia': 1, 'pulmonary Sm infection': 1, 'Albus bacteraemia': 1, 'MDR-Steno': 1, 'bacteraemia[P': 1, 'anthomonas maltophilia': 1, 'Stenotrophomas Maltophilia': 1, 'Bacteraemia;1': 1, 'Herbaspirillum bacteraemia': 1, '-negative bacteraemia': 1, '3GCRE bacteraemia': 1, 'ESBL bacteraemias': 1, 'MRSA bacteraemia.18': 1, 'I. limosus bacteraemia': 1, 'Portal bacteraemia': 1, 'S. Maltophilia bacteremia': 1, 'damselae bacteraemia': 1, 'Mucoid-typeS. maltophilia': 1, 's maltophilia"[Title': 1, 'TSRSM bacteremia': 1, 'bacteraemia#results': 1, '-positive bacteraemia': 1, 'bacteraemia endocarditisb': 1, 'listerial bacteraemia': 1, 'portal bacteraemia': 1}
|
bacteraemia
|
Disease
|
MESH:C531833
|
{'Superior orbital fissure syndrome': 36, 'superior orbital fissure syndrome': 127, 'painful ophthalmoplegia': 242, 'NSOI': 18, 'nonspecific orbital inflammation': 14, 'Painful ophthalmoplegia': 95, 'cavernous sinus and supraorbital fissure syndrome': 1, 'PO': 9, 'Painful Ophthalmoplegias': 1, 'SOF': 13, 'Alternating painful ophthalmoplegia': 1, 'Painful Ophthalmoplegia': 10, 'bilateral painful ophthalmoplegia': 1, 'Bilateral painful ophthalmoplegia': 1, 'painful recurrent ophthalmoplegia': 1, 'SOFS': 24, 'traumatic superior orbital fissure syndrome': 8, 'syndromes of the superior orbital fissure or cavernous sinus': 1, 'unilateral painful ophthalmoplegia': 5, 'idiopathic painful ophthalmoplegia': 3, 'painful, unilateral external ophthalmoplegia': 1, 'superior orbital fissure syndromes': 1, 'the SOF': 1, 'SOF syndrome': 4, 'Painful ophthalmoplegia syndrome': 5, 'orbital nonspecific inflammation': 2, 'superior orbital fissure asymmetry': 1, 'posttraumatic superior orbital fissure syndrome': 1, 'Superior Orbital Fissure syndrome': 1, 'post-traumatic SOFS': 1, 'N - NSOI': 1, 'Nonspecific Orbital Inflammation': 2, 'superior orbital fissure meningiomas': 1, 'Nonspecific orbital inflammation': 4, 'painful unilateral ophthalmoplegia': 1, 'painful total ophthalmoplegia': 1, 'painful ophthalmoplegia syndrome': 6, 'SOF lesion': 1, 'lesions of the SOF': 1, 'Superior Orbital Fissure Syndrome': 6, 'unilateral or bilateral painful ophthalmoplegia': 1, 'syndrome of the superior orbital fissure': 1, 'superior orbital fissures syndrome': 1, 'painful ophthalmoplegias': 7, 'Traumatic superior orbital fissure syndrome': 11, 'PO syndromes': 1, 'cavernous sinus/orbital apex inflammation': 1, 'superior orbital fissure': 2, 'posttraumatic SOFS': 1, ', painful ophthalmoplegia': 1, 'painful idiopathic ophthalmoplegia': 1, 'postoperative superior orbital fissure syndrome': 1, 'Superior orbital fissure syndrome III, IV': 1, 'tSOFS': 1, 'SPOs': 1, 'pain ophthalmoplegia': 1, 'episodic painful ophthalmoplegia': 1, 'paroxysmal painful ophthalmoplegia': 1, 'painful, external ophthalmoplegia': 1, 'NSOI disorder': 1, 'myositic NSOI': 1, 'angiomatous NSOI': 1, 'syndrome of superior orbital fissure': 1, 'post-traumatic superior orbital fissure syndrome': 1, 'left superior orbital fissure syndrome': 1, 'cavernous sinus and superior orbital fissure syndrome': 1, 'Painful ophthalmoplegias': 1, 'orbital and anterior cavernous sinus/superior orbital fissure syndrome': 1, 'cavernous sinus and superior orbital fissure syndromes': 1, 'SOFD': 1, 'SOF compression': 1}
|
painful ophthalmoplegia
|
Disease
|
MESH:C531834
|
{'Microsporum canis infection': 55, 'toxocara canis': 10, 'toxocara': 117, 'M. canis infected': 1, 'CATIE': 48, 'Jackal - Canis mesomelas': 1, 'canis': 71, 'Toxocara canis infection': 68, 'E canis infection': 5, 'GALEUS CANIS': 1, 'H. canis infection': 52, 'Hepatozoon canis infection': 39, 'T. canis infection': 116, 'E. canis infection': 104, 'Notoedres cati': 1, 'C. canis infection': 6, 'Mc infection': 1, 'CANIS LATRANS': 5, 'Microsporum canis infections': 20, 'T. cati infection': 19, 'canine roundworm': 4, 'Toxocara syndromes': 2, 'M. canis infection': 2, 'M. canis infections': 1, 'Sarcocystis canis infection': 1, 'microsporum canis': 2, 'CANIS FAMILIARIS': 2, 'canine roundworm infections': 2, 'T. canis larva infection': 1, 'Toxocara': 37, 'E. canis infections': 17, 'Babesia canis canis infection': 1, 'Toxocara Canis Infection': 2, "T. canis' infection": 1, 'E.canis infection': 3, 'Hepatozoon canis Infection': 4, 'Hepatozoon canis': 26, 'cAny symptoms': 1, 'Microsporum-canis-infected': 1, 'larva roundworm': 1, 'Toxocara spp': 2, 'T. canis infections': 9, 'Ocular toxocara canis': 1, 'Toxacaris canis infection': 1, 'Trichodectes canis': 1, 'Microsporum canis infection of the scalp': 5, 'Toxocara Canis infection': 1, 'Toxocara canis infection': 1, 'Piroplasma Canis': 1, 'cAny': 5, 'H canis': 2, 'toxocara canis retinochorioiditis': 1, 'E. canis': 4, 'Ctenocephalides canis infection': 1, 'C. canis infections': 1, 'canine roundworms': 1, 'T. canis Infection': 4, 'T.canis infection': 4, 'T. cati infections': 8, 'ocular toxocara': 1, 'CATIE type 1': 1, 'Toxocara canis infections': 2, 'Toxocara cati infections': 2, 'capnocytophagia canis': 1, 'canis infection': 8, 'Toxocara cati infection': 8, 'Toxocara cati Infection': 2, 'Toxocara (dog or cat roundworm) infection': 1, 'Toxocara-canis infection': 2, 'T canis infection': 4, 'canis familiaris': 3, 'Microsporum Canis infection': 1, 'T cati infection': 3, 'E. canis infected': 3, 'atroficans canis': 1, 'ROUNDWORM TOXOCARA CANIS': 1, 'P. canis infection': 4, 'TC': 1, 'D cati': 2, 'Haemobartonella canis infection': 6, 'Toxocara catis infection': 1, 'H. canis infections': 8, 'Toxocara canis of the eye': 1, 'CheopisCtenocephalides canis': 1, 'cauda canis': 1, '-Toxocara': 1, 'Capnocytophaga canis': 2, 'Canis Familiaris': 4, 'toxocara canis infection': 4, 'Canis': 3, 'Hapatozoon canis infection': 1, 'H. canis': 3, 'Toxocara canis Infection': 5, 'INF': 1, 'Cystoisospora canis': 1, 'Canis mesomelas': 5, 'common canine roundworm': 1, 'toxocara antibody': 1, 'Capnocytophaga canis infection': 1, 'Microsporum canis infection of the thumb-': 1, 'HCI': 1, 'CANIS': 2, 'Toxocara cati Infections': 1, 'M.c': 1, 'Toxicara canis-infected': 1, 'TTCaV.': 1, 'TTCaV': 2, 'D. canis infections': 1, 'D. canis lesions': 1, 'D. canis infection': 1, 'H canis infection': 2, 'Haemobartonella canis parasitaemia': 1, 'Sarcocystis canis-like infection': 1, 'canine and feline infections': 1, 'Neisseria canis infection': 2, 'microsporum canis infections': 1, 'P. canis': 1, 'Toxocara disease': 2, 'Microsporum Canis Infection': 1, 'E. canis (EC) infection': 1, 'canis infections': 2, 'ApEc': 1, 'Ec': 1, 'Pseudomycetoma for microsporum canis': 1, 'S. canis infection': 1, 'Microsporon canis infection': 1, 'cany toxic': 1, 'Toxocara diseases': 1, 'Microsporum canis Infection': 1, 'CATIE-A.D.': 1, 'Carasobarbus canis': 1, 'Microsporum canis': 1, 'Microsporum canis infected': 2, 'E. canis) infection': 1, 'MICROSPORUM CANIS': 2, 'Tc': 1, 'Cani & WM': 1, 'canis infections of the scalp': 1, 'DID CATIE HAVE EXTERNAL VALIDITY': 1, 'H.canis infection': 1, 'Hepatozoon Canis infection': 1, 'Canis etruscus': 1, 'microsporum canis infection': 1, 'T. canis Infections': 1, 'Toxocara lesions': 1, 'catis': 1, 'Hepatoozon canis': 1, 'cati': 2, 'CTLI': 1, 'E. canis Infection': 1, 'CaTI': 1, 'Toxocara lesion': 1, 'toxocara disease': 1, 'Haemobartonella canis': 1, 'cAny infection': 1, 'toxocara canis infections': 1, 'MICROSPORUM CANIS INFECTION': 1, 'Neisseria canis': 1, 'CFA': 2, 'Canis familiaris': 1, 'Canis lupus infected': 1, 'CATIs': 1, 'S. canis-like infection': 1, 'T. cati infected': 1, 'Canis%20lupus%20familiaris': 1, 'cAny disability': 1, 'cutaneous Microsporum canis infection': 1, 'CANIS INFECTION': 1, 'Micosporum canis infection': 1, 'Microsporum canis-infection': 1, 'cAny lesions': 1, 'adult toxocara cati': 1, 'Toxocara and': 1}
|
toxocara
|
Disease
|
MESH:C531835
|
{'eA': 58, 'TEFs': 106, 'Eragrostis tef': 10, 'anal atresia, cardiac, TEF': 1, 'EAs': 163, 'EA/TEF': 26, 'postoperative dysfunction of EA/TEF': 1, 'EA/TEF type C': 2, 'tracheoesophageal atresia': 29, 'tef': 43, 'Ea': 25, 'EA-TEF': 68, 'EATEF': 5, 'TEF': 6, 'OA-TOF': 3, 'eas': 2, 'Dyspn(o)ea': 1, 'eAs': 18, 'dysmenorrh?ea': 1, 'Esophageal Atresia-Tracheoesophageal Fistula': 3, 'semidwarf tef': 1, 'diarrh?ea': 1, 'gastrointestinal EAs': 1, 'Gastrointestinal EAs': 1, 'mitral Ea': 1, 'tracheoesophageal or esophageal-mediastinal fistula': 1, 'Acq-TEFs': 2, 'ea-borne diseases': 1, 'Tracheoesophageal atresia': 2, 'eAS': 4, 'EA with distal TEF)': 1, 'mi/ea-FTCs': 1, 'tef injera': 1, 'ea': 5, 'EA/ TEF': 1, 'TOF': 1, 'esophageal atresia-tracheoesophageal fistula': 4, 'tracheoesophageal or mediastinal- esophageal fistula': 1, 'tracheoesophageal fistula with atresia': 2, 'Eas tare': 1, 'Diarrh*ea': 1, 'BRONCHOESOPHAGEAL FISTULAE WITHOUT ESOPHAGEAL ATRESIA': 1, 'tef Pest': 1, 'Tef': 10, 'TM': 1, 'FISTULA OF TYPE H WITHOUT OESOPHAGEAL ATRESIA': 1, 'diarrh(o)ea': 2, 'tef crop weed': 1, 'tef crop': 1, "Ea'teghal-e-batn": 1, 'OA TEF': 1, 'sleep apn(o)ea': 1, 'dyspn[o]ea': 1, 'TE': 1, 'Atresia-Tracheoesophageal Fistula': 1, 'EA/TEF+': 1, 'esophageal atresia tracheoesophageal fistula': 1, 'Spathopoulos ea': 1, 'Congenital TEFs': 1, 'tTEF': 1, 'esophageal atresia with tracheoesophageal fistula': 1, 'Ea-': 2, 'Tef Lodging': 1, 'tef lodging': 1, 'Kothari ea': 1, 'ar-eas': 1, 'tracheoesophagal atresia': 1, 'apnea-hypopn ea': 1, 'tracheoesophageal atresia/fistula': 1, 'BT': 1, 'hypopn?ea': 1, 'apn?ea': 1, 'atresia without fistula': 1, 'tracheoesophageal atresia and fistula': 2, 'Hang-Korng Ea': 1, 'H-TEFs': 1, 'Esophageal and tracheoesophageal fistula': 1, 'diarrh?ea.tw.10': 1, 'diarrh*ea': 1, 'Tef Injera': 1, 'TOF/EA': 1, 'tracheoesophageal fistula/atresia': 1, 'III EA-TEF': 1, 'tef pests': 1, 'Tracheoesophageal Atresia': 1, 'Vagropoulos ea': 1, 'Ea medicinae pars quae pathologica': 1, 'Ea-Ea': 1, 'Ea-pulm': 1, 'Eragrostis tef Zucc': 1, '-TEFs': 1, 'ea rly': 1, 'Ea-TIII': 1, 'EAEDs': 1, 'EA/TEF type C or D': 1, 'EA/TEF type A or B': 1, 'Oesophageal atresia-tracheoesophageal fistula': 1, 'oesophageal atresia-tracheoesophageal fistula': 1, 'AAEE-Ea': 1, 'Eas': 1, 'TEF-EA': 2, 'CONGENITAL BRONCHOESOPHAGEAL FISTULA WITHOUT ATRESIA OF THE ESOPHAGUS': 1, 'LG-EAs': 1, 'Ea-LS': 1, 'type I-Ea': 1, 'tracheoesophageal fistula or atresia': 1, 'ESO-TRACHEAL FISTULA WITHOUT ESOPHAGEAL ATRESIA': 1, 'DiHETE-EA': 1, 'EA-TEF type C': 1, 'Marduk-Ea': 1, 'Haymond ea': 1, 'EA + TEF type D': 1, 'EA + TEF type C': 1, 'EA + TEF': 1, 'EAEd': 1, 'Type C OA-TOF': 1, 'OA-TOF anomalies': 1, 'ea-': 1, 'EA&TEF': 1, 'Esophageal atresia-tracheoesophageal fistula': 1, 'BREE-Ea': 1, 'BR': 1, 'Dyspn?ea.mp': 1, 'TREAT': 1, 'Cardiac, renal, and TEF/EA anomalies': 1, '3a-ea': 1, 'type III EAs': 1, 'OA/TOF': 1, 'TOF isolated OA': 1, 'OA/TOF syndrome': 1, 'TOF OA': 1, 'TOF Isolated OA': 1}
|
EAs
|
Disease
|
MESH:C531836
|
{'congenital anomaly of the tricuspid valve and': 1, 'agenesis of tricuspid valve': 1, 'ASPECTS OF CONGENITAL DEFECTS OF THE TRICUSPID VALVE': 1, 'congenitally malformed valves': 3, 'congenital or acquired abnormality of the tricuspid valve apparatus': 1, 'congenital valve malformation': 15, 'congenital valve malformations': 28, 'congenital defect of the tricuspid valve': 2, 'congenital tricuspid disease': 1, 'valve agenesis': 12, 'congenital dysplastic tricuspid valve': 1, 'congenital malformations of the tricuspid valve': 6, 'Congenital tricuspid valve blood cyst': 1, 'congenital and acquired anomalies of the tricuspid valve': 1, 'congenital abnormality of the tricuspid valve': 2, 'congenital malformation of the tricuspid valve': 11, 'congenital malformed valves': 1, 'Congenital malformations of the tricuspid valve': 4, 'congenital malformed valve': 1, 'congenitally malformed valve': 3, 'Congenital displacement of the tricuspid valve': 1, 'Congenital anomalies of the tricuspid valve': 1, 'congenital TVD': 1, 'congenital malformation of the valve': 2, 'agenesis of the tricuspid valve': 5, 'CONGENITAL TRICUSPID': 2, 'Congenital pulmonary valve agenesis': 1, 'Valve agenesis': 1, 'congenital malformation of the tricuspid valve and right': 1, 'congenital malformation of the HV': 1, 'Congenital valve malformations': 4, 'valve cushion agenesis': 1, 'Congenital tricuspid valve disease': 2, 'Congenital tricuspid valve dysplasia': 3, 'congenital anomalies of the TV': 1, 'congenital papillary tumor of the tricuspid valve': 1, 'Congenital papillary tumor of the tricuspid valve': 1, 'tricuspid valve congenital anomalies': 1, 'congenital TV disease': 5, 'agenesis of the semilunar valves': 1, 'congenital anomalies of the tricuspid valve': 3, 'congenital malformations of the atrioventricular valves': 1, 'Congenital tricuspid dysplasia': 1, 'congenital malformation of valves or': 1, 'Congenital agenesis of the pulmonary valve': 1, 'congenital malformations of tricuspid valve': 1, 'Congenital agenesis of anterior leaflet of tricuspid valve': 1, 'lymph valve agenesis': 1, 'congenital tricuspid valve calcification': 1, 'Congenital Tricuspid Valve Calcification': 1, 'CONGENITAL VALVES OF THE POSTERIOR': 1, 'congenital TV lesions': 1, 'congenital tricuspid valve diseases': 1, 'Ebstein congenital TV disease': 1, 'Ebstein congenital TV lesions': 1, 'Congenital tricuspid valve anomalies': 1, 'Congenital abnormalities of the tricuspid valve': 4, 'congenital abnormalities of the tricuspid valve': 2, 'or agenesis of the tricuspid valve': 1, 'agenesis of lymphatic valves': 2, 'congenital TV dysplasia': 3, 'agenesis of valves': 2, 'Tricuspid Valve Agenesis': 1, 'Congenital TV disease': 1, 'congenital malformation of the tricuspid valve (TV) and': 1, 'congenital malformation of the tricuspid valve and': 1, 'Congenital TV morphologic abnormalities': 1, 'Congenital TV abnormalities': 1, 'congenital TV diseases': 1, 'CONGENITAL VALVE MALFORMATIONS': 1, 'Congenital cleft of the anterior tricuspid leaflet': 1, 'congenital duplication of the tricuspid valve': 1, 'Congenital duplication of the tricuspid valve': 1, 'Congenital malformations of pulmonary and tricuspid': 1, 'congenital malformations of the valve': 1, 'cardiac valve agenesis': 1, 'congenital abnormality of TV': 1, 'congenital tricuspid valve dysplasia': 1, 'congenital tricuspid dysplasia': 1, 'Congenital Tricuspid Valve Spectrum': 1, 'Congenital bicuspidity of the tricuspid': 1, 'congenital anomaly of the tricuspid valve': 1, 'tricuspid congenital defect': 1, 'Congenital malformation of tricuspid valve': 2, 'congenital dysplasia of the tricuspid valve': 1, 'Congenital cleft of anterior tricuspid leaflet': 1, 'congenital TV abnormality': 1, 'agenesis of the TV': 1, 'congenital malposition of the tricuspidal valves': 1, 'congenital TV malformations': 1, 'Congenital Tricuspid Valve Lesion': 1, 'Valve agenesis and dysplasia of leg veins': 1, 'congenital dysplastic TV': 1, 'congenital TV anomalies': 2, 'Congenital Tricuspid Valve Cleft': 1, 'congenital developmental abnormality of the tricuspid valve': 1, 'congenital abnormalities of the TV': 1, 'agenesis of semilunar valve': 1, 'Congenital mitral and tricuspid valve abnormalities': 1, 'congenital malformations of valves': 1, 'congenital malformation of tricuspid valve': 1, 'congenital anomalies of the tricuspid valve complex': 1, 'Congenital obstructive valves': 1, 'congenital posterior valves': 1, 'agenesis of pulmonic valve': 1, 'congenital TV abnormalities': 1, 'Congenital Tricuspid Dysplasia': 1, 'congenital venous valve function': 1, 'Congenital lower extremity venous valve agenesis': 1, 'congenital lower extremity venous valve agenesis': 1, 'venous valve agenesis': 1, 'Congenital Lower Extremity Venous Valve Agenesis': 1, 'congenital lower extremity valve agenesis': 1, 'congenital disease of tricuspid valve': 1, 'Congenital dysplasia of tricuspid valve': 1}
|
congenital valve malformations
|
Disease
|
MESH:C531841
|
{'Inflamed': 21, 'inflamed': 1154, 'inflamed mucosa': 7, 'inflamation': 69, 'inflamed odontogenickeratocyst': 1, 'Inflam': 16, 'heart inflamed': 1, 'IBD': 3, 'Inflamed mucosal lesions': 1, 'Inflamed tumors': 35, 'inflamed tumors': 18, 'inflamed skin dysfunction': 1, 'inflamed joints': 54, 'inflammed': 36, 'inflamed redness': 1, 'inflamed depression': 3, 'TIS': 15, 'inflamed pterygium': 8, 'inflamed throat': 18, 'infected urachal cyst': 115, 'MIMS': 9, 'autoimmune inflamed': 5, 'Muco inflam': 1, 'inflamed pulps': 1, 'IM': 3, 'ocular inflamations': 1, 'inflamed granulation tissue': 1, 'IGT': 1, 'inflamed plaques': 2, 'inflam': 2, 'inflamed lungs': 2, 'microglia inflamed in MS': 3, 'inflamed mandible': 1, 'inflamed pulp tissue': 1, 'inflammed joints': 4, 'erythematous inflamed papules': 1, 'benign urachal anomalies': 1, 'urachal infection': 8, 'Inflamed mucosa': 3, 'inflamed pulp': 2, 'inflamed eyes': 16, 'Angiogenic and Inflamed Tumors': 1, 'inflamed cyst': 7, 'inflamed sores': 2, 'Inflamed Mucosa': 5, 'Inflamed depression': 1, 'Inflamed tumor': 1, 'inflamed pannus': 1, 'urachal anomaly infected': 1, 'infected urachal anomaly': 3, 'infected urachal cysts': 34, 'Inflamed eye': 1, 'infected urachal sinus': 14, 'infected urachal sinuses': 2, 'autoimune inflamation of thyroid gland': 1, 'inflamed skin': 19, 'inflamed pancreas': 4, 'inflamed diverticulum': 3, 'GI-inflamed': 1, '-inflamed': 3, 'systemic inflamation': 2, 'inflamation in': 1, 'inflamation in the lung': 1, 'thyroid inflamed': 1, 'UC inflamed': 1, 'Infected urachal cyst': 16, 'Urachal Cyst Infection': 1, 'wound and inflamation': 1, 'Inflammed': 1, 'inflamed limb/joint': 1, 'Inflamed Condition': 1, 'inflam- mation': 1, 'inflamed brain': 4, 'inflamed eye': 2, 'inflamed oral tissue': 1, 'ROLE OF INFLAMED': 1, 'hypothalamic inflamation': 1, 'inflamed synovium': 9, 'Inflamed synovium': 2, 'Inflamed Lungs': 1, 'inflamed lung': 6, 'oral inflamation': 1, 'inflamed bowel disorders': 2, 'swelling of inflamed': 2, 'inflamed bowel disease': 7, 'inflamed cartilage syndrome': 5, 'Inflamed-Suppressed Tumors': 1, 'inflamed skin disorder': 1, 'Inflamed cystadenolymphomas': 1, 'airways inflamation': 1, 'inflamed pericardium': 2, 'Inflamed oral mucosa': 1, 'inflamation of the lung': 1, 'inflamed bowel diseases': 5, 'Non-T-Cell-Inflamed Tumors': 1, 'inflamed oral mucosa': 3, 'inflamed lesions': 7, 'Inflamed pleura': 1, '-inflam.:24.3': 1, 'Inflamed Vascular Bleeding': 1, 'inflamed pleura': 7, 'brain inflamation': 1, 'inflamed muscle': 5, 'inflamed skin eruptions': 1, 'inflamed knee': 2, 'pulmonary inflamation': 2, 'ISF': 1, 'dysfunction of the inflamed eustachian tube': 1, 'inflammed legs': 1, 'necrotic inflamed myocardium': 1, 'vascular inflamation': 3, 'NI': 2, 'ITA': 1, 'Inflamed brain': 2, 'Inflamed Brain': 1, 'inflamed bowel': 15, 'Inflamed lesions': 11, 'infected urachal diverticula': 1, 'urachal cyst infection': 8, 'infected urachal diverticulum': 1, 'Inflam bowel disease': 1, 'non-urachal tumours': 2, 'Inflamed cyst': 4, 'inflamed tissue': 2, 'Non-Inflamed (Cold) Tumors': 1, 'inflamed prepuce': 1, 'INFLAMED': 7, 'edematous inflamed': 1, 'Inflamed throat': 1, 'inflam-mation': 2, 'pelvic-inflamation-disease-': 1, 'MANAGEMENT OF PELVIC INFLAMATION DISEASE': 1, 'Allergic inflamation of': 1, 'benign non-mucinous cysts': 1, 'inflamed swelling': 1, 'TCIP-L': 1, 'TCIP-H': 2, 'TCIP': 1, 'T-cell-inflamed': 1, 'TCIP-L tumors': 1, 'TCIP-H tumors': 1, 'TCIP tumors': 1, 'inflamed mollusca contagiosa': 1, 'sore and inflamed eyes': 1, 'swelling of inflamed joints': 4, 'erythematous inflamed skin': 1, 'urachal infections': 2, 'eye inflamation': 1, 'HealthyMucosa Inflamed Mucosa': 1, 'neuro-inflamation': 4, 'inflamed lesions or plaques': 1, 'eosinophilic-inflamed': 1, 'T Cell-Inflamed Tumors': 3, 'LROMno inflam': 1, 'Lung inflamation': 1, 'inflamed right eye': 1, 'benign urachal lesions': 2, 'inflamed cysts': 5, 'oral inflamed cysts': 1, 'Inflamed Cartilage Syndrome': 1, 'joints inflamation': 1, 'inflamed hips': 1, 'giant urachal cyst': 1, 'inflamed and scaly skin condition': 1, 'upper back Inflamed cyst': 1, 'inflammed lesion': 1, 'Infected urachal sinus': 2, 'Infected Urachal Sinus': 1, 'inflamed IP': 1, 'inflammed bronchial mucosa': 1, 'myocardium inflamed': 2, 'Inflamed Mesentery': 1, 'Inflamed cysts': 5, 'inflamed toe': 2, 'inflamed legs': 1, 'IIJ': 1, 'periapical inflamed tissue': 1, 'and inflammed Autopsy': 1, 'Urachal infection': 3, 'inflamed skin conditions': 3, 'Infected urachal cysts': 2, 'Infected Urachal Cyst': 5, 'Urachal cyst infection': 1, 'IS': 3, 'inflamed brain tissue': 1, 'inflammed alterations': 1, 'Inflamed serosa': 1, 'Pelvic Inflam': 1, 'udder inflamation': 1, 'infected maternal urachal cyst': 1, 'T cell-inflamed': 1, 'non-T cell-inflamed tumors': 1, 'Non-T Cell-Inflamed Tumors': 2, 'T Cell-Inflamed': 1, 'Anti-inflam': 2, 'INFLAM': 5, 'UNINFLAMED INFLAMED': 1, 'inflamed joint': 5, 'inflamed phyma': 1, 'inflamed bowel disorder': 1, 'urachal sinus infections': 1, 'inflamed elbow': 1, 'rheumatoid inflamed': 2, 'microglia-inflamed': 1, 'astrocyte-inflamed in MS': 1, 'MIMS-foam': 1, 'AIMS': 2, 'inflamed CNS lesions': 1, 'Inflamed uterus': 1, '-inflammed organic disorders': 1, 'Inflammed organic disorders': 1, 'psoriatic inflamed': 2, 'urachal cyst infections': 1, 'Urachal cyst infections': 2, 'Inflamed Pouch Mucosa': 1, 'inflammed sinus': 1, 'inflamed lumps': 1, 'inflaming lung': 1, 'inflamed molluscum': 2, 'Inflam.': 1, 'INFLAM MATORY DISEASES': 1, 'dry or inflamed skin': 1, 'granulomatous inflamation': 2, 'Pelvic inflam': 1, 'Immune-inflamed': 1, 'inflamed hemorrhagic': 1, 'inflamed tissues': 1, 'chronic inflam-mation': 1, '-inflammed': 1, 'Inflamed ulcer': 1, 'Inflam-mation': 1, 'inflamed cornea diseases': 1, 'Throat inflamation': 1, 'Pleura inflamation': 1, 'Inflamed skin': 3, 'inflamed lesion': 3, 'infected urachal': 2, 'inflamed degenerated': 1, 'astrocytes inflamed': 1, 'inflamed in': 1, 'MIMS-': 2, 'MIMS-AIMS': 1, 'infected urachal cyst sinus': 1, 'infected urachal cyst and sinus': 1, 'skin inflamed': 2, 'toxic heat inflaming syndrome': 1, 'inflammed choriocapillaris': 1, 'infected UC': 2, 'inflamed vascular disorders': 1, 'inflamed disc': 1, 'duct inflammed': 1, 'inflamed joint syndrome': 1, 'inflamed noduli': 1, 'inflamed lesions of': 1, 'economias inflamables': 1, 'economia inflamable': 1, 'inflamed wounds': 1, 'inflamed skin problems': 1, 'Urachal remnant infection': 2, 'urachal remnant infection': 1, 'MedCan-Inflam': 1, 'pyogranuloma of inflamed epididymis': 1, 'inflamed root': 1, 'INF': 3, 'inflammed lungs': 1, 'IMS': 2, 'inflammed cysts': 1, 'allergic lung inflamation': 1, 'Inflamed tooth': 1, 'ILV': 1, 'Interstitial inflamation': 1, 'inflamed appendagitis': 1, 'inflamed nodule': 1, 'inflamed in MS': 1, 'lung inflam': 1, 'Fully-inflammed': 1, 'FI tumors': 1, 'FI': 2, 'inflammed cyst': 1, 'inflam-matory myopathies': 1, 'NID': 1, 'ID': 1, 'Inflamed tissue': 1, 'LID': 1, 'T cell-inflamed tumors': 1, 'lung inflamation': 4, 'bronchial inflamation': 1, 'Inflamed diverticulum': 5, 'Swollen and inflammed joints': 1, 'SALICYLATE FOR INFLAMED': 1, 'Myocardial Inflamation': 1, 'inflamed pterygia': 1, 'gut inflamation': 1, 'inflamed scalp': 1, 'inflamed hearts': 1, 'Granulom inflam': 1, 'inflam.': 2, 'dry and inflamed skin': 1, 'Inflammed joints': 1, 'inflamed oesophagus': 1, 'IPs': 1, 'inflamed bowel problems': 1, 'benign urachal disease': 2, 'Gastrointestinal ulcer/chronic inflamation': 1, 'Benign urachal lesions': 1, 'infected urachal duct cysts': 1, 'I-I': 1, 'I-I tumors': 1, 'iPAPCs': 1, 'trachomatous inflamation-': 1, 'TI': 1, 'Inflamed Cysts': 1, 'inflamed adenoids': 1, 'inflamed SB': 1, 'inflamed hair follicle': 1, 'periapical inflamed': 2, 'inflammed sinus mucosa': 1, 'TARGETING INFLAMED ENDOTHELIUM': 1, 'joints inflamed': 2, 'inflamation of internal organs': 1, 'infected urachal masses': 1, 'inflamed rheumatic joint': 1, 'inflamed skin conditions.18': 1, 'itchy and inflamed skin': 2, 'dry or inflamed skin condition': 1, 'dry and/or inflamed skin conditions': 1, 'inflamed piles': 1, 'inflamed or': 1, 'allergic inflamations of the lungs': 1, 'benign urachal mass': 2, 'benign urachal lesion': 1, 'mammary inflamation': 1, 'inflammed lump': 1, 'benign urachal anomaly': 1, 'inflamed muscles': 1, 'nail changes*Dactylitis*Inflamed': 1, 'inflamed granuloma': 1, 'Inflamed Lesions': 1, 'allergic inflamation': 1, 'Inflamed molluscum': 1, 'corneal inflamation': 1, 'Pulmonary inflamation': 1, 'JOINT INFLAMATION': 1, 'ROLE OF C5a IN INFLAMATION': 1, 'Inflammed funicular cyst': 1, 'Inflamed myocardium': 1, 'inflamed palate': 2, 'lung inflamed': 4, 'inflammed injuries': 1, '-ulcerated inflamed lesion': 1, 'inflamed corneal nerves': 1, 'Inflamed Airway Mucosa': 1, 'Metabolic-Neuron-Inflamed': 1, 'inflamed marrow': 1, 'Urachal remnant infections': 1, 'Anti-inflamation': 1, 'gonadal inflamation': 1, 'inflamed ulcer': 1, 'inflamed effusion': 1, "inflamed'": 1, 'inflamed carcinoma': 1, "inflamed carcinoma's": 1, 'urachal remnants infection': 1, 'inflamed mucosa-dysplasia-carcinoma': 1, 'POST-INFLAMED': 1, 'Inflamed Vasculature Disease': 1, 'urachal infected tumors': 1, 'inflamed hip joints': 1, 'inflamed uterus': 5, 'MICROBIAL REGULATION OF INFLAMATION': 1, 'inflamed back lump': 1, 'Inflamed back lump': 1, 'inflamed back lumps': 1, 'allergically inflamed': 1, 'Mucosa inflamed versus detrusor inflamed': 1, 'inflamed) tumors': 1, 'benign urachal diseases': 1, 'inflamed cutaneous nodules': 1, 'TG-inflam': 1, 'inflamed umbilicus': 1, 'infection of the inflamed pancreas': 1, 'ocular inflamation': 1, 'UC Inflam': 1, 'Non-specific orbital inflamation (NSOI) syndrome': 1, 'umbilical and urachal infection': 1, 'Inflamed nevus': 1, 'ALLERGIC INFLAMATION': 1, 'inflamed pulp of': 1, 'IJCN': 1, 'swollen inflamed': 1, 'Inflamed mucosa and': 1, 'I-I TMEs': 1, 'Inflamed pterygium': 1, 'THE INFLAMED': 1, 'Inflamed lesion': 1, 'inflammed lesions': 3, 'chronic inflamed bowel': 4, 'inflam-matory disorders': 1, 'inflamed benign naevi': 1, 'inflamed melanocytic lesions': 1, 'infected urachal anomalies': 1, 'Inflamed ligamentum teres': 1, 'Inflamed fingers': 1, 'inflamed fingers': 1, 'multisystem inflam-matory syndrome': 1, 'inflamed NLS': 1, 'inflamed sinus': 1, 'swollen or inflamed joints': 1, 'swollen/inflamed joints': 1, 'inflamed cartilage - MAGIC syndrome': 1, 'chronically inflamed': 1, 'infection of an urachal sinus': 1, 'pulp inflamed': 2, 'Inflamed Nodular Lesions': 1, 'TREATING INFLAMED': 1, 'inflamed pingueculum': 1, 'Granulomatous Inflamation': 1, 'endothelial inflamation': 1, 'Immune-Inflamed tumors': 1, 'erythematous inflamed palate': 1, 'infection of the urachal cyst': 1, 'rheumatoid inflamed joints': 3, 'benign urachal masses': 1, 'inflamed sores in': 1, 'erosions of inflamed mucosa': 1, 'IN': 1, 'Inflamed pancreas': 1, 'non-urachal neoplasms': 1, 'inflamed rheumatic joints': 1, 'Inflamed juvenile nevus': 1, 'atrophic and inflamed pancreas': 1, 'infected uracheal cyst': 1, 'inflamed bowel syndrome': 3, 'inflamed lesionf': 1, 'infected urachal cyst and abscess': 1, 'inflamed nevus': 2, 'periapical tooth inflamation': 1, 'Inflamed Tumors': 2, 'Inflamed Gastrointestinal Mucosa': 1, 'Inflamed lung': 1, 'hepatic inflamation': 1, 'FID': 1, 'FID tumors': 1, 'inflamed skin epithelium': 1, 'rheumatic inflamed': 1, 'NINF': 1, 'hoof inflamation': 1, 'Benign non-mucinous cysts': 1, 'postoperative inflamation': 1, 'Inflamed A': 1, 'Inflamed B tumors': 1, 'inflamed dulla': 1, 'swelling of inflamed tissue': 1, 'TREATMENT OF INFLAMED': 1, 'Allergic inflamation': 1, 'Inflamed synovia': 1, 'PMID Inflam': 1, 'PI': 1, 'Inf': 2, 'Joint inflamation and destruction': 1, 'inflame-matory diseases': 1, 'Inflamed joints': 1, 'inflammed lung': 1, 'urachal infected cyst': 1, 'Giant abscessed urachal cyst': 1, 'CIG': 1, 'inflamed concha bullosa': 1, 'TCIA': 1, 'IUP': 1, 'IP': 1, 'inflammed pleura': 1, 'API': 1, 'allergic pulmonary inflam- mation': 1, 'inflamed trachea': 1, 'airway inflamation': 1, 'Inflamed Tumor': 1, 'inflammed piles': 1, 'inflammed tenditis': 1, 'skin inflamation': 1, 'Inflamed Uterus': 1, 'inflamed gut mucosa': 1, 'necrotic inflamed vessels': 1, 'benign non mucinous cyst': 1, 'NI-MC lesions': 1, 'NI-MC': 1, 'inflamed granulomas': 1, 'gynaecological inflamations': 1, 'Inflam inflammatory': 1, 'Inflamed sinus': 1, 'swollen and inflamed throat': 1, 'Myeloid-Inflamed Tumor': 1, 'systemic inflamations': 1, 'renal injury and inflamation': 1, 'Inflamed Gut Mucosa': 1, 'COLLAGENOLYTIC ACTIVITY EXERTED BY DIFFERENT TYPES OF INFLAMED TISSUES': 1, 'inflamed LN': 1, 'inflamed enthesitis': 1, 'Non-Inflamed Tumor': 1, 'Catabolic/inflam': 1, 'Allergic inflam': 1, 'Microglia inflamed': 1, 'Urachal Remnant Infection': 1}
|
inflamed
|
Disease
|
MESH:C531844
|
{'von Willebrand factor': 410, 'vWF deficiency': 63, 'deficiency or dysfunction of von Willebrand factor': 9, 'deficiency of the von Willebrand factor': 19, 'deficiency of von Willebrand factor': 78, 'vWF dysfunction': 3, 'factor von Willebrand': 5, 'von Willebrand factor type D': 20, 'von Willebrand factor deficiency': 103, 'VWF deficiency': 139, 'deficiency of VWF': 77, 'Willebrand factor': 9, 'vWD': 4, 'vWf disease': 1, 'Von Willebrand factor defects': 1, 'deficiency of von Willebrand factor cleaving protease': 7, 'Deficiency of vWF': 3, 'VWF-deficient': 14, 'VWF-/-': 2, 'VWF deficient': 4, 'Von-Willebrand factor': 2, 'Acquired defects of VWF': 1, 'vWf-deficient': 6, 'vWF': 28, 'SWIFT': 1, 'SWIFT-VWDext': 1, 'SWIFT-VWD': 1, 'deficiency of vWF': 20, 'von Willebrand Factor': 9, 'factor VIII and von Willebrand factor': 2, 'VWF': 76, 'von Willebrand factor abnormalities': 21, 'deficiency of von Willebrand factor-cleaving protease': 22, 'deficiency of the VWF-cleaving protease': 1, 'VWF dysfunction': 6, 'VWF disease': 5, 'von Willebrand factor (vWF) deficiency': 12, 'von Willebrand Factor disease': 2, 'Von Willebrand factor': 35, 'von Willebrand factor related disorders': 1, 'vWF-deficient': 3, 'Hereditary von Willebrand factor (vWF ) deficiency': 1, 'deficiency of von Willebrand Factor': 5, 'dysfunction of the von Willebrand factor': 2, 'Von Willebrand factor deficiencies': 1, 'of VWF': 13, 'deficiency of the von Willebrand factor (': 5, 'deficiency of von Willebrand factor (vWF)-cleaving protease': 2, 'Deficiency of von Willebrand factor-cleaving protease': 2, 'VWF protein deficiency': 1, 'VWD': 14, 'vWF deficiency in type 1 and 3': 1, 'acquired von Willebrand (vWF) syndrome': 1, 'vWF anomaly': 1, 'Deficiency of the von-Willebrand factor': 1, 'deficiency of the von Willebrand factor (VWF) cleaving protease': 1, 'von Willebrand factor-': 3, 'Von Willebrand Factor deficiency': 2, 'the von Willebrand factor-cleaving protease': 1, 'von Willebrand factor antigen': 3, 'von Willebrand factor defect': 9, 'Deficiency of von Willebrand factor': 2, 'von Willebrand factors (vWF) deficiency': 1, 'Low von Willebrand factor': 4, 'deficiency of plasma (and platelet) von Willebrand factor': 1, 'deficiency of plasma von Willebrand factor': 6, 'acquired von Willebrand factor syndrome': 5, 'von Willebrand factor-deficient': 3, 'vWFD': 1, 'deficiency of VWF.1': 1, 'deficiency of Von-Willebrand factor': 1, 'deficiency or defect of Von-Willebrand factor': 1, 'PT-VWF': 1, 'VWF deficiencies': 21, 'deficient von Willebrand factor': 1, 'von Willebrand factor-cleaving protease (ADAMTS13) deficiency': 1, 'von Willebrand factor defects': 2, 'von willebrand factor': 2, 'VWF abnormalities': 21, 'low von Willebrand factor': 3, 'constitutional deficiency of the von Willebrand factor-cleaving protease': 1, 'type I vWd': 1, 'vWd': 1, 'type I vWf deficiency': 1, 'deficiency of the von Willebrand factor cleaving protease': 2, 'Defective von willebrand factor': 1, 'Von Willebrand factor (vWf': 1, 'congenital or acquired deficiency of the von Willebrand factor-cleaving protease': 1, 'rVWF': 4, 'complete deficiency of vWF': 1, 'von Willebrand factor D': 5, 'von Willebrand factor (': 3, 'Von Willebrand Factor': 2, 'vWF abnormalities': 10, 'von Willebrand factor (vWf) deficiency': 3, 'ANTI-WILLEBRAND FACTOR': 1, 'deficiency of the von Willebrand factor-cleaving protease': 10, '1 VWF': 1, 'quantitative von Willebrand factor (VWF) deficiencies': 1, 'von Willebrand factor disease': 10, 'dysfunction of von Willebrand factor': 5, 'deficiency of the von-Willebrand factor (VWF': 1, 'absence of VWF': 1, 'Von Willebrand factor abnormalities': 2, 'deficiency of von Willebrand factor lyase': 1, 'von Willebrand factor syndrome': 4, 'AVWS': 2, 'vWf abnormality': 1, 'deficiency of plasma VWF': 3, 'ULVWF': 4, 'Von Willebrand factor deficiency': 14, 'von-Willebrand factor': 3, 'VWF syndrome': 3, 'von Willenbrand factor deficiency': 1, 'deficiency in von Willebrand factor': 3, 'von-Willebrand factor type D': 1, 'VWF and FVIII deficiencies': 1, 'Functional von Willebrand factor (': 1, 'Willebrand factor deficiency': 4, 'vWf deficiency': 3, 'von Willebrand factor-D': 2, 'WILLEBRAND FACTOR': 2, 'von Willebrand factor VIII': 5, 'WARP': 1, 'deficiency of plasma von Willebrand factor (vWF)-cleaving protease': 1, 'deficiency of von Willebrand factor-cleaving metalloprotease': 2, 'vWA': 1, 'VMAP': 1, 'Combined von Willebrand factor deficiency': 1, 'inherited defects of von Willebrand factor': 1, 'deficit of factor VIII-von Willebrand complex': 2, 'von Willebrand factor concentrate': 5, 'von Willebrand factor related disorder disease': 1, 'von Willebrand factor dysfunction': 4, 'abnormality of von Willebrand factor': 5, 'acquired von Willebrand Factor Deficiency': 1, 'Acquired von Willebrand factor deficiency': 7, 'Acquired Von Willebrand Factor Deficiency': 1, 'Congenital Von Willebrand deficiency': 1, 'von Willebrand Factor deficiency': 9, 'AVWFD': 1, 'Von Willebrand Factor Deficiency': 4, 'type II vWF deficiency': 1, 'deficiency of both vWF and FVIIIc': 1, 'VWDE': 1, 'vWF-cp': 2, 'deficiency of acquired von Willebrand factor': 1, 'deficiency of the vWF': 1, 'deficiency of Von Willebrand factor': 4, 'von Willebrand factor (VWF) deficiency': 15, 'low VWF': 1, 'Deficiency in the von Willebrand factor (VWF)-cleaving protease': 1, 'FvW': 1, 'deficiency of von Willebrand factor (': 3, 'hereditary deficiency of von Willebrand factor protease': 1, 'the von Willebrand factor': 1, 'von Willebrand human factor': 1, 'Thrombotic von Willebrand factor': 1, 'deficiency in Von Willebrand factor': 1, 'vWF abnormality': 1, 'von Willebrand factor (VWF) disease': 2, 'deficiency of vWF-cleaving metalloprotease': 1, 'vWB factor deficiency': 1, 'von Willebrand factor) deficiency': 1, 'von Willebrand factor-cleaving protease deficiency': 4, 'Deficiency of von Willebrand factor (VWF)-cleaving protease': 1, 'Von Willebrand factor disease': 1, 'vWf': 6, 'von Willebrand factor type 1': 1, 'AVWD': 1, 'von-Willebrand factor deficiency': 2, 'acquired vWF syndrome': 2, 'von Willebrand Factor VIII': 5, 'deficiency of von Willebrand Factor (vWF) cleaving metalloproteinase': 1, 'deficiency of defective VWF': 1, 'type 2) deficiency of von Willebrand factor': 1, 'Congenital and acquired deficiency of the von Willebrand (vWD) factor cleaving protease': 1, 'von-Willebrand-factor deficiency': 1, 'deficiency of von Willebrand Factor (VWF) cleaving metalloproteinase': 1, 'function of vWF': 1, '-I vWf': 1, 'deficiency of the von Willebrand factor (VWF)-cleaving protease': 1, 'type 2) deficiency of VWF': 2, 'acquired von Willebrand factor defect': 1, 'vWF syndrome': 4, 'deficiency of von Willebrand factor (VWF)-cleaving protease': 2, 'VWF-CP deficiency': 3, 'AiVWFD': 1, 'autoimmune VWF deficiency': 1, 'Autoimmune Acquired von Willebrand Factor Deficiency': 1, 'deficiency of specific von Willebrand factor-cleaving protease': 1, 'Von Willebrand factor dysfunction': 3, 'Von Willebrand factors': 1, 'vWF-deficiency': 1, 'deficiency in VWF': 1, 'von Willebrand factors': 6, 'von Willebrand factor large multimer deficiency': 1, 'of vWF': 2, 'type 2 VWF deficiency': 2, 'type 1 - partial quantitative deficiency of vWF': 1, 'decrease of von Willebrand factor': 1, 'VWF deficiency (type 1, 2, or 3': 1, 'von Willebrand factor multimer cleaving protease': 1, 'AVWA': 1, 'of von Willebrand factor': 7, 'congenital deficiency of von Willebrand factor-cleaving protease': 2, 'Factor von Willebrand': 5, 'Acquired abnormalities of von Willebrand factor': 1, 'Deficiency of VWF': 4, 'VWF-cp': 1, 'deficiency of VWF-cp': 1, 'hypersensitivity to VWF': 1, 'von willebrand factor (VWF) abnormality': 1, 'von Willebrand factor abnormality': 2, 'Deficiencies of VWF': 1, 'von Willebrand factor': 1, 'quantitative von Willebrand factor (VWF) deficiency': 1, 'von Willebrand Factor (vWF) deficiency': 1, 'VWF abnormality': 4, 'deficiency of VWF-cleaving protease': 2, 'deficiency of VWF-cleaving proteinase': 1, 'deficiency of the von Willebrand Factor (VWF)-cleaving proteinase': 1, 'vWF: Ag': 1, 'deficiency of the von Willebrand factor antigen': 1, 'Von Willebrand Factor abnormalities': 1, 'Dysfunctions of vWF': 1, 'von Willebrand Factor abnormalities': 2, 'von Willebrand factor disorders': 1, 'von Willebrand factor deficiency syndrome': 1, 'inherited deficiency of the von Willebrand factor-cleaving protease': 1, 'deficiency of the von Willebrand Factor-cleaving protease': 1, 'aVWS': 1, 'acquired VWF syndrome': 2, 'acquired inhibitors against von Willebrand factor': 2, 'impairment of vWF': 1, 'Von Willebrand Factor deficiencies': 1, 'von Willibrand factor dysfunctions': 1, 'VWF dysfunctions': 1, 'deficiency or dysfunction of VWF': 1, 'constitutional deficiency of the von Willebrand factor-cleaving': 1, 'VWF-deficiency': 1, 'deficiencies of VWF': 7, 'inherited and induced von Willebrand factor (VWF) deficiency': 1, 'von Willebrand factor-cleaving protease (ADAMTS 13) deficiency': 1, 'von Willebrand factor quantitative deficiencies': 1, 'Acquired von Willebrand factor disease': 1, 'deficiency of vWF and factor VIII': 1, 'deficiency of the specific von Willebrand factor-cleaving protease': 1, 'VWF-cp deficiency': 1, 'vWD deficiency': 2, 'deficiency of the Willebrand factor': 1, 'vWF-CP deficiency': 2, 'deficiency or dysfunction of vWF cleaving protease': 1, 'VWF-Ag deficiency': 1, 'congenital deficiency of von Willebrand factor-cleaving protein': 1, 'deficiency of VWF multimers': 1, 'Von Willebrand Factor (HMVWF) deficiency': 1, 'Von Willebrand factor (VWF) deficiency': 1, 'von factor Willebrand': 1, 'vWF deficiencies': 1, 'von Williebrand factor': 1, 'von Willebrand-factor type-': 1, 'deficiency of a von Willebrand factor (vWF)-cleaving protease': 1, 'deficiency of vWF and FVIII': 1, 'von Willebrand ristocetin co-factor': 1, 'compromised Willebrand factor': 1, 'congenital vWF deficiency': 1, 'vWF Deficiency': 1, 'von Willebrand factor (vWF': 1, 'deficiencies of von Willebrand factor': 1, 'Willebrand factor (': 1, 'von Willebrand-factor type-D': 1, 'VWF+/-': 1, 'Von Willebrand factor type D': 1, 'von Willebrand factor Disease': 1, 'von Willebrands factor': 1, 'deficiency of VWF Type 3': 2, 'deficiency of VWF Type 2': 1, 'deficiency of VWF Type 1': 1, 'deficiency of the von Willebrand factor-cleaving': 1, 'von Willebrand factor deficiency or': 1, 'vWF disorders': 1, 'DYNAMICS OF SINGLE vWF': 1, 'abnormalities of the factor VIII:von Willebrand complex': 1, 'von Willebrand factor (vWF) disease': 2, 'Disordered von Willebrand factor': 1, 'Von willebrand factor D': 1, 'vWf defect': 1, 'vWf gene abnormality': 1, 'Von Willebrand clotting factor': 1, 'congenital deficiency of von Willebrand factor metalloproteinase': 1, 'deficiency of VWF-CP': 1, 'acquired von Willebrand factor (vWF) deficiency': 3, 'vWF-protease deficiency': 1, 'vWF-cleaving protease deficiency': 2, 'von Willebrand factor disorder': 1, 'of Von Willebrand factor': 1, 'of von Willebrand factor cleaving protease': 1, 'complete VWF deficiency': 2, 'von Willebrand Factor (VWF) deficiencies': 1, 'Acquired von Willebrand factor (vWF) disease': 1, 'Von willebrand factor type A': 1, 'von Willebrand factor deficient': 2, 'von Willebrand Factor Deficiency': 1, 'vWF deficiency type 2': 1, 'deficiency of the von Willebrand factor-cleaving metalloprotease': 1, 'Von Willebrand factor cleaving protease enzyme (ADAMTS 13) deficiency': 1, 'deficiency of Von Willebrand factor cleaving protease enzyme': 1, 'VWF disorders': 1, 'VWF deficiency (type 1 and 3)': 1, 'von Willebrand factor inhibitors': 3, 'von Willebrand factor (VIII/vWf': 1, 'quantitative deficiency of VWF': 1, 'Congenital deficiency of VWF': 1, 'von Willebrand factor deficiencies': 3, 'vWF defect': 1, 'vWF-': 1, 'deficiency of the VWF': 3, 'Acquired von Willebrand factor (VWF) deficiency': 1, 'von Willebrand factor-cleaving protease) deficiency': 1, 'Isolated von Willebrand factor deficiency': 1, 'dysfunction of von Willebrand Factor': 1, 'Dysfunction in vWF': 1, 'deficiency or abnormality of von Willebrand factor': 2, 'deficiency of Von Willebrand Factor': 2, 'deficiency of the vWF-cleaving protease': 1, 'VWF-CP': 1, 'deficiency of vWF cleaving protease': 1, 'deficiency of the VWF cleaving protease': 1, 'plasma deficiency of the von Willebrand factor (': 1, '(type 2) deficiency of VWF': 1, 'von Willebrand factor (VWF) abnormalities': 3, 'Deficiency or dysfunction of VWF': 3, 'von Willebrand factor deficiency type 1': 1, 'deficiencies in VWF': 1, 'deficiency of the von Willebrand Factor': 1, 'Von Willebrand Factor-': 1, 'Deficiency of von Willebrand factor cleaving protease': 1, 'vWF disease': 5, 'TRADITIONAL vWF TESTING': 1, 'Acquired von Willebrand factor abnormalities': 3, 'VWFMs': 2, 'factor von Willebrand deficiency': 1, 'deficiency of the plasma VWF depolymerase': 1, 'FVW': 1, 'factor de von Willebrand': 1, 'abnormalities of VWF': 1, 'anomaly of the Willebrand factor': 1, 'von Willebrand factor-related disorder': 1, 'VWFM': 1, 'VWFM deficiency': 1, 'Deficiencies in von Willebrand factor': 1, 'deficiency in the von Willebrand factor': 2, 'Type 1 deficiency of VWF': 1, 'Deficient von Willebrand factor': 1, 'Deficiency of VWF Type 2': 1, 'Deficiency of VWF Type': 1, 'WARP deficiency': 1, 'WARP-deficient': 1, 'deficiency of the von Willebrand Factor (VWF)-cleaving protease': 1, 'deficiency of a von Willebrand factor (': 1, 'von Willebrand factor(vWF': 1, 'von Willebrand disease Factor V deficiency': 1, 'Acquired VWF syndrome': 1, 'VWF functional abnormalities': 1, 'type Vicenza VWF': 1, 'type 1 VWD': 1, 'Deficiency of the von Willebrand cleaving enzyme': 1, 'deficiency of von Willebrand (vW) factor cleaving protease': 1, 'deficiency of vWF-cleaving protease': 2, 'acquired von Willebrand factor deficiency': 6, 'Acquired and congenital von Willebrand factor abnormalities': 1, 'congenital deficiency of von Willebrand factor': 1, 'von-Willebrand factor and factor-VIII deficiencies': 1, 'deficiency of von Willebrand factor(vWF)-cleaving protease': 1, 'Low von Willebrand Factor': 3, 'deficiency and dysfunction of von Willebrand factor': 1, 'fvW': 1, 'Deficiency or dysfunction of von Willebrand factor': 1, 'von Willebrand factor type C': 2, 'von Wilebrand factor': 1, 'vWF deficient': 1, 'Fetal and neonatal von Willebrand factor': 1, 'dysfunction of the VWF': 1, 'deficiency or dysfunction of the von Willebrand factor': 1, 'abnormalities of von Willebrand factor': 2, 'of Willebrand factor': 1, 'Von Willebrand Factor D': 1, 'AMOP -vWD': 1, 'thrombotic von Willebrand factor': 1, 'Deficiency of the von Willebrand factor (VWF': 1, 'Hemophiliavon Willebrand diseaseSpecific factor deficienciesBD': 1, 'von willebrand factor deficiency': 1, 'congenital or acquired deficiency of VWF-CP': 1, 'von Willebrand clotting factor': 1, 'acquired von Willebrand factor (VWF) abnormalities': 1, 'deficiency or defect of von Willebrand factor': 2, 'van Willebrand factor (vWF) deficiency': 1, 'Von-Willebrand factor deficiency': 1, 'Low VWF': 1, 'congenital defects of von Willebrand factor': 1, 'deficiency of the Von Willebrand factor-cleaving protease': 1, 'abnormalities of the von Willebrand factor': 1, 'type II von Willebrand factor deficiency': 1, 'abnormality of vWF': 1, 'von Willebrand Factor Concentrate': 1, 'deficiency of the von-Willebrand Factor-cleaving protease': 1, 'VWF:RCo deficiency': 1, '-large von Willebrand factor': 1, 'VWF Deficiency': 1, 'von Willebrand factor multimer deficiency': 1, 'inherited or acquired deficiency of the von Willebrand factor-cleaving protease': 1, 'in the von Willebrand Factor': 1, 'Acquired inhibitor of von Willebrand factor': 1, 'absent von Willebrand factor': 1, 'VWF-cleaving protease deficiency': 1, 'deficiency or functional abnormality of von Willebrand Factor': 1, 'deficiency of a von Willebrand factor (VWF) -cleaving protease': 1, 'von vWF': 1, 'Proteolysis of von Willebrand factor': 1, 'von Willebrand Factor type D': 1, 'acquired vWF deficiency': 1, 'deficiency in the von Willebrand factor cleaving protease': 1, 'von Willebrand factor protease deficiency': 1, 'LVWF': 1, 'deficiency in von Willebrand factor-cleaving metalloprotease': 1, 'Deficiency of vWf': 1, 'Deficiency in VWF': 1, 'VWD type 1 and 1 factor [F]XIII deficiency': 1, 'abnormalities of vWF': 1, 'Acquired deficiency of von Willebrand factor': 1, 'congenital or acquired deficiency of the VWF cleaving enzyme': 1, 'VWF deficiency or': 1, 'von Willebrand Factor deficiency syndrome': 1, 'inherited deficiency of von Willebrand factor': 2, 'Deficiency of Von Willebrand factor (VWF)-cleaving protease': 1, 'functional abnormalities of von Willebrand factor': 1, 'von Willebrand Factor Deficiency and Dysfunction': 1, 'VWFcp deficiency': 2, 'EFFECT OF vWF': 1, 'VWF multimer deficiency': 1, 'deficiency of factor VWD': 1, 'deficiencies of Willebrand factor': 1, 'quantitative deficiencies of VWF': 1, 'von Willebrand Factor deficient': 1, 'Von Wilebrand factor': 1, 'congenital or acquired deficiency of the von Willebrand factor (VWF) cleaving protease': 1, 'constitutional deficiency of vWF-cleaving protease': 1, 'complete deficiency of VWF': 1, 'von Willebrand factor-related disease': 1, 'type 3 VWD': 1, 'deficiency of von Willebrand factor (vWF) cleaving metalloproteinase': 1, 'Von-Willebrand Factor': 1, 'deficiency in vWF': 2, 'vWF multimer deficiency': 1, 'deficiency of the von Willebrand factor (vWF)-cleaving protease': 1, 'type 2D VWF disease': 1, 'factor Willebrand': 1, 'Von Willebrand factor syndrome': 1, 'complete deficiency of the VWF': 1, 'von Wilebrandt factor deficiency': 1, 'von Willibrand Factor': 1, 'deficiency of von Willebrand factor protease': 1, 'Type III von Willebrand factor deficiency': 1, 'deficiency of VWF Type 1': 1, 'deficiency of VWF Type 2': 1, 'congenital deficiency of vWF': 1, 'von Willebrand factor and type 1': 1, 'ultra-large von Willebrand factor': 1, 'inherited VWF deficiency': 1, 'type 1 vWF disease': 1, 'deficiency of a plasma von Willebrand factor-cleaving protease': 1, 'VWFcp': 1}
|
von Willebrand factor
|
Disease
|
MESH:C531847
|
{'deficits of the pyramidal tract': 1, 'autonomic nerve or pyramidal tract dysfunction': 1, 'Degeneration of the pyramidal tract': 4, 'Degeneration of the pyramidal tracts': 2, 'pyramidal tract involvement': 87, 'Pyramidal tract impairment': 1, 'pyramidal tracts damage': 4, 'pyramidal tract dysfunction': 165, 'pyramidal tract': 58, 'pyramidal tract symptoms': 30, 'pyramidal tracts lesion': 2, 'pyramidal tract signs': 30, 'py': 2, 'pyramidal tract damage': 77, '(Wallerian) tract degeneration': 1, 'Pyramidal tract lesion': 4, 'pyramidal tract lesion': 67, 'pyramidal tract degeneration': 68, 'pyramidal cell degeneration': 34, 'pyramidal-tract disorder': 1, 'PT': 84, 'dysfunction of the pyramidal tract': 3, 'dysfunction in the pyramidal tract': 1, 'pyramidal tract lesions': 82, 'pyramidal tract injury': 34, 'Wallerian degeneration of the CST': 3, 'pyramidal tract degeneration/': 1, 'pyramidal tract syndrome': 34, 'Wallerian Degeneration of the pyramidal tract': 1, 'degeneration of the pyramidal tracts': 12, 'hypoplasia of the pyramidal tracts': 4, 'PT damage': 4, 'pyramidal tract (': 1, 'PT) damage': 1, 'CA1 pyramidal cell degeneration': 1, 'Pyramidal tract damage': 2, 'Pyramidal tract': 2, 'pyramidal tract anomaly': 2, 'and pyramidal tract deterioration': 1, 'pyramidal tract diseases': 4, 'pyramidal tract disruption': 3, 'degeneration of the pyramidal': 3, 'pyramidal tract disturbance': 4, 'pyramidal tract disorder': 13, 'Wallerian degeneration of corticospinal tract': 6, 'pyramidal tract atrophy': 5, 'degeneration of bilateral pyramidal tract': 2, 'pyramidal tract impairment': 23, 'pyramidal tract deficit': 2, 'pyramidal tract WD': 1, 'Pyramidal tract degeneration': 5, 'PT stroke': 1, "pyramidal cells' degeneration": 1, 'wallerian degeneration of the corticospinal tract': 3, 'Atrophy of the pyramidal tracts': 1, 'Pyramidal tract lesions': 4, 'pyramidal tract dysfunctions': 4, 'pyramidal tract deficits': 2, 'Muscular and pyramidal tract involvement': 1, 'pyramidal tract abnormalities': 14, 'pyramidal degeneration': 41, 'lesions of the pyramidal tract': 4, 'pyramidal tract system damage': 1, 'Retrograde Wallerian degeneration of the CST': 1, 'pyramidal tract disease': 13, 'pyramidal-tract lesions': 2, 'contralateral impairment of the pyramidal and sensory tracts': 1, 'ORIGIN OF THE PYRAMIDAL TRACT': 1, 'PTN': 7, 'PTNs': 18, 'damage to the spinal motor neurons and pyramidal tract': 1, 'atrophic pyramidal tract': 1, 'degeneration of the pyramidal tract': 14, 'Pyramidal degeneration': 2, 'degeneration of the pyramidal motor system': 1, 'pyramidal tracts dysfunction': 3, 'pyramidal tract necrosis': 2, 'pyramidal system degeneration': 2, 'cerebellar or pyramidal tract': 1, 'pyramidal-tract impairment': 1, 'pyramidal tract(PT) injury': 1, 'and pyramidal tract involvement': 2, 'PT lesions': 4, 'PT lesion': 3, 'spastic and pyramidal tract signs': 1, 'pyramidal tract agenesis': 1, 'and pyramidal tract dysfunction': 1, 'Wallerian degeneration of the corticospinal tracts': 1, 'pyramidal tract weakness': 2, 'pyramid degeneration': 1, 'Pyramidal tract dysfunction': 9, 'pyramidal and sensory tract injury': 1, 'hypoplastic pyramidal tracts': 2, 'pyramidal tract disorders': 7, 'Wallerian degeneration of OT': 1, 'degeneration of pyramidal cells': 5, 'pyramidal tract injuries': 3, 'disease of the pyramidal tracts': 1, 'pyramidal tract myelopathy': 1, 'pyramidal tract defect': 1, 'pyramidal tract deficiency syndrome': 1, 'PT neuron': 2, 'pyramidal tract or sensory nerve involvement': 1, 'pyramidal tract affection': 5, 'PYRAMIDAL TRACT': 8, 'pyramidal tract sign': 5, 'brain and/or pyramidal tract damage': 1, 'pyramidal tracts impairment': 1, 'lesion of the pyramidal tract': 9, 'the pyramidal tracts': 1, 'pyramidal tract strokes': 2, 'cerebellar or pyramidal tract abnormalities': 1, 'ET': 1, 'pyramidal tract (PT) lesions': 2, 'cortical and pyramidal tract dysfunction': 1, 'of the pyramidal tract': 1, 'degeneration of pyramidal tracts': 3, 'PT injury': 2, 'pyramidal tract (PT) injury': 1, 'pyramidal tract-lesion': 1, 'Wallerian degeneration of the corticospinal tract': 14, 'Wallerian degeneration of CST': 2, 'pyramidal tract abnormality': 3, 'Wallerian degeneration of the PCT': 1, 'Wallerian degeneration of the pontocerebellar tract': 1, 'PyT': 1, 'lesion of pyramidal tract': 2, 'cystic degeneration of the pyramidal tract': 1, 'wallerian degeneration of the pyramidal tract': 6, 'Wallerian degeneration of the pyramidal tract': 6, 'motor deficits in the pyramidal tract': 1, 'disturbance of the pyramidal tract': 1, 'injury to the pyramidal tract': 1, 'to pyramidal tracts': 1, 'cerebellar and pyramidal tract symptoms': 1, 'degeneration of long pyramidal tract': 1, 'atrophy of the pyramidal tract': 2, 'hypoplasia of pyramidal tracts': 2, 'Atrophy of the basal ganglia and pyramidal tract degeneration': 1, 'pyramidal tracts': 5, 'Wallerian degeneration of corticospinal tracts': 2, 'hypoplasia of the pyramidal tract': 2, 'pyramidal tract syndromes': 2, 'hypoplasia of the optico-pyramidal tracts': 2, 'Wallerian tract degeneration': 3, 'extra-pyramidal degeneration': 1, 'dysfunction of pyramidal tract': 1, 'degeneration of pyramidal tract': 2, 'pyramidal tract malformations': 2, 'malformations of the human pyramidal tract': 1, 'cerebellar and pyramidal tract involvement': 1, 'Pyramidal tract disease': 1, 'the pyramidal tract': 3, 'and pyramidal tract damage': 1, 'cerebellar and pyramidal tract abnormalities': 1, 'chronic disorders of the pyramidal tract': 1, 'pyramidal tract ischemic lesions within the': 1, 'pyramidal tract impairments': 1, 'degeneration of the pyramidal dendritic system': 1, 'PYRAMIDAL TRACTS': 1, 'impairment of the pyramidal tract': 2, 'Wallerian degeneration of the pyramidal bundle': 1, 'Wallerian) degeneration of the CST': 1, 'pyramidal cell (PC) degeneration': 1, 'disease of the pyramidal tract': 1, 'atrophy of the pyramidal tract system': 1, 'atrophy of pyramidal tract': 1, 'pyramidal (corticospinal) tract dysfunction': 1, 'cortical lesions of the pyramidal tract': 1, 'pyramidal tract hypoplasia': 2, 'atrophy of pyramidal tracts and': 1, 'cortical and pyramidal tract deterioration': 2, 'damage to the PT': 1, 'pyramidal tract (PT) damage': 1, 'degeneration in pyramidal tracts': 1, 'pyramidal tract irritation': 3, 'dysfunction or degeneration of the pyramidal tracts': 1, 'or pyramidal tract involvement': 1, 'damage to the pyramidal tracts': 1, 'CST-WD': 1, 'Wallerian degeneration of the pyramidal': 2, 'cerebellar and pyramidal tract': 1, 'pyramidal tracts degeneration': 2, 'Pyramidal tract dysfunctiona': 1, 'pyramidal tract compression': 4, 'pyramidal-tract related weakness': 1, 'pyramidal-tract-related weakness': 1, 'Bulbar and pyramidal tract involvement': 1, 'Pyramidal tract syndrome': 4, 'of pyramidal tracts': 1, 'CSTWd': 1, 'anterograde (Wallerian) degeneration of the corticospinal tracts': 1, 'abnormalities in the pyramidal tracts': 1, 'absent pyramidal tract': 1, 'PTs': 1, 'pyramidal tract stroke': 1, 'Bowel/bladder and pyramidal tract dysregulation': 1, 'pyramidal cortex and tract impairment': 1, 'Pyramidal Tract Injury': 2, 'pyramidal tract agenesis/hypoplasia': 2, 'pyramidal tract hypoplasia or asymmetry': 1, 'pyramidal tract damage syndrome': 1, 'degeneration and necrosis of pyramidal cells': 1, 'degeneration of hippocampal pyramidal cells': 1, 'Pyramidal tract symptoms': 2, 'degeneration of pyramidal': 3, 'lesion of pyramidal tract involvement': 1, 'Degeneration of pyramidal cells': 1, 'iPT': 1, 'absence of pyramidal tracts': 1, 'pyramidal tract insult': 1, 'Pyramidal tract hypoplasia': 1, "Waller's degeneration of the pyramidal tract": 1, 'Wallerian) tract degeneration': 1, 'Damage to the motor cortex and pyramidal tract': 1, 'in the pyramidal tract': 1, 'PTD': 1, 'of the pyramidal tracts': 1, 'MODULATION OF POPULATION OF PTNs': 1, 'THAT PTNs ACTIVE DURING RAKE': 1, 'L5 PT': 1, 'pyramidal tract disturbance of the': 1, 'APT': 2, 'Damage to pyramidal tracts': 1, 'cortex or pyramidal tract injuries': 1, 'PY injuries': 1, 'pyramidal and sensory tract dysfunctions': 1, 'pyramidal and/or sensory tract symptoms': 1, 'Pyramidal tract injuries': 1, 'damage of the pyramidal tracts': 1, 'impairment of pyramidal tracts': 1, 'PT-l': 1, 'degeneration of the extra-pyramidal motor system': 1, 'degeneration of the PT': 1, 'Wallerian degeneration of pyramidal tract': 1, 'pyramidal tract and peripheral dysfunction': 1, 'pyramidal tract disturbances': 2, 'lesion in the pyramidal tract': 1, 'or pyramidal tract': 1, 'PYs degeneration': 1, 'PY Degeneration': 1, 'PY': 1, 'to the pyramidal tract': 2, 'pyramidal tracts and': 1, 'primary lesion of the pyramidal tract': 1, 'diseases of the pyramidal tract': 1, 'cortical pyramidal tract lesion': 1, 'cortical pyramidal tract lesions': 1, 'hypolasia and hyperplasia of the pyramidal tract': 1, 'Pyramidal tract abnormalities': 1, 'dysfunction of the pyramidal tracts': 1, 'PT-cre': 1, 'degeneration of pyramidal and': 1, 'impaired pyramidal tract': 1, 'Pyramidal Tract Impairment': 1, 'impairment of pyramidal tract': 1, 'Pyramidal Tract Damage': 1, 'agenesis of the pyramidal tracts': 1, 'dysplastic pyramidal tracts': 1, 'abnormalities in the pyramidal tract': 1, 'injuries to the pyramidal tract': 1, 'bulbar and pyramidal tract dysfunction': 1, 'pyramidal tract symptom': 2, 'disturbances of the pyramidal tract': 1, 'cerebral pyramidal tract lesion': 1, 'Pyramidal Tract Lesion': 1, 'pyramidal-tract symptoms': 1, 'degeneration of CA1 pyramidal': 1, 'pyramidal or corticobulbar tract lesion': 1, 'of the pyramidal tract function': 1, 'degeneration and necrosis of pyramidal': 1, '-PT': 1}
|
pyramidal tract dysfunction
|
Disease
|
MESH:C531849
|
{'lipophagic granuloma': 16, 'non tropical sprue': 2, 'intestinal granulomatosis': 1, 'Non-tropical sprue': 9, 'non-tropical sprue': 25, 'BILATERAL PREMAMMARY LIPOPHAGIC GRANULOMA': 1, 'lipophagic necrosis': 1, 'Non-Tropical Chyluria': 1, 'Non tropical sprue': 1, 'lipophages': 1, 'lipophagic disorders': 1, 'Lipophagic granuloma': 3, 'lipophage granulomas': 1, 'non-tropical diseases': 2, 'lipophagic impairment': 1, 'Non-Tropical Diseases': 1, 'lipophagic granulomas': 3, 'on non tropical sprue': 1, 'Lipophagic intestinal granulomatosis': 1, 'non-tropical chyluria': 2, 'Non-tropical infections': 1, 'lipophagic lipoatrophy': 2, 'non-Tropical sprue': 1, 'Non-Tropical Sprue': 1, 'Non-tropical chyluria': 1, 'NTC': 1, 'lipophage': 1, 'LIPOPHAGIC GRANULOMA': 1, 'lipophagic granulomatosis': 2, 'Lipophagous Granuloma': 1, 'lipophagic reactions': 1, 'non-tropical': 1, 'lipophagic': 1, 'non tropical diseases': 1, 'non-tropical botfly infection': 1, 'Autophagic and Lipophagic Impairment': 1, 'Intestinal granulomatosis': 2, 'nNL-TIA': 1, 'Non-tropical sprue-like syndrome': 1, 'non-malarial tropical infections': 1, 'Lipophagic granuloma of the mammary gland': 1, 'tropical and non-': 1, 'non-tropical infections': 1, 'intestinal and hepatic granulomatosis': 1}
|
non-tropical sprue
|
Disease
|
MESH:C531854
|
{'CE': 132, 'CHS-CS': 1, 'fumarylacetoacetate hydrolase (FAH) deficiency': 19, 'lysosomal acid lipase deficiency': 269, 'DNA Damage': 51, 'DNA damage': 175, 'LAL': 226, 'cholesteryl ester storage disease': 220, 'LAL-deficiency': 8, 'LAL-ko': 1, 'CESD': 902, 'LAL infectioning': 1, 'FAAH-deficient': 1, 'PGHs': 5, 'Cholesteryl ester storage disease': 70, 'CHS': 52, 'Hydrolases': 118, 'FAMEs': 17, 'HD': 14, 'FAH': 56, 'deficiency of fumarylacetoacetate hydrolase': 45, 'EH': 49, 'LAL deficiency': 154, 'LAL-D': 91, 'LAL-D.': 38, 'lysosomal acid lipase (LAL) deficiency': 30, 'acid lipase': 3, 'lysosomal acid lipase enzyme deficiency': 1, 'XTH': 56, 'meibomian CE': 3, 'DNA lesions': 21, 'Acid hydrolase deficiencies': 1, 'CHEMS': 16, 'CESD depression': 2, "C3'H deficiency": 1, 'like Hydrolase': 1, 'ABHSF': 1, 'FAAEs': 2, 'fumarylacetoacetate hydrolase deficiency': 26, 'acid lipase disease': 1, 'Fah (fumarylacetoacetate hydrolase) deficiency': 1, 'DNA damages': 16, 'cholesteryl ester storage disease (CESD': 1, 'deficiency of lysosomal acid lipase': 17, 'ZHD': 4, 'Lysosomal Acid Lipase Deficiency': 48, 'KA lesion': 10, 'Cholesteryl Ester Storage Disease': 34, 'acidic hydrolase': 1, 'deficiency in fumarylacetoacetate hydrolase': 2, 'Lysosomal acid lipase deficiency': 100, 'LIPA deficiency': 4, 'deficiency of LAL': 10, 'Lysosomal acid lipase (LAL) deficiency': 21, 'LAL-deficient': 14, 'FAH deficiency': 56, 'MPH': 8, 'Deficiency of lysosomal acid lipase': 5, 'deficiency in lysosomal acid lipase': 3, 'LAL deficiencies': 4, 'LAL Deficiency': 9, 'CESD Disease': 1, 'FAE': 3, 'cholesteryl storage disease': 2, 'Lysosomal lipase deficiency': 2, 'DHCHs': 1, 'hydrolases': 22, 'CESD-10': 12, 'deficiency of lysosomal acid hydrolase': 1, 'nCEH': 6, 'EHs': 26, 'LEHs': 1, 'Damage to Nucleic Acids': 1, 'Deoxyribonucleic Acid Damage': 7, 'fumarylacetoacetate-hydrolase deficiency': 1, 'GAS': 1, 'XTHs': 11, 'CHE': 1, 'cholesteryl ester storage diseases': 2, 'lysosomal acid lipase': 8, 'Deficiency of FAH': 5, 'Epoxide Hydrolases': 9, 'Wolman disease and cholesteryl ester storage disease': 4, 'acid hydrolases': 2, 'CESD-': 7, 'KA lesions': 4, 'TGH deficiency': 3, 'TGH Deficiency': 2, 'epoxide hydrolase deficiency': 5, 'EL': 27, 'FAEs': 2, 'AOAH deficiency': 6, 'PGH': 3, 'ABHD': 12, 'CEH': 10, 'Fatty acid amide hydrolase deficiency': 2, 'hydrolase deficiencies': 2, 'KA-lesion': 2, 'acid/peptic acid disease': 3, 'ibotenic acid lesion': 8, 'IAL': 1, 'Fumarylacetoacetate hydrolase (FAH) deficiency': 3, 'CERM': 7, 'LAL occlusion': 2, 'QA lesion': 18, 'deficiency in the FAH': 1, 'CHOLESTERYL': 3, 'FAH-deficiency': 6, 'APEH': 2, 'Fah deficiency': 14, 'AEH': 2, 'acid damage': 9, 'deficiency of lysosomal acidic lipase': 1, 'Wolman or cholesteryl ester storage disease': 1, 'CAH': 4, 'RMCAH': 1, 'Moorella CAH': 1, 'LIPA disorders': 1, 'cholesteryl ester storage disorder': 9, 'QA lesions': 5, 'PEFA': 4, 'hydrolase': 18, 'CESD-20': 5, 'Phthalate Esters Hydrolase': 1, 'LAL-XXX': 1, 'fumarylacetoacetate hydrolase (Fah) deficiency': 9, 'deficiency of fumaryl acetoacetic acid hydrolase': 1, 'LAL-B': 3, 'Nucleic acid damage': 3, 'Nucleic Acid Damage': 5, 'Wolman and Cholesteryl Ester Storage Diseases': 1, 'CESD-R': 13, 'Hypotonic, Acidic Oxidizing Solution Containing Hypochlorous Acid': 1, 'Epoxide Hydrolase': 5, 'Deficiency of LIPA': 1, 'LALd': 1, 'FAH-deficient': 28, 'ibotenic acid lesions': 5, 'NAs Damage': 1, 'Hydrolase': 32, 'Bari-Jheh': 1, 'lysosomal acid lipase complete deficiency': 1, 'lysosomal acid cholesteryl ester hydrolase deficiency': 1, 'acid cholesteryl ester hydrolase deficiency': 3, 'LAL Deficiency"[tiab': 1, 'CESD"[tiab': 1, 'LIPA deficiency"[tiab': 1, 'LAL-93': 1, 'LIPA': 10, 'deficiency in the lysosomal acidic SMase': 1, 'Juvenile Hormone Epoxide Hydrolase': 1, 'TGH': 7, 'FAAE': 3, 'hydrolase deficiency': 3, 'ABH': 4, 'APEH-1Dl n.a': 1, 'PMHs': 2, 'DNA lesion': 6, 'CESD-R-10': 3, 'FAH dysfunction': 1, 'MGL': 1, 'complete or partial lysosomal acid lipase (LAL) deficiency': 1, 'Dysfunction of monoacylglycerol lipase': 1, 'Ibotenic acid lesions': 1, 'LAL insufficiency': 1, 'OxCE': 4, 'TGH-deficient': 1, 'TGH deficient': 1, 'CESD-D': 6, 'AH': 3, 'lysosomal acid deficiency': 2, 'Deficiency of LAL': 5, 'IBO lesions': 5, 'RP-LALD': 1, 'CA-LALD': 1, 'LAL deficient': 7, 'FAME': 9, 'lysosomal acid lipase deficiency disease': 1, 'DNA-Damage': 1, 'Fah-deficiency': 4, 'LALD': 33, 'Hydrolase feather': 1, 'fumarylacetoacetate hydrolase (FAH)-deficiency': 1, 'DNA-damage': 1, 'acid acid-peptic mucosal disease': 1, 'LAL reduction': 1, 'LAL defect': 1, 'FAH deficient': 8, 'ACPH': 1, 'PETases': 1, 'KA) lesion': 1, 'Acid Damage': 1, 'GH': 4, 'of fumarylacetoacetate hydrolase': 3, 'AOAH-deficient': 4, 'nucleic acid dysfunction': 1, 'Lysosomal acid lipase (LAL, EC 3.1.1.13) deficiency': 2, 'LAL coagulation': 1, 'CESD-11': 8, 'Cm-Hydrolase': 1, 'deficiency of acid hydrolase': 2, 'acid-associated diseases': 4, 'and RNA damage': 1, 'deficiency of the lysosomal acid lipase': 3, 'lysosomal lipase deficiency': 2, 'galactosyl hydrolase deficiency': 1, 'LAL-D disease': 4, 'LAL enzyme': 1, 'lysosome acid lipase deficiency': 1, 'lysosomal lipase acid deficiency': 1, 'cholesteryl ester overload disease': 1, 'ChEs': 2, 'Damage to DNA': 3, 'Fah-deficient': 9, 'deficiency of the lysosomal enzyme acid lipase': 1, '-Hydrolases': 2, 'BiuH.': 1, 'LAL-T': 3, 'acidic lesions': 2, 'infantile lysosomal acid lipase deficiency': 1, 'deficiency of fumarylace-toacetate hydrolase': 1, 'CL': 5, 'CESD-7': 4, 'Nucleic Acids Damage': 1, 'ABHD5 deficiency': 1, 'CLL': 1, 'BLMH': 3, 'Poly(A) hydrolase': 1, 'deficiency of FAH': 4, 'Familial plasma cholesterol ester deficiency': 3, 'DMSA lesions': 2, 'Lysosomal Acid Lipase (LAL) deficiency': 3, 'LAL deficiency disease': 2, 'DNA Damaging': 1, 'CESD Depression': 1, 'CESD-C': 3, 'ChEH': 5, 'CESKA LIPA AREA': 1, 'cholesterol ester hydrolase': 1, 'LAL Deficiencypatients': 1, 'CDH': 1, 'HYDROLASES': 5, 'LAL SEN': 1, 'SFAEs': 1, 'Cholesteryl Ester Storage disease': 1, 'LIPH dysfunction': 1, 'PMH': 2, 'EO-LAL-D': 1, 'RPL': 1, 'LAL 0201': 1, 'FAGE': 1, 'PHL': 1, 'Polyester Hydrolase': 1, 'Polyester Hydrolases Leipzig': 1, 'Fumarylacetoacetate hydrolase deficiency': 2, 'CH': 4, 'AEA': 1, 'PPH': 2, 'NCHH': 1, 'cholesteryl ester deficiency': 1, 'multiple hydrolase deficiency diseases': 1, 'CHP': 6, 'PASE': 2, 'CESD 6': 1, 'CESD 7': 1, 'CESD 5': 1, 'CESD 10': 1, 'CESD 2': 1, 'Cholesteryl ester storage disease liver': 1, 'HEFA': 5, 'deficiency of functional fumarylacetoacetate hydrolase': 1, 'CESD-8': 2, 'Hydrolase-': 1, 'lactosylceramide galactosyl hydrolase deficiency': 1, 'deficiency of fuarylacetoacetate hydrolase': 1, 'Fah': 2, 'XAF': 1, 'EPHs': 1, 'CFAEs': 1, 'PET hydrolase': 1, 'AA dysfunction': 2, 'CE storage disease': 10, 'Wolman/CESD': 2, 'Meibomian CE': 2, 'LAL- D': 1, 'LAL-B.': 1, 'deficiency of the fumarylacetoacetic hydrolase': 1, 'TTH': 1, 'ChoE-18:3': 1, 'WOStri Hydrolase': 1, 'Deficiency of fumarylacetoacetate hydrolase': 1, 'QAL': 1, 'enzyme fumarylacetoacetate hydrolase': 2, 'CHEH': 1, 'PGPH': 1, 'LAL) Deficiency': 1, 'thiocyanate hydrolase': 1, "Wolman's or cholesteryl ester storage diseases": 2, "Wolman's and cholesteryl ester storage diseases": 1, 'CHARACTERIZATION OF HYDROLASES': 1, 'deficiency of the lysosomal acid hydrolase': 1, 'of LAL': 2, 'I PAEs': 1, 'type II PAEs': 1, 'FABCEs': 1, 'FAIAEs': 1, 'cholesteryl easters': 1, 'EH enzyme': 1, 'RNA dysfunction': 1, 'DNA dysfunction': 2, 'FAAH deficiency': 6, 'lysosomal acid lipase insufficiency': 1, 'deficiency of epoxide hydrolase': 1, 'FDP': 1, 'Nal lesions': 1, 'Cholesteryl ester storage disorder': 2, 'CESD_12': 1, 'CESD_18': 1, 'CESD_14': 1, 'CESD_19': 1, 'CESD_15': 1, 'CESD_10': 1, 'CESD_11': 1, 'CESD_16': 1, "Localised lesions':Fusidic acid": 1, 'BH': 1, 'AN': 3, 'deficiency of lysosomal acid alphaglucosidase': 1, 'ROLE OF LYSOSOMAL ACID LIPASE-DERIVED': 1, 'CHYLOMICRON CHOLESTERYL ESTER': 1, 'adult cholesteryl ester storage disease': 1, 'Adult cholesteryl ester storage disease': 1, 'LDAH': 1, 'deoxyribonucleic acid damage': 3, 'QUIN lesions': 1, 'deficiency of cholesteryl ester': 2, 'deficiency of the lysosomal acid lipase enzyme': 2, 'CNDE': 1, 'cholesteryl ester hydrolase deficiency': 2, 'cholesteryl ester storage syndrome': 1, 'deficiency of the enzyme fumarylacetoacetate hydrolase': 2, 'LAL-TSAT': 1, 'cholesteryl pullulan': 1, 'nucleic acid lesions': 1, 'Deficiency of acylpeptide hydrolase': 1, 'ARA dysfunction': 1, 'IBO lesion': 4, 'Wolman and cholesteryl ester storage diseases': 4, 'LAL enzyme deficiency': 1, 'deficiency of CE': 1, 'deficient in LAL': 1, 'Excitotoxic acid lesions': 1, 'Wolman- and CESD': 1, 'DIPP': 1, 'ibotenic acid lesions of the': 1, 'fumarylacetoacetate hydrolase (FAH)-deficient': 1, 'LAL deficiency syndromes': 1, 'deoxyribonucleic acid (DNA) damage': 2, 'Lysosomal Acid lipase Deficiency': 1, 'Deficiency of hydrolase': 1, 'AOAH': 1, 'TTK lesion': 1, 'Lysosomal acid lipase (LAL': 1, 'deficiency of the fumarylacetoacetate (FAA) hydrolase': 1, 'fumarylactoacetate hydrolase deficiency': 1, 'CGH': 2, 'CESD 1': 1, 'LAL dysfunction': 2, 'deficiency of fumarylacetoacetate hydrolase enzyme': 1, 'and FAH-deficient': 1, 'deficiency in the lysosomal acid lipase': 1, 'CESHs': 1, 'CESH': 1, 'LAL-CL04': 1, 'LAL-CL01': 2, 'LAL-CL06': 1, 'Cholesteryl ester storage disease in the liver': 1, 'deficiency of the lysosomal hydrolase acid neuraminidase': 1, 'Phthalate Hydrolase': 1, 'AA damage': 1, 'XET': 1, 'HYD': 2, 'DNA damage DNA': 1, 'CholS': 1, 'acid rumen dysfunction': 1, 'IHL': 1, 'Congenital cholesteryl ester storage disease': 1, 'ACEH': 1, 'Neutral CE Hydrolase': 1, 'LAL D.': 2, 'Lysosomal Acid Lipase (LAL) Deficiency': 3, 'LAL D': 3, 'QUIS lesion': 1, 'Excitotoxic QUIS lesion': 1, 'CB': 1, 'and acid CEH': 1, 'Hydrolase Disease': 1, 'deficiency of acid cholesteryl ester hydrolase': 1, 'CEST': 1, 'Deficiency of serum cholesteryl-ester': 1, 'OPases': 1, 'C-LAL': 1, 'Fatty Acid Amide Hydrolase Deficiency': 1, 'MUFAME': 1, 'I-LAL': 1, 'CESD disease': 1, 'HMSA-H': 1, 'lysosomal acid lipase deficiencies': 2, 'FAPEs': 2, 'Gaucher, Fabry, and lysosomal acid lipase deficiencies': 1, 'LAL) (GenBank: NP_ 000226.2) deficiency': 1, 'Lysosomal acid lipase': 2, 'TA-G': 3, 'TA-G.': 1, '(FAH)': 1, '21-Hydrolase Deficiency': 1, '-Hydrolase': 1, 'Ibo lesion': 1, 'IH': 2, 'LPA dysfunction': 1, 'LAL-deficiencies': 1, 'LAL-QLB': 1, 'LSD Damages': 1, 'Acid mine damage': 1, 'AMD': 1, 'Carcinine Hydrolase': 1, 'CEs': 3, 'PHs': 1, 'cholesteryl esters storage disease': 1, 'HVA dysfunction': 1, 'DGH': 2, 'MGH': 1, 'deficiency in epoxide hydrolase': 1, 'LGA': 1, 'LALD lysosomal acid lipase deficiency': 1, 'NCEH': 1, 'lipase metabolism disorder': 1, 'LAL-d': 1, 'deficiency of acid hydrolases': 1, 'Damaged DNA': 1, 'PH': 2, 'Kainic acid lesion': 2, 'cholesteryl-ester storage disease': 4, 'HD 2': 1, 'HD 1': 1, 'Lysosomal lipase (LIPA/LAL) deficiency': 1, 'Wolman RLAL': 1, 'lysosomal acid lyase deficiency': 1, 'lysosomal acid lipase (LIPA': 1, 'CESD disorders': 1, 'KA and Ibo lesions': 1, 'CHARACTERIZATION OF LAL': 1, 'ROLE OF LAL-DERIVED LIPOLYTIC': 1, 'CESD 20': 1, 'CESD 4': 1, 'BLH': 1, 'lysosomal acid lipase A deficiency': 1, 'Fah Deficiency': 2, 'Cholesteryl Ester': 1, 'acid-lesion': 1, 'Kainic acid lesions': 1, 'Ochr-MPH': 1, 'REHs': 1, 'Retinyl Ester Hydrolases': 2, 'hepatic REH': 1, 'Dietary Infections Lysosomal Acid Lipase (LAL-D) deficiency': 1, 'acid lysosomal lipase': 1, 'cholesteryl ester disease': 1, 'acid lysosomal lipase deficiency': 1, 'IAH': 1, 'deficiency of the fatty acid amide hydrolase': 1, 'LAL (acid esterase) deficiency': 1, 'Bleomycin Hydrolase': 1, 'QUIN lesion': 1, 'CFASES': 1, 'CESD Anemia MPS I': 1, 'Hydrolases of the oral fluid': 1, 'lysosomal acid lipase disease': 1, 'deficiency of the lysosomal acid ester hydrolase': 1, 'glycosyl hydrolase': 1, 'CESD -- 2': 1, 'Wolman/cholesteryl ester storage disease': 1, 'Acid lipase Anemia': 1, 'CESD-15': 1, 'Wolman and cholesteryl ester storage disease': 1, 'cholesteryl ester storage disease[S': 1, 'XEH': 1, 'acidic hydrolase or': 1, 'ACTIVITY OF ACID HYDROLASES': 1, 'Lysosomal Acid Lipase deficiency': 1, 'HA': 1, 'lysosomal acid lipase deficiency-associated': 1, 'lysosomal acid lipase deficiency-associated disorders': 1, 'IA lesions': 1, 'acidic lesion': 1, 'uric acid dysfunction': 1, 'PNC': 1, 'lysosomal acid-lipase (LAL) deficiency': 1, 'Cholesteryl Ester storage disease': 1, 'Esters 1,3': 1, 'IBA lesions': 1, 'deoxyribonucleic acid (DNA) lesions': 1, 'deoxyribonucleic acid damages': 1, 'ester hydrolases': 1, 'Ester Hydrolases': 1, 'CholE': 1, 'enlargement of CE': 1, 'Wolman cholesteryl ester storage disease': 1, 'HNMPA': 1, 'deficiency of human lysosomal acid lipase': 1, 'FAPE': 1, 'LAL Deficiency)': 1, 'Fah disease': 1, 'Cholesteryl Ester Acyltransferase Deficiency': 1, 'CESD-19': 1, 'DNA damage of': 1, 'fumarylacetoacetate hydrolase': 2, 'Rih Hydrolases': 1, 'DNA damage and': 1, 'CE storage diseases': 1, 'Defects in fatty acid amide hydrolase 2': 1, 'FAAH2 deficiency': 1, 'GHs': 1, 'Starch Hydrolases': 1, 'RNA damages': 1, 'LAL-OPH': 1, 'LAL-OPH07': 1, 'LAL-PH': 1, 'CES-D': 2, 'QA': 1, 'ARISE': 1, 'LAL-CL02': 1, 'cholesteryl-ester disease': 1, 'deficiencies of the lysosomal hydrolase, acid lipase': 1, 'nucleic acid lesion': 1, 'CEH deficiency': 1, '-LAL-': 1, 'Blmh deficiency': 1, 'cholesteryl ester stroage disease': 1, 'CE accumulation': 1, 'Congenital LAL deficiency': 1, 'lecithin cholesteryl ester transferase deficiency': 1, 'familial plasma cholesterol ester deficiency': 1, 'IB lesion': 1, 'DHCH': 1, 'AOHA': 1, 'acidic damage': 1, 'CHA': 1, 'acid cholesteryl ester deficiency': 1, 'AGLC': 1, 'CELC': 1, 'CHOLESTERYL ESTERS OF (O-ACYL)-omega-HYDROXY FATTY ACIDS': 1, 'MAGL dysfunction': 1, 'congenital deficiency of lysosomal acid lipase': 1, 'E8SJM LAL': 1, 'GHD': 1, 'CAHs': 1, 'CAH-PR': 1, 'Moorella thermoacetica CAH': 1, 'LAL-LCH': 1, 'Lysosomal acid lipase deficiencyLecithin-cholesterol acyltransferase deficiency': 1, 'lysosomal acid lipase deficiency': 1, 'COSase': 1, 'MUCOPEPTIDE HYDROLASES': 2, 'acid lesions': 1, 'Biuret Hydrolases': 1, 'deficiency of the fumarylacetoacetate hydrolase': 1, 'late-onset LALD': 1, 'Late-onset LALD': 1, 'deoxyribonucleic acid dysfunction': 1, 'Adol-CESD': 1, 'BiuH': 1, 'Wolman and CESD': 1, 'attenuated cholesteryl ester storage disease': 1, 'deficiency of lysosomal acidic': 1, 'Cholesteryl-ester storage disease': 1, 'deficiency of lysosomal lipase': 1, 'LAL-A slight deficiency': 1, 'LAL-D-like': 1, 'LAL-associated diseases': 1, 'ICSH': 1, 'Lysosomal acid lipase enzyme deficiency': 1, 'lysosomal acid lipase (': 1, 'cholesteryl ester storage disease': 1, 'deficiency of (Fah)': 1, 'OPH': 1, 'LAL-D - Wolman disease': 1, 'in FAH': 1, 'KA damage': 1, 'lysosomal acid lipase (LIPA) deficiency': 1, 'deficiency of the LAL': 1, 'deficiency in the hydrolase': 1, 'the hydrolase': 1, 'CLOOH': 1, 'hepatic fumarylacetoacetate hydrolase (FAH) deficiency': 1, 'Poly(ethylene terephthalate) Hydrolases': 1, 'HAAEE': 1, 'deficiency of the hydrolase': 1, 'Autosomal recessive cholesteryl ester storage disease': 1, 'cholesteryl ester': 1, 'CdhM': 1, 'DLH': 1, 'CS': 1, 'Wolman disease and CE storage disease': 1, 'EAH': 1, 'RNA damage': 1, 'Hepatic Retinyl Ester (RE) Hydrolases': 1, 'd7]-CE': 1, 'FAAH': 1, 'Commercial Hydrolases': 1, 'EAD.Cholesteryl esters': 1, 'QA lesioned': 1}
|
CESD
|
Disease
|
MESH:C535269
|
{'TRGs': 4, 'tetracycline': 834, 'TETRACYCLINE': 73, 'tet': 108, 'TETRACYCLINE IN': 2, 'TE': 112, 'TETRACYCLINE-INDUCED FLUORESCENCE TEST': 1, 'TF': 1, 'TTC': 5, 'TETRACYCLINE-RESISTANT': 6, 'TETR': 2, 'TET': 134, 'TetR': 6, 'cfos-tTA': 1, 'TETRACYCLINE ALLERGY': 1, 'TETRACYCLINE HYDROCHLORIDES': 1, 'TETRACYCLINE FLUORESCENCE TEST': 7, 'TC': 117, 'LNL-tTA': 2, 'USE OF TETRACYCLINE IN QUANTITATIVE EVALUATION': 1, 'TET-ON': 1, 'TETRACYCLINE FLUORESCENCE': 14, 'TETRACYCLINE LABELLING': 5, 'TETRACYCLINES': 45, 'Tet-ON': 2, 'rtTA': 11, 'TETRACYCLINE INDUCED FLUORESCENCE': 2, 'Tc': 61, 'TTCC': 1, 'TETRACYCLINE-METHYLENE-LYSINE IN': 1, 'Te': 3, 'MTAD': 6, 'TETRACYCLINE DEPOSITS': 2, 'TETRACYCLINE-CHLORAMPHENICOL': 1, 'tTR': 1, 'CMTs': 4, 'tTA': 26, 'TETs': 2, 'AGSuT': 1, 'tet-': 1, 'TETRACYCLINE USED PROPHYLACTICALLY': 1, 'PTMB': 1, 'TETRACYCLINE PHOSPHATE COMPLEX': 1, 'TRG': 1, 'TETRACYCLINE-INDUCED FLUORESCENCE': 2, 'tetO': 2, 'TCs': 10, 'TETRACYCLINE FLUORESCENCE OF SOME HUMAN': 1, 'TN': 1, 'TK': 1, 'TETRACYCLINE RESISTANCE': 4, 'TR': 1, 'TETRACYCLINES IN OPHTHALMOLOGY': 1, 'tTA cont': 1, 'TET 3': 1, 'TH': 6, 'tetracycline resistance': 4, 'TTCs': 1, 'TETRACYCLINE LOCALIZATION': 1, 'CEZ-TC': 1, 'CMT-3': 2, 'AHT': 2, 'EFFECT OF TETRACYCLINE': 2, 'Type 1 and 2 TDases': 1, '2 TDase': 1, '1 TDase': 1, '1 TDases': 2, 'TDase': 1, 'TDases': 2, 'Type 1 TDases': 2, '1 and 2 TDases': 1, '2 TDases': 2, 'TIA': 1, 'TETRACYCLINE-FUNGICIDINE-': 1, 'tetracycline allergy': 2, 'CHALLENGES OF TETRACYCLINE PRODUCTION': 1, 'TETRACYCLINE HYDROCHLORIDE': 1, 'tetracycline resistance proteins': 2, 'Tet': 7, 'TETRACYCLINE DERIVATIVE': 1, 'TE,': 1, 'TEO': 3, 'TCNs': 2, 'TETRACYCLINE DERIVATIVES': 2, 'Tet-R': 2, 'TRANSDUCTION OF TETRACYCLINE RESISTANCE': 1, 'Tc-': 1, 'TETRACYCLINE TREATMENT': 2, 'TCC': 3, 'TETRACYCLINE IN PEDIATRICS': 1, 'AX-TE-E-CIP': 1, 'TETRACYCLINE-PHYTATE-DIHYDRONOVOBIOCIN': 1, 'TRE': 1, 'EFFECT OF TETRACYCLINES ON': 2, 'AML-CAZ-VA-TE': 1, 'TRNG': 1, 'Tetracycline': 1, 'Nop-tTA': 1, 'TETRACYCLINE ON': 3, 'TETRACYCLINE OVERDOSAGE': 1, 'PsMD': 1, 'ACTIVATED TETRACYCLINE': 1, 'TCH': 9, 'TCN': 6, 'USE OF TETRACYCLINE AS FLUOROCHROME AND': 1, 'CLI-TE': 1, 'tetracycline sclerosis': 1, 'TE-': 1, 'TOXICITY OF THE TETRACYCLINES': 1, 'TETRACYCLINE DISCOLOURATION': 1, 'TETRACYCLINE ACCUMULATION': 1, 'TETRACYCLINE-L-METHYLENELYSINE': 2, 'tetR': 3, 'TETRACYCLINE BONDS': 1, 'METHYLPYRROLIDINE TETRACYCLINE HYDROCHLORIDE + PHENYRACILLIN': 1, 'TETRACYCLINE-INDUCED': 2, 'OF TETRACYCLINE': 1, 'TETRACYCLINE AND': 2, 'tTS': 2, 'tetracycline resistance protein': 1, 'OF TETRACYCLINES': 1, 'ATC': 2, 'TETRACYCLINE GROUP': 2, 'TO': 1, 'TETRACYCLINE BY': 1, 'TETRACYCLINE-BITARTRATE': 1, 'TETRACYCLINES WITH': 1, 'TETRACYCLINE-METHYLENE-LYSINE': 1, 'VALUE OF A NOVOBIOCIN-TETRACYCLINE COMBINATION': 1, 'TET-CIP-NAL': 1, 'tet-TK': 1, 'TETRACYCLINE FLUORESCENCE IN': 1, 'ANTIBACTERIAL ACTIVITY OF TETRACYCLINES': 1, 'WAP-rtTA': 1, 'TETRACYCLINE FLUORESCENCE OF': 1, 'TET-R.': 1, 'TET-R': 1, 'CMT-5': 1, 'TETRACYCLINE-1': 1, 'SIDE-EFFECTS OF TETRACYCLINES ON': 1, 'TETRACYCLINE HC1': 1, 'CMT': 3, 'TEC': 2, 'EFFECTS OF TETRACYCLINE': 1, 'Em Tc': 1, 'tNM': 1, 'tetracycline-resistance': 1, 'TETRACYCLINE TOXICITY': 2, 'NAL-CIP-TET': 1, 'TET-': 2, 'TET-SXT-NAL': 1, 'Osx-tTA': 1, 'TcR': 3, 'TETRACYCLINES IN': 1, 'TCY': 2, 'TREs': 1, 'HTL': 1, 'TETRACYCLINE-INDUCED AUTOFLUORESCENCE': 1, 'tetracycline destructases': 2, 'TETRACYCLINE THROUGH THE HEMATO-ENCEPHALIC BARRIER': 1, 'EFFECT OF TETRACYCLINE ON': 3, 'TETRACYCLINE ASSOCIATION': 1, 'MT': 1, 'tetracycline-': 1, 'TETRACYCLINE DEGRADATION': 1, 'TC-H': 1, 'CIP TCY': 1, 'TETRACYCLINE SERIES': 2, 'TETRACYCLINE ADMINISTRATION': 3, 'CT': 1, 'TETRACYCLINE HEPATOTOXICITY': 2, 'TA': 2, 'TETRACYCLINE-NOVOBIOCIN COMBINATION': 1, 'tetr': 1, 'TETRACYCLINE COMBINATION': 1, 'MIP-rtTA::TRE': 1, 'LDD': 1, 'tetA': 1, 'PENETRATION OF TETRACYCLINE': 1, 'TETRACYCLINE ULTRAVIOLET FLUORESCENCE': 1, 'nCMT-3': 1, 'TETRACYCLINE OINTMENTS': 1, 'TC-OC': 1, 'TETRACYCLINE ACTIVATED BY PHYTIC ACID ON': 1, 'THE EFFECTIVENESS OF TETRACYCLINE IN': 1, 'InvRas': 1, 'ETS': 1, 'TETRACYCLINE-L-METHYLENE': 1, 'TRE.FXE': 1, 'TETRACYCLINE-NOVOBIOCIN': 1, 'Smx-T-E': 1, 'class A tetracycline': 1, 'TETRACYCLINE EFFECTS': 1, 'cTGM': 1, 'type 1 and type 2 TDases': 1, '1 and type 2 TDases': 1, 'type 2 TDases': 1, 'type 1 TDases': 1, '- OX- TE- 1': 1, 'TMS': 1, 'TETRACYCLINE-OLEANDOMYCIN COMBINATION': 1, 'Tetr': 1, 'TETRACYCLINE-REGULATED TRANSACTIVATION': 1, 'A-T-TM': 1, 'TTA': 1, 'TDs': 1, 'aTC': 1, 'TTCH': 1, 'ATc': 2, 'TETRACYCLINES ON': 1, 'TETRACYCLINES AND': 1, 'ERY&TC': 1, 'TR-LEF': 1, 'TETRACYCLINE-FLUORESCENCE TEST': 1, 'tet(A)': 1, 'TETr': 2, 'TETRACYCLINES AS THERAPEUTIC ADJUNCTS': 1, 'tet (': 1, 'TE-E-CLI': 1, 'TCLs': 1, 'ATM': 1, 'Tet-S': 1, 'TC-r': 1, 'MAC-PNC-TET': 1, 'tet(': 1, 'TETRACYCLINE-TREATED': 1, 'TETRACYCLINE AS': 1, 'TETRACYCLINE HCL': 1, 'MRKPC': 1, 'MR': 1, 'TETRACYCLINE COMPLEXES': 1, 'Tet-ON SYSTEM': 1, 'AM-E-P-TET': 1, "CMT'S": 1, 'TETRACYCLIN': 1, 'TcS': 1}
|
tetracycline
|
Disease
|
MESH:C535273
|
{'KRAEPELIN': 3, 'Kraepelin symptom': 1, 'Kraepelin': 12, "Kraepelin's disease": 4, "Kraepelin's schizophasia": 1, 'CHALLENGE TO KRAEPELIN': 1, "Kraepelin's paraphrenia": 1, "Kraepelin's paraphrenic patients": 1, 'Kraepelin-Fraud syndrome': 1, 'UCHIDA-KRAEPELIN TEST': 1, 'Kraepelin-Fraud Syndrome': 1, 'Kraepelin-fraud syndrome': 1, "Kraepelin's Dementia": 1, 'Emil Kraepelin': 1, 'KRAEPELIN CHARACTER TYPES': 1, 'Kraepelin disease': 1}
|
Kraepelin
|
Disease
|
MESH:C535274
|
{'THE syndrome 2': 1, 'DADA 2 syndrome': 1, 'PRS': 314, 'retardation and dysmorphism syndrome': 1, 'chto PRS': 1, 'neurodevelopmental, dysmorphic/congenital malformation syndromes': 1, 'APDSs': 1, 'PI3Kdelta syndrome 2': 3, 'APDS2': 3, 'PRS type': 1, 'Hyperhemolytic syndrome 2': 1, 'Warkany syndrome 2': 8, 'linked syndromic': 1, 'celiac-PRS': 1, 'dysmorphic/mentally retarded': 1, 'BASC-PRS': 2, 'PRS-CS': 7, 'retardation, dysmorphism': 2, 'Reyes-Prieto A': 1, '-Prieto': 5, 'Kallman syndrome 2': 4, 'Cerebral atrophy Dysmorphisms': 1, 'PRS_type': 2, 'zoea 2 syndrome': 4, 'Warkany Syndrome 2': 2, 'mentally retarded and dysmorphic': 4, 'cerebral X-ALD': 2, 'del22q11.2) syndrome': 3, 'del22q11.2 syndrome': 18, '2 syndrome': 2, 'Hypertelorism Mental retardation Del(22q11.2) syndromes': 1, 'PRS-19': 2, 'PRS postreperfusion syndrome': 1, 'dysmorphic and neurodevelopmental traits': 1, 'Samilson-Prieto III': 1, 'Samilson-Prieto': 8, 'Del22q11.2 syndrome': 2, 'Neurodevelopmental and dysmorphic': 1, 'disequilibrium syndrome 2': 2, 'retardation of cerebral ageing': 1, 'dysmorphic/mental retardation syndrome': 1, 'Dup22q11.2 syndrome': 1, 'AD-PRS': 4, 'linked syndromes': 2, 'dysmorphic UMIs': 1, 'phosphor-ribosyl-pyrophosphate (PPRP) synthetase (PRS) hyperactivity': 1, '-PRS': 6, 'O-PRS': 1, '2 MLS': 1, 'Samilson-Prieto Allain': 1, 'Zoea 2 syndrome': 2, 'PRS-I superactivity': 2, 'dysmorphic and mentally retarded': 7, 'mental retardation, and disequilibrium syndrome 2': 1, 'MD*PRS': 1, 'CS': 1, 'RETARDED CEREBRAL': 1, 'Palacin Prieto': 1, 'PRS-FEP': 1, 'dysmorphic and slightly retarded': 1, 'dysmorphic, slightly retarded': 1, 'dysmorphic, mentally retarded': 1, 'asute resriratory syndrome soronavirus 2': 2, 'Syndrome 2': 5, 'neurodevelopmental disorder with dysmorphism': 1, 'dysmorphic mentally retarded': 3, 'X-linked dysmorphic syndrome': 1, 'complex dysmorphic syndromes': 1, 'Haley Syndrome 2': 3, 'lamin-linked syndromes': 1, 'NEAR/2 syndrome': 6, 'PRS-8': 1, 'mentally retarded dysmorphic': 2, 'MA-PRS': 1, 'cerebral dysfunction or retardation': 1, 'Reyes-Prieto': 1, 'dysmorphic familial syndrome': 1, 'Psycho-syndrome 2': 1, 'Otofaciocervica syndrome 2': 1, 'dysmorphic retarded': 1, '111/2 Syndrome': 1, '151/2 Syndrome': 2, 'X-linked-inherited psychomotor retardation': 1, 'PRS.ACT.3PL': 1, 'Gov PRS': 2, 'cerebral neurodevelopmental': 1, 'S-P': 1, 'PRS_14': 1, 'Prieto PA': 1, 'cerebral developmental retardation': 1, 'TE-PRS': 1, 'PRS-I': 5, 'PRS-I hypoactivity disease': 1, 'Prieto syndrome': 1, 'cardiocerebral syndrome 2': 1, 'disequilibrium syndrome-2': 1, 'Betacoronavirus-linked syndromes': 1, 'Beta-CoV-linked syndromes': 1, '-dysmorphic neurodevelopmental condition': 1, 'Syndromes polymalformatifs 2': 1, '2 CHS': 1, 'Engraftment syndrome 2': 1, 'COPA syndrome.2': 1, 'syndromic 2': 1, 'Samilson-Prieto radiographic osteoarthritis': 1, 'PRS-I deficiency': 4, 'KI-PRS': 1, 'Algodistrofic syndrome 2': 1, 'genetic dysmorphic/mental retardation syndrome': 1, 'mentally retarded dysmorphic man': 1, 'OPHN1 syndrome 2': 1, 'PRS-I superactivity disorder': 1, 'hypertensionType 2 diabetesMetabolic syndrome': 1, 'SPO': 1, 'Prieto-Frias': 1, 'cerebral retardation': 4, 'syndrome 2': 3, 'PPS 2': 1, 'linked, syndromic': 1, 'Syndromic 2': 1, 'APDS type 2': 1, 'APDS) type 2': 2, 'type I PRS': 1, 'LQT-2 syndrome': 3, 'ER-PRS': 1, 'adult PRS': 1, 'RIN2 syndrome': 4, 'Dysmorphism 2': 1, 'PRS) disease': 1, 'PI3KDelta syndrome (APDS) type 2': 1, 'HFpEF syndrome.2': 1, 'X-linked inherited psychomotor retardation': 1, 'neurodevelopmental delays,2': 1, 'del22q11.2 Syndrome': 1, 'Prieto-syndrome': 1, 'PRS-GO': 2, 'Fabella syndrome 2': 1, 'mtDNA-linked syndrome': 1, 'PRS-050': 2, 'PRS X 23': 1, 'PRS X 19': 1, 'PRS O': 1, 'MD_PRS': 1, 'Adherence syndrome 2': 1, 'SS?2': 1, 'geriatric syndromes.2': 1, 'FE-PRS': 1, 'psychiatric PRS': 1, 'Samilson & Prieto': 1, 'X-linked overgrowth and dysmorphic syndrome': 1, 'Ailette Prieto': 1, 'NF2 syndrome': 2, 'autosomal dominant neurodevelopmental dysmorphic syndromes': 1, 'Mental retardation Dysmorphism': 1, 'PRS-1 deficiency': 1, 'Iglesias-Prieto': 1, 'pacemaker syndrome.2': 1, 'Syndrome 1 Syndrome 2': 2, 'Immunodefiency Syndrome 2': 1, 'cerebral and neurodevelopmental impairments': 1, 'PRS-RS': 1, 'Samilson-Prieto stage 3-4': 1, 'centrosome-linked syndrome': 1, 'mental retardation dysmorphism syndrome': 1, 'hyperphosphatasemia with mental retardation syndrome 2': 1, 'cerebral atrophy with reduced cerebral function': 1, 'PRS pulmonary-renal syndrome': 1, 'PRS super activity syndrome': 1, 'PRS disease': 2, 'PRS Super Activity Syndrome': 1, 'PRS Super Activity syndrome': 1, 'zapote prieto': 1, '151/2 syndrome': 1, '3-PRS': 1, 'Samilson and Prieto': 5, 'and Prieto': 2, 'SPC': 1, 'dup17p11.2 syndrome': 1, 'SCH-PRS': 1, 'triglyceride-PRS': 1, 'PRS clefting': 1, 'SoxE-linked syndromes': 1, 'linked syndrome': 1, 'HFrEF-PRS': 1, 'KCNE-linked syndromes': 1, 'cerebral dysmorphism': 1, 'familial mental retardation protein 2': 1, 'punch drunk syndrome,2': 1, 'E-PRS': 1, 'Shiwen Syndrome 2': 1, 'AF-PRS': 2, 'X-linked skeletal syndrome': 1, 'dysmorphic and retarded': 1, 'Fun-PRS': 1, 'dup22q11.2 syndrome': 1, 'J-PRS': 1, 'elongase-linked syndromes': 1, 'PRS RCT': 1, 'foal syndrome.2': 1, 'dysmorphic MR': 1, 'dysmorphic mental retardation': 1, 'dysmorphic mental retardation syndrome': 1, 'PRS-SA': 2, 'X-linked cerebral disorders': 1, 'PRS-343': 2, 'PPG-PRS': 1, 'PRS-3': 1, 'PRS-1': 1, 'ASD PRS': 1, 'PRS F': 1, 'dup22q11.2) syndrome': 1, 'hypopathyroidism, retardation and dysmorphism (HRD) syndrome': 1, 'X-linked Prieto syndrome': 1, 'neurodevelopmental and dysmorphic features': 1, 'PRS-10': 1, 'L-PRS': 1, 'PRIETO': 1, 'retardation and dysmorphism': 1, 'dysmorphic and neurodevelopmental features': 1, 'SYNDROME 2': 1, 'cerebello-cerebral atrophy type 2 Mental retardation': 1, 'cardiac PRS': 1, 'PRS-I -hypoactivity disease': 1, 'PRS-I hypoactivity disorders': 1, 'PRS-I superactivity syndrome': 1, 'Neuropathy PRS-I': 1, 'PRS-I hypoactivity diseases': 1, 'dysmorphic and mentally defective': 1, '2-minaline HyperlipemiaPhlegm syndrome': 1, 'familial dysmorphic syndromes': 1, 'PRS-5': 1, 'PIK3Kdelta syndrome 2': 1, 'BASC-2-PRS-C': 1, 'PRS-L': 1, '08-09-BC-PRS': 1, 'LINKED syndrome': 1, 'CREBBP-linked syndrome': 1, 'Houge-Janssen syndrome 2': 1, 'congenital skeletal dysmorphic syndrome': 1, 'PRS-I disorders': 1, 'PRS-I enzyme deficiency': 1, 'PRS-I super-activity syndrome': 1, 'PRS-I super-activity': 1, 'MLS 2': 1, 'Warkany 2 syndrome': 1, 'PRS-11': 1, 'MRXSB.2': 1, 'PRS-FHliab': 1, 'PRS;Fig': 1, 'Haley Syndromes 2': 1, 'N-PRS': 1, 'PRS-I.': 1, 'Samilson-Prieto I or II': 1, 'dysmorphic 2': 1, 'Vitreomacular traction syndrome 2': 1, 'PRS-I deficiency/Deafness-2': 1, 'and disequilibrium syndrome 2': 1, 'HSMR syndrome 2': 1}
|
PRS
|
Disease
|
MESH:C535276
|
{'primary angiitis of the CNS': 78, 'Primary angiitis of the central nervous system': 180, 'PACNS': 367, 'primary angiitis of the central nervous system': 352, 'Primary Angiitis of the Central Nervous System': 43, 'small vessel primary angiitis of the central nervous system': 2, 'Small vessel PACNS': 1, 'svPACNS': 1, 'Primary angiitis of central nervous system': 7, 'primary angiitis of central nervous system': 16, 'PACNS mass-like lesions': 1, 'primary central nervous system angiitis': 27, 'primary angiitis of the central nervous system--reply': 1, 'cPACNS': 6, 'primary angiitis of Central Nervous System': 1, 'primary angiitis of the nervous system': 5, 'primary nervous system angiitis': 1, 'Primary angiitis of central nervous system - A': 1, 'primary or secondary angiitis of the central nervous system': 2, 'primary angiitis of CNS': 6, 'Primary CNS Angiitis': 1, 'Primary Central Nervous System (CNS) Angiitis': 1, 'Primary CNS angiitis': 2, 'Adult primary angiitis of the central nervous system': 1, '-PACNS': 1, 'Mv-PACNS': 1, 'Primary angiitis of CNS': 4, 'medium vessel PACNS': 1, 'Sv-PACNS': 1, 'Primary central nervous system angiitis': 6, 'Primary angiitis of the CNS': 20, 'primary central nervous system and systemic angiitis': 2, 'primary angiitis of the peripheral nervous system': 1, 'PACNS.7': 1, 'Primary vasculitis (angiitis) of the central nervous system': 1, 'Small vessel-childhood primary angiitis of the central nervous system': 1, 'small vessel-childhood primary angiitis of the central nervous system': 1, 'Primary Central Nervous System Angiitis': 2, 'Small Vessel Primary Angiitis of the Central Nervous System': 2, 'Primary central nervous angiitis': 1, 'primary central nervous system (CNS) angiitis': 6, 'primary CNS angiitis': 15, 'primary angiitis of the central CNS': 1, 'Primary angiitis of the central': 2, 'ML-PACNS': 4, 'vessel primary angiitis of the central nervous system': 1, 'Primary Angiitis of the CNS': 3, 'Small vessel primary angiitis of the central nervous system': 1, 'Small-vessel primary angiitis of the CNS': 1, 'primary angiitis of the central system': 1, 'Primary angiitis of the central nervous system of childhood': 2, 'primary angiitis of the central': 1, 'primary angiitis/arteritis of the central nervous system': 1, 'p-cPACNS': 1, '-cPACNS': 1, 'p-PACNS': 1, 'Primary Angiitis of Central Nervous System': 5, 'Primary Angiitis of the Central Nervous System headache': 1, 'primary or isolated CNS vasculitis/angiitis of childhood': 1, 'PACNS disease': 1, 'PCNSA': 1, 'PACNS mass lesions': 1, 'PACNS overlap syndrome': 1, 'hemorrhagic PACNS': 1, 'primary and secondary angiitis of the central nervous system': 2, 'UR-PACNS': 1, 'PACNS lesions': 2, 'PACNS symptoms': 1, 'SV-PACNS': 2, 'LV-PACNS': 1, 'PACNS Clinical syndrome': 1, 'tumefactive primary angiitis of the central nervous system': 1, 'Primary angiitis of the central nervous system in': 2, 'PACNs': 2, 'Catastrophic primary angiitis of the central nervous system': 1, 'PACNS vasculitis': 1, 'Primary (isolated) angiitis of the central nervous system': 1, 'cSV-PACNS': 1, 'Small-Vessel Primary Angiitis of the Central Nervous System': 1, 'cPACNS vasculitis': 1, 'TLML-PACNS': 2, 'primary angIitis of the central nervous system': 1, 'Solitary tumor-like mass lesions of primary angiitis of the central nervous system': 1, 'Small Vessel Childhood Primary Angiitis of the Central Nervous System': 1, 'sv-PACNS': 1, 'primary angiitis of the Central Nervous System': 1, 'primary angiitis of central nervous systems': 1, 'Primary Angiitis of the central nervous system': 1, 'primary angiitis of the central nervous system of childhood': 1, 'Cerebellar PACNS': 1, 'cerebellar PACNS': 1, 'primary cerebral angiitis of the central nervous system': 1, 'primary angiitis in central nervous system': 1, 'primary angiitis of the central nervous systemReversible': 1, 'c-PACNS': 1, 'small vessel childhood primary angiitis of the CNS': 1, 'primary central nervous system (PCNS) angiitis': 1, 'PCNS angiitis': 1, 'Small vessel childhood primary angiitis of the central nervous system': 1, 'ML- PACNS': 1, 'primary and secondary angiitis of the CNS': 1, 'primary vasculitis or angiitis of the central nervous system': 1, 'Primary Angiitis of the Central Nervous System in': 1, 'PACNS 3': 1, 'systemic or primary angiitis': 1, 'Lymphocytic primary angiitis of the central nervous system': 1, 'lymphocytic primary angiitis of the central nervous system': 1, 'Small vessel childhood primary angiitis of the CNS': 1, 'relapsing primary angiitis of the central nervous system': 1, 'PACNS of': 1, 'small-vessel primary angiitis of the central nervous system': 1, 'solitary tumor-like mass lesion of PACNS': 1, 'Primary angiitis of the adult central nervous system': 1, 'PACNS)': 1, 'MV-PACNS': 1, 'AN-cPACNS': 1, 'AP-cPACNS': 1, 'vessel cPACNS': 1, 'Childhood-PACNS': 1, 'APP-cPACNS': 1, 'primary (isolated) angiitis of the central nervous system': 1, 'primary systemic angiitis': 1, 'Primary angiitis of the Central Nervous Sistem': 1, 'primary and secondary systemic angiitis': 1, 'primary angiitis of the central nervous': 1, 'PACNS primary angiitis of the central nervous system': 1, 'idiopathic Primary Angiitis of the CNS': 1, 'Primary angiitis in the CNS': 1, 'primary angiitis in the CNS': 1}
|
PACNS
|
Disease
|
MESH:C535278
|
{'choroidal, 3 iris, and 3 ciliary body tumors': 1, 'primary ciliary dyskinesia type 3': 5, 'dyskinesia.3': 1, 'MIQ-3': 1, 'situ 3 IA': 1, 'PCD 3': 1, 'no movement - 3': 1, 'TD-3': 3, 'movement disorders.3': 1, 'primary ciliary dyskinesia (PCD) type 3': 1, 'Contraction of ciliary muscle 3': 1, 'muscle movements.3': 1, 'Distance and Movement Part 3 -': 1, 'Central abnormalities II.3.a': 1, 'choroidal (C69.3) and ciliary body (C69.4) tumors': 1, 'cardiac abnormality.3': 1}
|
primary ciliary dyskinesia type 3
|
Disease
|
MESH:C535280
|
{'cortisol-secreting carcinomas': 2, 'cortisol': 769, 'MACS': 32, 'cortisol secretion': 74, 'HCC': 247, 'cortisol deficiency': 704, 'DCS': 21, 'CTS': 2, 'CORTISOL': 43, 'Cortisol deficiency': 88, 'MACE': 21, 'cortisol excess': 53, 'CORTISOL-': 1, 'CORTISOL DOSE': 1, 'CORTISOL TIME COURSE': 1, 'ACTIVITY OF CORTISOL-METABOLIZING': 1, 'CORTISOL KINETICS DURING INFUSION': 1, 'CAR': 168, 'cortisol hormone deficiency': 4, 'cortisol-secreting tumor': 13, 'Cortisol Excess': 8, 'Cortisol-secreting tumors': 4, 'ACS': 71, 'cortisolism': 30, 'CDCs': 1, 'CDC': 3, 'cortisol dysfunction': 20, 'FMC': 1, 'COR': 17, 'SINGLE LATE-NIGHT PLASMA CORTISOL': 2, 'hypo-cortisolism': 13, 'CT': 6, 'overproduction of cortisol': 1, 'cortisol-secreting adenomas': 82, 'RCC': 1, 'cortisol-secreting adenoma': 46, 'cortisol-secreting': 5, 'cortisol metabolism disorder': 1, 'cortisol dysregulation': 60, 'hyper-cortisolism': 28, 'cortisol-secreting tumors': 36, 'HC': 12, 'RLC': 1, 'NC': 1, 'LNSC': 33, 'CL': 2, 'cortisol-': 42, 'cortisol abnormalities': 19, 'cortisol secreting adenomas': 10, 'DIURNAL CORTISOL SECRETION': 1, 'cortisol-secreting carcinoma': 3, 'Cortisol Deficiency': 6, 'PTC': 2, 'cortisol-producing tumors': 15, 'Cortisol hyperactivity': 1, 'cortisol-hypersecreting adenoma': 1, 'UC': 14, 'CS': 7, 'CA': 1, 'hyper- and hypo-cortisolism': 6, 'Cortisol': 16, 'HCC Hypersecretion': 1, 'cortisol autonomy': 2, 'PACS': 6, 'HCCs': 27, 'ACR': 2, 'cortisol metabolism': 1, 'cortisol hypersensitivity': 6, 'EFFECTS OF CORTISOL ON': 1, 'cortisol disorder': 2, 'adrenal-cortisol abnormality': 1, 'cortisol-producing tumor': 6, 'COMPARISON OF CORTISOL CONTENT': 1, 'hC': 2, 'cortisol secreting adenoma': 5, 'cortisol secreting tumor': 2, 'cortisol tumors': 2, 'cortisol tumor': 2, 'cortisol resistance': 31, 'CRT': 1, 'cortisol disease': 1, 'hyper- or hypo-cortisolism': 5, 'ITS RESPONSE TO CORTISOL': 1, 'autonomous cortisol secretion': 11, 'thyroid or cortisol disorders': 1, 'LC': 3, 'Cortisol excess': 3, 'cortisol-deficiency': 2, 'PCC': 7, 'CMP': 1, 'deficiency of cortisol': 10, 'cortisol hyporeactivity': 7, 'EFFECTS OF CORTISOL': 5, 'deficiency of cortisol secretion': 3, 'cFC': 1, 'STC': 1, 'PA-ACS': 1, 'ACS-PA': 1, 'ACS-': 1, 'cortisol deficiencies': 18, 'Cortisol deficient': 1, 'cortisol hyperactivity': 8, 'PLASMA CORTISOL SUPPRESSION': 1, 'Cortisol-Secreting Tumors': 1, 'MORNING SALIVARY CORTISOL': 1, 'SALIVARY CORTISOL': 2, 'CORTISOL-C14': 1, 'cortisol-producing ACT': 1, 'SCC': 11, 'and hyper-cortisolism': 1, 'excessive cortisol': 1, 'cortisol secreting tumors': 6, 'SCDC': 1, 'EFFECT OF CORTISOL': 3, 'Cortisol Secretion': 8, 'cortisol-deficient': 4, 'CORNET': 1, 'HCL': 3, 'cortisol deficient': 12, 'A/CPAs': 1, 'mUFC': 9, 'ACS No ACS': 1, 'cortisol hypoactivity': 3, 'CRA': 2, 'cortisol-secreting mass': 1, 'CAR.Using': 1, 'inborn error of cortisol': 1, 'MCA': 1, 'CTOL': 1, 'TC': 6, 'CDR': 2, 'cortisol secretion disorder': 1, 'hypo-cortisol': 2, 'cortisol and': 3, 'cortisol adenoma': 2, 'Cortisol adenoma': 1, 'CORTISOL PRODUCTION': 1, 'Cortisol deficiencyThyroid hormone deficiencyDrug': 1, 'basal SCC': 1, 'FREE CORTISOL': 1, 'FC': 2, 'QUANTITATIVE ANALYSIS OF CORTISOL': 1, 'LTC': 2, 'ACTH/cortisol deficiency': 2, 'Cortisol-secreting adenoma': 1, 'sCort': 2, 'CORTISOL HYDROXYLATION': 1, 'CORTISOL ON': 3, 'CR': 3, 'Cortisol resistance': 4, 'hypo cortisolic': 1, 'cortisol-producing': 5, 'cortisol hypoarousal': 1, 'EFFECTS OF LONG-TERM CORTISOL': 1, 'ACS 2': 1, 'Cortisol dysregulation': 3, 'EMANCIPATE PLASMA CORTISOL': 1, 'IPPC': 1, 'cortisol deficit': 3, 'HCC*age': 1, 'SCI': 1, 'SCS': 1, 'Cortisol hyperreactive syndrome': 2, 'Hypo-cortisolism': 1, 'Hyper- and Hypo-Cortisol': 1, 'Hyper- and hypo-cortisol': 1, 'cortisol dysregulations': 1, 'ICM': 1, 'CRI': 1, 'Cortisol-Dependent Diseases': 1, 'ACTH-cortisol deficiency': 1, 'CORTISOL SECRETION': 6, 'HCC Sleep disorders': 1, 'cortisol hyperreactive': 1, 'TURNOVER OF CORTISOL': 1, 'cortisol receptor resistance': 2, 'CORTISOL SECRETION RATE': 1, 'Autonomous cortisol secretion': 5, 'cortisol rhythm disorder': 3, 'UNCONJUGAT- ED CORTISOL': 1, 'cortisol reductase deficiency': 2, 'CRD': 2, 'cortisol co-secreting adenoma': 1, 'cortisol hyperreactive syndrome': 4, 'cortisol-secreting adrenal adenomata': 1, 'MATERNAL CORTISOL': 1, 'R-Inc-SCC': 1, '-SCC': 1, 'ACTH-cortisol deficiencies': 1, 'cortisol-secreting lesions': 1, 'AI-ACS': 1, 'cortisol-secreting adrenal tumor': 5, 'PC': 6, 'BC': 1, 'Autonomous Cortisol Secretion': 3, 'SC': 6, 'CI': 1, 'NCI': 1, 'Cortisol Autonomy': 1, 'CIRCADIAN CORTISOL SECRETION': 1, 'caribou HCC': 1, 'cortisol deficiency and': 1, 'hypo- and hyper-cortisolism': 2, 'cortisol hyper-suppression': 1, 'or cortisol-': 1, 'CORTISOL UPON SOME': 1, 'hyper cortisolism': 2, 'cortisol awakening response': 1, 'LCR': 1, 'hypo-and hyper-cortisolism': 1, 'autonomous cortisol excess': 1, 'CORTISOL METABOLISM': 2, 'MC': 1, 'rHCC': 1, 'CRF': 1, 'EFFECTIVENESS OF CORTISOL': 1, 'FCF': 1, 'FCC': 2, 'CSR': 3, 'cortisol hyposecretion': 1, 'AC': 1, 'CO': 1, 'Cortisol Dependent Diseases': 2, 'Cortisol-Secreting Adenomas': 2, 'CHALLENGES OF DIAGNOSIS OF MILD AUTONOMOUS CORTISOL SECRETION': 1, 'MORNING CORTISOL': 1, 'CoAL': 2, 'cortisol thrombocytopenia': 1, 'CLU': 1, 'cortisol suppression': 2, 'congenital deficit of cortisol synthesis': 2, 'injury to the CAR': 1, 'cortisol hypersecretion': 1, 'DIURNAL CORTISOL': 1, 'SCL': 2, 'unilateral and bilateral ACS': 1, '-cortisolism': 1, 'CSAs': 3, 'cortisol withdrawal syndrome': 2, 'primary cortisol resistance syndrome': 1, 'fCM': 1, 'cortisol insensitivity': 3, 'MACS adenomas': 1, 'HC reduction': 1, 'TRANSPORT OF CORTISOL ACROSS': 1, 'TRANSPORT OF CORTISOL': 2, 'UFC': 2, 'HCC-': 1, 'HCC-P': 1, 'BIORHYTHM OF PLASMATIC CORTISOL': 1, 'MORNING SERUM CORTISOL': 1, 'CORTISOL-INDUCED INCREASE': 1, 'Adrenocortical Cortisol': 1, 'SMNC': 1, 'pituitary-dependent hyper-cortisolism': 1, 'GCE': 1, 'MEAN CORTISOL': 1, 'of cortisol synthesis': 1, 'LNPC': 1, 'abnormalities of cortisol': 1, 'cortisol-related syndrome': 1, 'adrenal cortisol-producing tumor': 1, 'CS-ACCs': 1, 'hypo- and hyperactive cortisol': 1, 'CORTISOL ACTIVATION': 1, 'cortisol-producing carcinoma': 1, 'cortisol-producing carcinomas': 1, 'sCT': 1, 'sC': 2, 'cortisol-producing adrenal tumors': 2, 'CPATs': 1, 'Hyper-cortisolism': 1, 'PLASMA CORTISOL': 1, 'BSC': 1, 'PCL': 1, 'cortisol syndrome': 1, 'mUC': 1, 'mSC': 2, 'adrenal cortisol-secreting lesions': 1, 'CAR dysregulation': 1, 'Cortisol dysfunction': 3, 'Hyper- or hypo-cortisolism': 1, 'NCS tumors': 1, 'CS adenomas': 1, 'cortisol-secreting (CS) tumors': 1, 'CS adenoma': 1, 'CS carcinoma': 1, 'NCS adenoma': 1, 'CS tumors': 1, 'NCS carcinoma': 1, 'NCS': 1, 'sCorti': 1, 'FCM': 1, 'FCI': 3, 'PRIOR-DAY IMPLICIT AFFECT AND THE CORTISOL AWAKENING RESPONSE': 1, 'MACS condition': 1, 'ACC': 1, 'inherited enzymatic deficiencies in cortisol': 1, 'cortisol binding Deficiency': 1, 'Cortisol rhythm disorder': 1, 'cortisol hypofunction': 1, 'sC-sAA': 1, 'CHANGES OF SALIVARY CORTISOL': 1, 'cortisolic adenoma': 2, 'cortisolic adenomas': 1, 'cortisol secreting (MACS) adenomas': 1, 'MECHANISM OF CORTISOL ACTION': 1, '-LABELLED CORTISOL': 1, 'SeC': 1, 'ACI': 1, 'HCC.Lay': 1, 'cortisol abnormality': 1, 'Cortisol insensitivity': 1, 'CORTISOL RESPONSE': 2, 'CORTISOL-TREATED': 1, 'CDD': 1, 'cortisol producing tumors': 1, 'cortisol disorders': 2, 'CD': 1, 'cortisol awakening': 1, 'thyroid and cortisol deficiencies': 1, 'chronic stroke': 1, 'stroke': 1, 'cortisol-secreting adrenal carcinoma': 1, 'HCC reduction': 1, 'MCE': 1, 'Blunted cortisol': 1, 'Cortisol-secreting tumor': 1, 'adrenal ACS': 1, 'EQUILIBRIUM OF CORTISOL': 1, 'pACS': 2, 'CORTISOL RESPONSES TO': 1, 'adrenal cortisol dysfunction': 1, 'DECREASED CORTISOL': 1, 'SCCs': 1, 'NCC': 1, 'cortisol synthesis deficiency': 3, 'CORTISOL EFFECTS': 1, 'CCC': 1, 'cortisol derangement': 1, 'cortisol psychosis': 1, 'Cortisol-secreting adrenal tumors': 2, 'THE EFFECT OF CORTISOL ON THE TRANSFORMATION OF HEXOSEPHOSPHATES': 1, 'of cortisol': 2, 'hyper-/hypo-cortisolism': 1, 'Endline HCC': 1, 'DCPR': 1, 'deficiency in cortisol': 1, 'AUCS': 1, 'cortisol-secreting adenomas and': 1, 'MCL': 1, 'CE': 1, 'CORTISOL TOLERANCE': 1, 'Ac': 1, 'FCMs': 1, 'STRESS-MEDIATED HAIR CORTISOL': 1, 'Disrupted cortisol circadian': 1, 'cortisol adenoma necrosis': 1, 'adrenal cortisol': 1, 'EFFECT OF CORTISOL ON SYNTHESIS': 1, 'Cortisol Secretion Disorders': 1, 'MDC': 1, 'CORTISOL CIRCADIAN': 1, 'cortisol inadequacy': 1, 'cortisol hypersensitivity syndrome': 1, 'thyroid and cortisol hormone deficiencies': 1, 'POST-ENCODING CORTISOL BENEFITS': 1, 'DAC': 1, 'MSC': 2, 'SCR': 1, 'cortisol- and': 1, 'cortisol-producing lesions': 1, 'CAR dysfunction': 1, 'the CAR': 1, 'maltreatment*cortisol': 1, 'SaC.': 1, 'MCI': 1, 'cortisol secretion disorders': 1, 'cortisol and thyroxine deficiencies': 1, 'adrenal cortisol-producing tumors': 1, 'CSA': 2, 'cIIV': 1, 'diminished cortisol': 1, 'cortisol-producing adrenal lesions': 1, 'Cortisol-Secreting Adenoma': 3, 'cortisol- and catecholamine-secreting adrenal tumor': 1, 'ACTH cortisol deficiency': 1, 'CONTRAINDICATIONS FOR CORTISOL': 1, 'CONTRAINDICATIONS OF CORTISOL DERIVATIVES': 1, 'CONTRAINDICATIONS FOR CORTISOL DERIVATIVES': 2, 'FOR CORTISOL IN PNEUMOLOGY': 1, 'PSYCHIATRIC INCIDENTS DURING CORTISOL TREATMENTS': 1, 'iSC': 1, 'cortisol deficits': 1, 'MB;Cortisol': 1, 'cortisol salivar': 1, 'CORTISOL-INDUCED': 1, 'SCCL': 1, 'CORTISOL-4-C14': 1, 'cortisol - secreting tumor': 1, 'adrenal cortisol lesions': 1, 'GENDER CORTISOL': 1, 'MPC': 1, 'cortisol secreting adrenal mass': 1, 'HCC.a': 1, 'DSC': 1, 'adrenal cortisol excess': 1, 'ECC': 1, 'cutaneous cacostasis': 1, 'cacostasis': 1, 'ACTH deficiency': 1, 'CRS Cortisol Resistance Syndrome': 1, 'cortisol rhythms': 1, 'hCort': 1, 'cortisol-secreting adrenal carcinomas': 1, 'RC': 1, 'elevada RC': 1, 'MACS-1': 1, 'MACS-2': 1, 'carcinoma of cortisol': 1, 'cortisol secretion adenoma': 2, 'CORTISOL UPON': 1, 'deficient Cort activity': 1, 'cortisol synthesis': 1, 'ectopic cortisolism': 1, 'CORTISOL RATIO': 1, 'cortisol deficiency': 1, 'CORTISOL SECRETION RATES': 1, 'CORTISOL TRANSPORT': 1, 'cortisone reductase deficiency': 1, 'Dysfunction of daytime cortisol': 1, 'EFFECTS OF OESTRADIOL ON CORTISOL SECRETION': 1, 'INHIBITORS OF CORTISOL SYNTHESIS': 1, 'TSC': 1, 'SaC': 1, 'the cortisol': 1, 'Idiopathic Cortisol deficiency': 1, 'cortisol overdosage': 1, 'cortisol-secreting adrenal tumors': 2, 'Cortisol Resistance': 1, 'PMS-C.': 1, 'ACS adenomas': 1, 'autosomal recessive inborn error of cortisol biosynthesis': 1, 'autosomal recessive inborn error of cortisol': 1, 'PCT': 1, 'hyper or hypo-cortisolism': 1, 'Cortisol secreting adenoma': 1, 'cortisol secretingadenomas': 1, 'pituitary cortisol resistance syndrome': 1, 'Blunted cortisol awakening': 1, 'blunted CAR': 1, 'Blunted CAR': 1, 'and cortisol-': 1, 'mLNSC': 1, 'deficiency of both cortisol': 1, 'adrenal-cortisol dysfunction': 1, 'cortisol adenomas': 1, 'OF CORTISOL': 1, 'Cortisol Acanthosis': 1, 'FPC': 1, 'cortisol-related diseases': 1, 'hypo- or hyper-cortisolism': 1, 'Cs deficiency': 1, 'MT/C': 1, 'THE METABOLISM OF CORTISOL': 1, 'HCC dysregulation': 1}
|
cortisol
|
Disease
|
MESH:C535281
|
{'Radial aplasia or hypoplasia': 2, 'radial aplasia': 142, 'asymmetrical radial aplasia': 1, 'radial aplasia/hypoplasia': 5, 'radial hypoplasia/aplasia': 3, 'Radial aplasia': 16, 'radial aplasia or hypoplasia': 9, 'Radial hypoplasia or aplasia': 1, 'anogenital anomalies': 28, 'aplasia of the radial artery': 1, 'Aplasia of the radial artery': 1, 'Anogenital anomalies': 1, 'anogenital, cutaneous, renal and urologic anomalies': 4, 'Radial ray aplasia': 1, 'Radial bone aplasia': 1, 'congenital radial aplasia': 3, 'right radial aplasia': 3, 'aplasia of the radial bones': 3, 'RAdial hypoplasia/aplasia': 3, 'anogenital, cutaneous, renal, and urologic anomalies': 2, 'CONGENITAL APLASIA OF RADIAL COMPONENT': 1, 'RAdial aplasia or hypoplasia': 2, 'Absence of Radius With Metacarpal Anomalies': 1, 'Congenital radial aplasia': 1, 'right thumb and radial aplasia': 1, 'radial and thumb aplasia': 1, 'radial and tibial aplasia': 1, 'aplasia of radial bones': 1, 'radial aplasia and hypoplasia': 1, 'aplasia of radial ray of hand': 1, 'anogenit anomalies': 1, 'radial aplasia of': 1, 'radial hypoplasia or aplasia': 1, 'thumb and radial aplasia/hypoplasia': 1, 'left radial aplasia': 1, 'Congenital radial and thumb aplasia': 1, 'congenital radial and thumb aplasia': 1, 'aplasia of the radial segment of the hand': 1, 'cardiac and anogenital anomalies': 1, 'Anogenital anomaly': 1, 'anogenital distance anomalies': 1, 'aplasia of the radial portion of the carpus': 1, 'anogenital neoplastic diseases': 1, 'Thumb aplasia or hypoplasia Radial defects': 1, 'Anogenital and Oral Injuries': 1, 'hypoplasia or aplasia of radial elements including the thumb': 1, 'unilateral radial aplasia': 4, 'aplasia of the radial elements': 1, 'radial ray aplasia': 5, 'radial-ray aplasia': 1, 'preaxial radial ray-thumb aplasia': 1, 'symmetric preaxial radial ray-thumb aplasia': 1, 'Unilateral radial aplasia': 1, 'radial aplasias': 2, 'RAdial hy-po/aplasia': 1, 'RAdial hypo/aplasia': 1, 'unilateral radial aplasia or hypoplasia': 1, 'anogenital and facial lesions': 1, 'RAdial hypo-/aplasia': 1, 'Congenital aplasia of the humero-radial joint': 1, 'aplasia of both radial deviation': 1, 'Radial hypoplasia/aplasia': 1, 'Radial aplasia B': 1, 'aplasia of the radial ray of hand': 1, 'aplasia of the radial digits': 1, 'congenital cardiac, urinary, and anogenital anomalies': 1, 'radial (hypo)aplasia': 1, 'Radial/thumb aplasia': 1, 'radial-thumb aplasia': 1, 'ANOMALY WITH ABSENT': 1, 'radial with or without ulnar aplasia or hypoplasia': 1, 'radial aplasia x-linked syndrome': 1, 'radial bone aplasia': 1, 'radial aplasia of the hand': 1, 'radial aplasia and hypoplasia syndromes': 1, 'Aplasia of radial bone': 1, 'radial ray aplasia or reduction': 1, 'radial aplasia) deficiency of the radius': 1, 'anogenital or oral disorder': 1, 'radial aplasia with absent thumbs': 1, 'upper-limb anomalies of the radial aplasia': 1}
|
radial aplasia
|
Disease
|
MESH:C535282
|
{'rain': 388, 'osteosclerotic': 612, 'Osteosclerotic': 49, 'osteosclerotic lesions': 329, 'Osteosclerotic lesions': 36, 'RNS': 252, 'osteosclerotic and osteolytic lesions': 14, 'osteosclerotic changes': 51, 'autosomal recessive osteosclerotic bone dysplasia': 5, 'Raine syndrome': 173, 'osteolytic and osteosclerotic': 1, 'JETS': 1, 'acid rain': 118, 'osteosclerotic lesion': 81, 'osteosclerotic reaction': 2, 'rains': 17, 'RAIN': 1, 'Rain': 44, 'osteosclerotic bone lesions': 77, 'dark rain cloud': 1, 'Raine': 23, 'osteosclerotic bone dysplasia': 63, 'osteosclerotic bone metastases': 24, 'Acid rain': 53, 'Raine Syndrome': 29, 'osteosclerotic myeloma': 167, 'SAR': 17, 'Osteosclerotic disease': 1, 'osteosclerotic and': 7, 'Osteosclerotic myeloma': 36, 'OSM': 1, 'PRS': 1, 'Rain-': 1, 'Short Rain-Short Dry': 1, 'rain-forest fires': 1, 'rain drop pigmentation': 6, 'rain forest': 15, 'osteosclerotic MBD': 1, 'Rain damage': 1, 'neonatal osteosclerotic dysplasias': 2, 'alkali rain': 1, 'Osteosclerotic myeloma (': 1, 'osteosclerotic long bone lesions': 1, 'osteolytic-osteosclerotic skeletal changes': 1, 'heavy rain': 2, 'HRRM': 1, 'with osteosclerotic myeloma': 2, "Raine's Syndrome": 3, 'DR': 2, 'rain lesions': 1, 'RII': 1, 'Osteosclerotic Bone Changes': 1, 'Stolovich-Rain': 1, 'AR': 12, 'acid rain poisoning': 1, 'autosomal recessive osteosclerotic skeletal dysplasia': 5, 'rain disasters': 4, 'osteolytic-osteosclerotic lesions': 4, 'osteolytic and osteosclerotic lesions': 21, 'osteosclerotic bone': 20, 'AciD Rain': 1, 'SREIA': 2, 'osteosclerotic change': 22, 'osteosclerotic disorders': 10, 'Rain-dance': 1, 'Rain-dance display': 1, 'rain depressions': 4, 'osteolytic osteosclerotic lesion': 1, 'osteosclerotic plaques': 1, 'Osteosclerotic and': 1, 'osteosclerotic skeletal': 1, 'Heavy Rain and Drought': 1, 'Osteosclerotic secondaries': 1, 'Osteosclerotic lesion': 5, 'osteolytic/osteosclerotic lesions': 3, 'fibro-osteosclerotic': 7, 'osteosclerotic symmetrical lesions of the long bones': 1, 'osteosclerotic focuses': 1, 'ABANDONS RNS': 1, 'osteosclerotic bone changes': 4, 'osteosclerotic skeletal lesions': 2, 'Osteosclerotic manifestations': 1, 'osteosclerotic bone disorder': 7, 'Acid Rain': 13, 'Osteosclerotic changes': 9, 'osteosclerotic conditions': 6, 'rain disaster': 7, 'Rain and Rheumatism': 1, 'osteosclerotic disorder': 9, 'osteosclerotic lesions of the pelvis': 2, 'Raine dysplasia': 3, 'Osteosclerotic Conditions': 1, 'osteosclerotic metastasese.g': 1, 'osteosclerotic foci': 3, 'Osteosclerotic Disorders': 2, 'Neonatal Osteosclerotic Dysplasias': 1, 'osteosclerotic and osteopetrotic conditions': 1, 'osteosclerotic lesion of the mandible': 1, 'osteosclerotic tumors': 4, 'osteolytic-osteosclerotic metastatic lesions': 1, 'osteosclerotic disease': 10, '-rain': 1, 'ACI': 1, 'RS': 10, 'black rain': 4, 'osteosclerotic dysplasia': 10, 'Rains Syndrome': 1, 'yellow rain': 3, 'osteosclerotic dysplasias': 2, 'Neonatal osteosclerotic dysplasias': 2, 'osteosclerotic metaphyseal': 1, 'osteosclerotic bone lesion': 12, 'osteosclerotic bone disease': 6, 'RAin': 3, 'Irrigated Rain': 1, 'RNS long': 1, 'Heavy rain': 2, 'osteosclerotic skeletal dysplasia': 4, 'osteolytic-osteosclerotic': 5, 'rain-': 1, 'osteolytic and osteosclerotic processes': 1, 'SR 19': 1, 'LR 20': 1, 'osteosclerotic tumor': 3, 'RAINs': 2, 'Osteolytic and osteosclerotic lesion of the femur': 1, 'osteosclerotic cortical lesions': 1, 'osteosclerotic genetic disease': 1, 'osteosclerotic bone metastasis': 11, 'osteosclerotic nodule': 1, 'osteosclerotic or osteolytic lesions': 1, 'rain diminution': 1, 'osteosclerotic bone disorders': 1, 'osteolytic and osteosclerotic bone disorders': 1, 'rain drop': 4, 'GOLs': 1, 'Giant Osteosclerotic Lesions': 1, 'giant osteosclerotic lesions': 1, 'osteolytic nor osteosclerotic lesions': 1, 'osteosclerotic deformity': 1, 'osteosclerotic deformities': 1, 'Congenitally osteosclerotic': 2, 'RF': 7, 'Shoulders and Raines': 3, 'rain dance': 3, 'Skeletal Osteosclerotic Lesions': 1, 'osteosclerotic thickening': 1, 'Rain,': 1, 'Heavy Rain': 3, 'Nigel Raine': 1, 'osteosclerotic or subcortical lesions': 1, 'DMR': 1, 'autosomal dominant osteosclerotic (ADO) dysplasia': 1, 'Osteolytic and/or osteosclerotic lesions': 1, 'RNS(p': 1, 'osteosclerotic bone involvement': 5, 'osteosclerotic diseases': 9, 'Osteosclerotic & osteolytic lesions': 1, 'Osteoblastic/osteosclerotic bone metastases': 1, 'osteosclerotic bone remodeling disease': 1, 'osteosclerotic bone-forming diseases': 2, 'RAINS STONE': 1, 'osteosclerotic mineralization defect': 1, 'fibro-osteosclerotic lesions': 1, 'Osteosclerotic plasmacytoma of maxillary bone': 1, 'Silver Rains': 1, 'Deforestation of the rain forest': 1, 'osteosclerotic and lytic lesions': 1, 'osteosclerotic recovering lesions': 1, 'osteosclerotic appearence': 1, 'Osteosclerotic eosinophilic granulomatosis': 1, 'LRS': 1, 'Raine osteosclerotic dysplasia': 1, 'osteosclerotic bone defects': 2, 'RS syndrome': 1, 'lethal RS': 1, 'osteosclerotic lesion of': 1, 'osteosclerotic/': 3, 'osteosclerotic bone dysplasias': 3, 'PRM': 1, 'Douglas E. Raines': 1, 'osteolytic or osteosclerotic lesions': 9, 'TRB': 1, 'osteosclerotic skull': 2, 'congenital sclerosing osteomalacia with cerebral calcification': 2, 'Congenital Sclerosing Osteomalacia With Cerebral Calcification': 1, 'osteosclerotic skeletal disease': 1, 'cyclone rain': 1, 'Rain drop hyperpigmentation': 1, 'osteolytic or osteosclerotic bone lesions': 4, 'osteosclerotic myelomas': 3, 'osteosclerotic-osteolytic': 2, 'acid-rain': 2, 'rain-forest': 1, 'acid rain corrosion': 2, 'Purple Rain': 2, 'F-RF': 1, 'osteosclerotic syndrome': 2, 'osteosclerotic/lytic bone lesions': 1, 'rain-borne diseases': 1, 'MRF': 1, 'rain flood damage': 1, 'rain flood': 3, 'osteosclerotic vertebral lesions': 2, 'osteosclerotic or': 1, 'osteosclerotic myeoloma': 1, 'osteosclerotic malignancies': 1, 'osteosclerotic malignancy': 1, 'osteolytic-osteosclerotic lesion': 1, 'osteosclerotic lesions of long bones': 1, 'osteosclerotic lesions of the long bones': 6, 'Osteosclerotic Change': 1, 'osteosclerotic bones': 3, 'osteosclerotic metastatic lesions': 4, 'osteosclerotic" myeloma': 1, 'heavy rain disaster': 1, 'lethal osteosclerotic bone dysplasia': 1, 'Lethal osteosclerotic bone dysplasia': 1, 'osteosclerotic phenotype': 4, 'rain-drop': 2, 'Osteosclerotic bone metastases': 1, 'Osteosclerotic Bone Metastases': 2, 'Rains': 2, 'osteosclerotic change of the bone': 1, 'osteosclerotic legion': 1, 'oc/oc': 8, 'osteosclerotic and osteolytic changes': 1, 'Yellow Rain': 1, 'rain injury': 3, 'Flooding Rains': 1, 'Raine syndrome-associated': 1, 'osteosclerotic process': 3, 'osteolytic osteosclerotic': 1, 'osteolytic or osteosclerotic': 1, 'osteolytic and osteosclerotic bone lesions': 5, 'RG': 2, 'osteosclerotic bony relapse': 1, 'SiAR': 1, 'IRPN': 1, 'rain flash floods': 1, 'Osteosclerotic Disease': 2, 'osteosclerotic\\osteolytic': 1, 'osteoblastic or osteosclerotic lesions': 1, 'Osteolytic and osteosclerotic lesions': 1, 'Long-bone osteosclerotic lesions': 1, 'Heavy rain flood': 1, 'Torrential Rains': 1, 'rain flash': 1, 'NAS Acid Rain': 1, 'rain panic': 1, 'OSTEOSCLEROTIC LESIONS': 1, 'TRF': 6, 'Rain Disease': 1, 'oc': 6, 'neonatal osteosclerotic dysplasia': 1, 'rain-flood disaster': 1, 'rain-flood': 1, 'osteosclerotic and osteonecrotic lesions': 1, 'REN': 1, 'RN': 1, 'osteosclerotic changes of': 1, 'osteosclerotic-osteolytic lesion': 1, 'Osteosclerotic disorders': 1, 'fibro-osteosclerotic changes': 2, 'osteosclerotic pattern of the pelvis': 1, 'Osteosclerotic bone dysplasia': 2, 'Nonlethal Raine Syndrome': 1, 'SARS': 2, 'SD': 1, 'CDs': 1, 'Osteosclerotic Myeloma': 3, 'b rain granulomas': 1, 'osteosclerotic metastatic lesion in humerus': 1, 'osteosclerotic condition': 5, 'systemic osteosclerotic lesions': 1, 'rain-on-': 1, 'Osteosclerotic tumors': 1, 'rain etastasis': 1, 'osteosclerotic tibia and': 1, 'osteosclerotic nodules': 1, 'Osteosclerotic skull': 1, 'osteosclerotic bone change': 1, 'rain wear': 1, 'congenital sclerosing osteomalacia': 2, 'osteosclerotic skeleton': 1, 'NAR': 1, 'rain anomalies': 1, 'Acid-rain': 2, 'Speckled Rain': 1, 'Variegated Rain Frog': 1, 'Osteosclerotic Anaemia': 1, 'Osteosclerotic change': 2, 'RaINS': 1, 'CRF': 1, 'rain rot': 2, "Raine's syndrome": 6, 'osteosclerotic bone myeloma': 1, 'yellow rains': 1, 'Osteosclerotic bone lesions': 8, 'Unchlorinated raining water': 1, 'rain flood disaster': 1, 'osteolytic or osteosclerotic lesion': 1, 'Heavy Rain and Drought-Flood Disasters': 1, 'rain loss': 1, 'osteosclerotic lesions of the mandible': 1, 'Osteosclerotic and Osteolytic Vertebral Metastatic Lesions': 1, 'AP': 1, 'Osteolytic Osteosclerotic': 1, 'Osteosclerotic bowed': 1, 'osteosclerotic lesions of': 3, 'osteosclerotic lesion in': 1, 'rain fever': 1, 'osteosclerotic or lytic lesion': 1, 'osteosclerotic lesions of the skull': 2, 'Osteosclerotic and osteolytic manifestations': 1, 'osteolytic and osteosclerotic skull lesions': 1, 'osteosclerotic lesion of the skull': 1, 'osteosclerotic skeletal dysplasias': 3, 'osteolytic and osteosclerotic destruction': 1, 'OM': 2, 'Raine-syndrome': 1, 'flooding rains': 1, 'Osteosclerotic and osteolytic changes': 1, 'RNS abnormalities': 1, 'osteolytic and osteosclerotic lesion': 3, 'osteosclerotic and osteolytic lesion': 1, 'osteosclerotic alterations': 1, 'Raine Syndromes': 1, 'Raine syndromes': 1, 'osteosclerotic/hyperostotic disorders': 1, 'osteosclerotic metastatic lesion': 1, 'osteosclerotic trabeculae': 1, 'osteosclerotic problems': 1, 'rain storms': 1, 'autosomal-recessive neonatal osteosclerotic bone dysplasia': 1, 'TRMM 3B43V7': 1, 'rain stains': 1, 'rain abnormalities': 1, 'fibro-osteosclerotic manifestations': 1, 'Raines syndrome': 3, 'rain infarction': 1, 'LR': 3, 'SR': 3, 'RAINS': 1, 'Osteosclerotic bone changes': 1, 'ARF': 3, 'osteosclerotic, skeletal dysplasias': 1, 'osteolytic and/or osteosclerotic bone lesion2': 1, 'Rain Forest': 1, 'Atlantic Rain': 1, 'osteosclerotic femora': 1, 'autosomal recessive osteosclerotic condition': 1, 'autosomal recessive osteosclerotic bone disorder': 1, 'osteosclerotic metaphyses': 1, 'rain flood disasters': 1, 'long-bone osteosclerotic lesion': 1, 'Black Rain': 1, 'Rain Streaks': 1, 'rain streaks': 3, 'osteosclerotic metaphysial dysplasia': 2, 'Osteosclerotic Lesions': 3, 'fibro-osteosclerotic marrow': 1, 'Osteolytic and Osteosclerotic Lesions': 1, 'Fallout Rain': 1, 'RFF': 1, 'rain dependency': 1, 'N-SiAR': 1, 'BRA': 1, 'RA': 1, 'OSSDs': 1, 'REHS': 3, 'rain fall': 1, '-osteosclerotic condition': 1, 'pachy-osteosclerotic': 1, 'osteosclerotic processes': 1, 'osteosclerotic solitary plasmacytoma of bone': 1, 'Focal and Osteosclerotic Bone Diseases': 1, 'rain storm': 3, 'raining': 1, 'Manjari Rain': 1, 'osteosclerotic bone remodeling': 2, 'rain forest toxoplasmosis': 1, 'OC': 1, 'golden rain': 1, 'golden rain tree cankers': 1, 'Golden rain': 1, 'golden rain tree canker diseases': 1, 'golden rain trees': 1, 'Rain flush': 1, 'Osteosclerotic Bone Dysplasia': 1, 'Osteolytic and Osteosclerotic Bone Metastasis': 1, 'osteosclerotic lesion of vertebral body': 1, 'Raine symptoms': 1, 'TPF': 1, 'sclerosing osteomalacia': 1, 'Osteosclerotic syndrome': 1, 'RL': 1, 'DoF': 1, 'craniofacial RS': 1, 'craniofacial RS abnormalities': 1, 'RS brain defects': 1, 'RS defects': 1, 'congenital osteosclerotic dysplasia': 1, 'osteomalacia, sclerosing, with cerebral calcification': 1, 'JDDN': 1, 'osteosclerotic disease of the': 1, 'RAINE SYNDROME': 1, "Raine's": 1, 'RAINE': 2, 'acid rains': 1, 'Multiple Osteosclerotic Lesions': 1, 'osteosclerotic metastatic bone disease': 1, 'osteosclerotic dysplasia of bones': 3, 'RI': 1, 'Myelo-osteosclerotic disease': 1, 'RNS-': 1, 'Hunchbacked rain priest': 1, 'Osteosclerotic effects': 1, 'osteolytic or osteosclerotic changes': 1, 'rain hut': 1, 'osteosclerotic type lesions': 1, 'Rain and flood disaster': 1, 'congenital osteosclerotic skeletal dysplasia': 1, 'osteosclerotic, osteolytic lesion': 1, 'Painless osteosclerotic lesions': 1, 'Osteosclerotic pelvic bone': 1, 'autosomal recessive osteosclerotic bone disease': 1, 'Kanchanaburi Rain-': 1, 'Rain streaks': 1, 'osteosclerotic metabolic bone disorder': 1, 'osteosclerotic bone tumors': 1, 'Rain Tree': 1, 'hypocalcemic osteosclerotic': 1, 'fibro-osteosclerotic process': 1, 'Osteosclerotic myelopathy': 1, 'Rain Fall': 1, 'osteosclerotic bone destruction': 1, 'osteolytic/osteosclerotic bone lesions': 1, 'osteolytic-osteosclerotic bone changes': 1, 'osteosclerotic and osteolytic lesion in the pelvis': 1, 'osteosclerotic BM': 1, 'osteosclerotic or hyperostotic bone lesions': 1, 'osteosclerotic leasions': 1, 'osteosclerotic myeloleukosis': 1, 'TLRF': 1, 'RF-FACs': 1, 'Osteosclerotic and osteolytic lesions': 1, 'Rain-Makers': 1, 'osteosclerotic dysplasia of the skull': 1, 'BSR': 1, 'beauty rain frog': 1, 'Osteosclerotic bone lesion': 1, 'osteosclerotic bone disease Dysplasia': 1, 'osteosclerotic bone diseases': 1, 'osteosclerotic lesions of the': 1, 'osteosclerotic form': 1, 'Osteosclerotic Bone Lesions': 1, 'osteosclerotic vertebrae': 1, 'osteosclerotic vertebra': 1, 'MuR': 1, 'Titan Rain': 1}
|
osteosclerotic
|
Disease
|
MESH:C535284
|
{'humeroradial synostosis': 33, 'class II humeroradial synostosis': 1, 'Humeroradial synostosis': 11, 'humero-radial epicondylitis': 1, 'unilateral humero-radial synostosis': 1, 'Congenital humeroradial synostosis': 5, 'Humeroradial Synostosis': 2, 'HRS': 4, 'humeroradial or longitudinal synostosis': 1, 'Fracture in Humeroradial Synostosis': 1, 'type-I HRS': 1, 'congenital humero-radial synostosis': 2, 'RDP': 2, 'humero-ulnar synostosis': 2, 'Post-traumatic humero-ulnar synostosis': 1, 'post-traumatic humero-ulnar synostosis': 1, 'Humero-radial synostosis': 5, 'humeroradial-ulnar synostosis': 1, 'humeroradial joint disorder': 1, 'humeroradial symptoms': 1, 'humeroulnar and humeroradial incongruence': 1, 'humero-radial synostosis': 13, 'radial humero-ulnar ligament': 1, 'Humero-radial instability': 1, 'humeroradial OA': 2, 'humero-radial luxation': 1, 'Congenital humero-radial synostosis': 1, 'bilateral humeroradial synostosis': 3, 'humeroradial and humeroulnar synostosis': 2, 'post-traumatic or humeroradial synostosis': 1, 'humeroradial osteoarthritis': 2, 'humeroradial synostoses': 5, 'Congenital bilateral humero-radial synostosis': 1, 'humeroradial meniscus': 1, 'symmetrical humeroradial synostosis': 1, 'Humeroradial synostoses': 2, 'OA of the humeroradial joint': 1, 'AO- humeroradial (': 1, 'humero-radial osteoarthritis': 3, 'humeroradial impingement': 1, 'humeroradial fusion': 5, 'humeroulnar and/or humeroradial impingement': 1, 'humeroradial joint meniscus': 1, 'uni- or bilateral humeroradial synostosis': 1, 'HRA': 1, 'humeroradial subluxation': 1, 'humeroradial or humeroulnar subluxation': 1, 'kissing fracture" of humeroradial joint': 1, 'disorders of the humeroradial epicondyle': 1, 'humero-radial arthrogryposis': 1, 'humero-radial joint instability': 1, 'humeroradial joint luxation': 1, 'luxation of the humeroradial joint': 1, 'humero-radial synostosis syndrome': 1, 'humeroradial joint': 2, 'humeroradial dislocation': 1, 'humeroradial dislocations': 1, 'cranio- and humeroradial synostoses': 1, 'humero-radial and humero-ulnar instability': 1, 'humero-ulnar and femoro-tibial synostosis': 1, 'humero-ulnar-radial synostosis': 1, 'Ramer-Lin syndrome': 1, 'H-R joint osteoarthritis': 1, 'humero-radial arthrodesis': 1, 'humeroradial chondrolysis': 1, 'Humeroradial joint cartilaginous lesion': 1, 'Humeroradial joint impingement': 1, 'left-sided humero-radial synostosis': 1, 'Congenital symmetrical humeroradial synostosis': 1, 'humeroradial, humero-ulnar, intercarpal and intermetacarpal synostosis': 1, 'humeroradial joint incongruity': 1, 'humeroradial, humeroulnar and/or proximal radioulnar osteoarthritis': 1, 'humeroradial joint OA': 1, 'humeroradial and humero-ulnar subluxation': 1, 'Humero-radial epicondyl pain': 1, 'osteoarthritis of humeroradial joint': 1, 'HRD': 1, 'bilateral humero-radial synostosis': 1, 'humeroradial joint asymmetry': 1, 'humero-radial articular pathology': 1, 'Humeroradial joint degeneration': 1, 'humero-ulnar nor humeroradial cartilage defects': 1, 'internal derangement of the humero-radial joint': 1, 'humeroradial joint (HRJ) chondral lesions': 1, 'HRJ chondral lesions': 1, 'humeroradial joint chondral lesions': 1, 'humeroradial arthritis': 1, 'Humero-radial and humero-ulnar osteophytosis': 1, 'humero-radial ankylosis': 1}
|
humeroradial synostosis
|
Disease
|
MESH:C535285
|
{'RCUH': 1, 'Ramon syndrome': 38, "Ramon's syndrome": 6, 'Ramon Syndrome': 3, 'cherubism with gingival fibromatosis': 1, 'Ramon y Cajal': 1, 'Ramon': 1, 'MR': 2, 'RAMON': 4, 'HRC': 2, 'URL-C5': 1, 'and Ramon syndromes': 1, 'HURyC': 1, 'Ramon and Rutherford syndrome': 1, 'SANTIAGO RAMON': 1, 'HOSPITAL RAMON RUIZ ARNAU': 1, 'RSF': 1, 'Murray-Ramon syndrome': 1, 'Rutherfold and Ramon syndrome': 1, 'RC': 1, 'HRYC': 1, 'Laband, Rutherford, Ramon, or Cross syndrome': 1, 'Rutherford, and Ramon syndromes': 1, 'RF': 1, 'Gorlin and Ramon syndrome': 1, 'MEMORY OF GASTON RAMON': 1, 'GASTON RAMON': 1, 'giant cell lesions of Ramon syndrome': 1, 'Ramon syndrome 6': 1, 'Anavi, Gohlich-Ratmann and Ramon syndromes': 1, 'MONSIEUR GASTON RAMON': 1, "Ramon's Syndrome": 1}
|
Ramon syndrome
|
Disease
|
MESH:C535286
|
{'Catarina IV Ramos': 1, 'Ramos-Louzada': 1, 'RL': 1, 'ramo cerebelar': 1, 'ramo cerebelar posterior': 1, 'Ramos-Arroyo syndrome': 3, 'ramo direito': 3, 'BRD': 7, 'BRE': 3, 'BRE doloroso': 1, 'BRE doloroso sao pouco claros': 1, '-Ramos': 2, 'OR': 1, 'RAMOS': 6, 'Murillo-Ramos': 1, 'os ramos nervosos nociceptivos': 1, 'Garay-Arroyo': 1, 'WWAV': 1, 'Ramos': 6, 'Cuevas-Ramos': 1, 'AS': 1, 'Ramos-Arroyo Syndrome': 1, 'Ramos S-orange': 1, 'Ramos-RA1': 1, 'Ramo Direito': 1, 'Ramos 19': 1, 'RE': 1, 'ramo-conidiis et conidiis intercalaribus brevioribus': 1, 'Angiografia de ramo da veia mesenterica superior': 1, 'WWA infection': 1, 'BR': 1, 'varios ramos musculares': 1, 'pro ramo nervi': 1, 'ramo nervi': 1, 'canalis pro ramo nervi vidiani': 1, 'ramos': 1, 'Ramo Grande': 1, 'Palma de ramos': 1, 'BCRD': 1, 'Ramos-Martinez syndrome': 1, 'ramo nervi vidiani': 1, 'Ramos-Pichardo': 1, 'Netzahualcoyotl Arroyo-Curras': 1, 'iatrogenica da arteria subclavia e seus ramos': 1, 'RIPNS': 1, 'pro ramo nervi vidiani': 1}
|
BRD
|
Disease
|
MESH:C535287
|
{'myoclonus epilepsy myopathy sensory ataxia': 8, 'Ramsey Hunt syndrome': 27, 'Ramsey-Hunt syndrome': 35, 'HH': 96, "Hunt's dyssynergia": 1, 'Hunting': 41, 'Ramsey Hunt Syndrome': 7, 'hunting': 8, 'Big-Game Hunting': 1, 'Phage Hunting': 1, 'Hunt bumble bee': 1, 'HLP': 1, 'Hunt': 63, 'Ataxia-myoclonus syndrome': 2, 'ataxia-myoclonus syndrome': 5, 'HHG': 5, "Hunting's disease": 6, 'HD': 7, "Hunt's syndrome": 32, 'Ramsey-Hunt-syndrome': 2, 'hunt': 12, 'Hunt and Kosnik': 17, 'MEMSA': 12, 'H-H': 19, 'H&H IV-V': 1, 'MEMSA)': 1, 'Myoclonus-Ataxia Syndrome': 5, 'ataxia with myoclonus': 3, 'Myoclonus ataxia': 2, "Rumsay-Hunt's syndrome": 1, 'myoclonus epilepsy-ataxia syndrome': 6, 'Hunting disease': 3, 'Hunt-Hess': 29, 'SH': 19, 'cavernous sinus Tolossa Hunt syndrome': 1, 'Hunt and hess': 1, 'Tolose-Hunt-like syndrome': 1, 'Tolose-Hunt syndrome': 1, 'Tolsa-Hunt syndrome': 1, 'Bessen-Hunt': 1, '-Hunt': 8, 'autosomal dominant myoclonus ataxia': 1, 'myoclonus ataxia': 22, "Hunting-ton's disease": 6, 'myoclonus-ataxia syndrome': 8, 'Hunt-': 15, 'Hunt and Hess': 3, 'ataxia and myoclonus': 1, 'hunting injuries': 9, "Hunt's facial palsy": 1, 'Hunt&Hess': 1, 'Hunt syndrome': 30, 'myoclonus movements': 3, 'Hunting billbug': 1, 'Defect of DHOA': 1, 'Deer Hunting': 1, 'DHOA': 2, 'HHS': 2, 'Hunt-hess': 5, 'Hunt &': 4, 'myoclonus and ataxia': 10, 'myoclonus or ataxia': 4, 'Ataxia Myoclonus': 3, 'myoclonus-like movements': 7, 'VH.VIMP': 1, 'hunting-induced toxicity': 1, 'Prey Hunting': 1, 'Myoclonus epilepsy myopathy sensory ataxia': 3, 'ataxia Myoclonus': 1, 'ataxia-myoclonus': 2, 'Stag Hunt': 8, 'myoclonus/ataxia': 1, 'Ramsy-Hunt syndrome': 1, 'CHI': 1, 'Neuron Hunt': 1, 'H&H grade 5': 1, 'Ataxia Myoclonus Chorea': 1, 'HHS I-III': 1, 'Hunt & Kosnik': 6, 'Hunt and': 4, 'myoclonus-like movement': 5, 'myoclonus-like involuntary movements': 5, 'myoclonus-like involuntary movement': 6, 'Myoclonus-like involuntary movement': 1, 'HH Stroke': 1, 'H&H': 2, "Hunting's Disease": 2, 'MAS': 1, 'Myoclonus-Ataxia Syndromes': 1, 'myoclonus-ataxia syndromes': 1, 'Abnormal myoclonus movements': 1, 'EH': 1, 'HUNTING': 1, "Hunting- ton's chorea": 1, 'Leigh Hunt': 1, 'OHO': 1, 'paraneoplasticopsoclonus myoclonus ataxia': 1, 'POMA': 1, 'hunting misconduct': 1, 'abnormal movement as myoclonus': 1, 'hunting moratorium': 1, 'H&K.': 1, 'HPA': 2, 'hunted hares': 1, 'Hunt-&-Hess': 1, 'Myoclonus and ataxia': 2, 'HE': 2, 'HC': 1, 'WHL': 1, 'Ward Hunt Lake': 1, 'FH': 1, 'myoclonus-ataxia': 6, 'Epilepsy-myoclonus-ataxia Syndrome': 1, 'Bat Hunting': 1, 'Hunt-Hess III': 1, "Ramsey Hunt's palsy": 1, 'walrus hunt': 1, 'HS': 3, '-hunts': 1, 'myoclonus) movements': 1, 'Ramsey-Hunt-Syndrome': 1, 'TH': 2, 'myoclonus/ataxia syndrome': 1, 'Myoclonus-like movements': 1, "Hunt's myoclonic dyssynergy": 1, 'myoclonus, epilepsy, myopathy, sensory ataxia': 1, "Hunt and Kosnik's": 1, 'myoclonus epilepsy and ataxia': 3, 'Stoep Hunt': 1, 'Hunt and Kosnick': 1, 'THT': 3, 'hunt seals': 1, 'witch hunt': 1, 'Ramsay-Hunt syndrome type II': 1, 'Trophy Hunting': 3, 'myoclonus-like movement disorder': 3, 'stone hunting blind': 1, 'Ramsay Hunt syndrome type 2': 2, 'RHS type 2': 1, 'Ramsay Hunt syndrome Type 2': 1, 'Ramsay Hunt syndrome type 3': 1, 'Ramsay Hunt syndrome type 1, type 2, and type 3': 1, 'Movements Mimicking Myoclonus': 1, 'HEAD-Hunt': 1, 'Jeremy Hunt': 1, 'Ramsay Hunt syndrome (RHS) type 2': 1, 'myoclonus-ataxia encephalitis': 1, 'hunting injury': 1, 'myoclonus Leg movements': 1, 'HH 1': 2, 'HH 4-5': 1, 'Hunted': 1, 'Tolusa-Hunt syndrome': 3, 'THS': 1, 'Hunt and Hess sore': 1, 'Nauclea gambir Hunt': 1, 'Myoclonus Epilepsy Myopathy Sensory Ataxia': 5, 'AH': 1, 'Compulsive hunt': 1, 'Hunt-Kosnik': 1, 'SLH': 1, 'Ataxia Hypertonia Myoclonus Encephalopathy': 1, 'HMUs': 1, 'HMU': 1, 'Palatal myoclonus and ataxia': 1, 'Hunting injuries': 3, 'hunt-and-peck': 2, 'Hunt-and-peck': 2, 'Myoclonus-like involuntary movements': 1, 'Myoclonus-ataxia spectrum syndrome': 1, 'brainstem myoclonus-ataxia clinical syndrome': 1, 'Brainstem myoclonus-ataxia syndrome': 1, 'H-C': 1, 'Myoclonus-ataxia': 2, 'Deer hunt': 1, 'HDs': 1, 'PHS': 3, 'HUS': 1, 'hunted deer': 2, 'amsay Hunt Syndrome': 1, 'hunts': 2, 'National Hunt (jump)': 1, 'Ataxia Myoclonus': 1, 'NHS': 1, 'Ramsey-Hunt syndromes': 1, 'myoclonus-ataxia-parkinsonism': 1, 'myoclonus-ataxia-': 1, 'Snipe Hunting': 1, 'Myoclonus Epilepsy and Ataxia': 1, 'Ramsay Hunt syndrome type II': 4, 'Trophy Hunting 7': 1, 'Lion Hunting': 1, 'HH II': 2, 'HH I': 1, 'witch hunts': 1, 'H&H III-V': 1, 'H&H I and II': 1, 'GAMH': 1, 'HA': 2, 'Myoclonus and Ataxia Syndrome': 1, 'myoclonus and ataxia syndrome': 2, 'Anorexia Myoclonus;Nystagmus;Ataxia;Tetraparesis': 1, 'hunted': 2, "Hunt-ington's Disease": 1, 'DHR': 1, 'Myoclonus Ataxia': 3, 'myoclonus ataxia syndromes': 1, 'ataxia myoclonus': 1, 'Ataxia myoclonus': 1, 'myoclonus and involuntary movements': 1, 'Pig-hunting': 1, 'Toulouse-Hunt syndrome': 1, 'Classical Hunt syndrome': 1, '- myoclonus-ataxia syndrome': 1, 'Hunt & Hess': 2, 'familial myoclonus-ataxia epilepsy': 1, 'Ataxia-Myoclonus Syndrome': 1, 'Hunt syndromes': 1, 'HH 1-2': 1, 'ataxia-myoclonus-syndrome': 1, 'Ataxia Myoclonus Syndrome': 1, 'AMS': 1, 'H&K': 1, 'myoclonus epilepsy myopathy with sensory ataxia': 1, 'Myoclonus-Ataxia': 1, 'Myoclonus Epilepsy-Ataxia Syndrome': 1, 'HUNTING ACCIDENT': 1, 'NH': 1, 'H&H I': 1, 'Ramsay Hunt syndrome 2': 1, 'bone hunting injuries': 1, 'Myoclonus-ataxia syndrome': 1, 'myoclonus, epilepsy, myopathy, sensory ataxia [MEMSA] syndromes': 1, 'myoclonus with ataxia': 2, 'ramsay hunt syndrome type I.': 1, 'Ramsey Hunt': 1, 'Myoclonus and involuntary movement': 1, 'Hunt-Hess 5': 1, 'Heterobasis Hunt': 1, 'Ground Hunting': 1, 'H-H I-II': 1, "Hunt's": 2, 'clonus-myoclonus-ataxia': 1, 'H&H.': 1, 'Beartooth-Absaroka hunt': 1, "Hunt's palsy": 1, 'Hunting-related injuries': 1, 'Myoclonus epilepsy, myopathy, sensory ataxia': 1, "Tolos-Hunt's": 1, "Tolos-Hunt's disease": 1, "Tolos-Hunt's syndrome": 1, 'HandH': 1, 'Liz Hunt': 1, "R. Hunt's disease": 1, 'myoclonus-like abnormal movements': 1, 'WB-HS': 1, 'voluntary movement myoclonus': 1, 'HK': 2, 'Ataxia and myoclonus S': 1, 'Runsay-Hunt syndrome': 1, 'RHS type II': 1, 'H-V': 1, 'Ataxia-opsoclono--myoclonus': 1, 'H-K': 1, 'hunted wildlife': 1, 'myoclonus/involuntary movements': 1, 'bonobo hunts': 1, 'Ramsay-Hunt syndrome (type 2)': 1, 'Ramsay-Hunt syndrome type 2': 1, 'myoclonus-epilepsy and ataxia syndrome': 1, 'myoclonus ataxia syndrome': 2, 'Tolsa-Hunt ophthalmoplegia': 1, 'Hunt-Lawrence': 1, "Hunt-ington's disease": 1, 'ABEH': 2, 'Ramsay Hunt syndrome, type I.': 1, 'Suruwaha hunt': 1, 'zawada hunts': 1, 'AFHM': 1, 'hunted venison': 1, 'HH 4': 1, 'HH 4 and 5': 1, 'HH 5': 1, 'HH 1 and 2': 1, 'HHPA': 1, 'ataxia or myoclonus': 1, 'Myoclonus Ataxia': 1, 'Ramsey-Hunt Syndrome': 1, 'DISEASE IN HUNTED WILD BOAR': 1, 'Familial myoclonus and ataxia': 1, 'Ataxia Myoclonus Neocortex': 1, 'Ataxia Parkinsonism Myoclonus': 1, 'asteroid hunt': 1, 'hunted animals': 1, 'HZs': 1, 'Rumsey Hunt disease': 1, 'Myoclonus epilepsy and ataxia': 1, 'Myoclonus movements': 1, 'MEMSA) syndrome': 1, 'myoclonus, epilepsy, myopathy, sensory ataxia (': 2, 'autosomal recessive myoclonus epilepsy-ataxia syndrome': 1, 'ataxia with cortical myoclonus': 1, 'Ramsy-Hunt syndorme': 1, 'Ramsey hunt syndrome': 1, 'Price-Hunt': 1, 'Hunt-Reich': 1, 'Ataxia Myoclonus Hypokinetic Hyperkinetic': 1, 'Myoclonus-like movement': 1, 'Marine Hunting': 1, 'HADCHA': 1, 'InfantileProgressive myoclonic epilepsy-3Opsoclonus-myoclonus ataxia-like syndrome': 1, 'Sustains Hunting': 1, 'Myoclonus with Ataxia': 1, 'GH': 1, 'GHHT': 1, 'Myoclonus Ataxia Cognitive decline': 1, 'witch-hunt': 1, 'Witch-Hunt': 1, 'MEMSA) syndromes': 1, 'TWHN': 1, 'myoclonus like involuntary movement': 1, 'Ariz HPA': 1, 'myoclonus movement': 1, 'MFH': 1, 'Hunted Piglets': 1, 'encephalitisCerebellitisRhombencephalitisOpsoclonus-myoclonus-ataxia syndromeStiff-person syndrome': 1, 'ataxic myoclonus': 1, 'myoclonus-like movement of the': 1, 'myoclonus ataxia syndromes Infections': 1, 'DH': 1}
|
HH
|
Disease
|
MESH:C535288
|
{'RAPADILINO': 82, 'RAPADILINO syndrome': 95, 'AR': 1, 'radial and patellar hypoplasia': 1, 'congenital patellar aplasia or hypoplasia': 2, 'patellar aplasia or hypoplasia': 18, 'patellar hypoplasia': 40, 'patellar hypoplasia or agenesis': 3, 'patellar tendon hypoplasia': 1, 'medial patellar facet hypoplasia': 1, 'patellar apoplasia/hypoplasia': 3, 'patellar hypoplasia or aplasia': 3, 'RAPADILINO syndromes': 7, 'RAPA': 3, 'PAtellar hypoplasia': 2, 'patellar hypoplasia/aplasia': 2, 'Patellar aplasia': 3, 'Bilateral patellar aplasia': 1, 'congenital patellar aplasia': 1, 'Congenital patellar aplasia or hypoplasia': 2, 'patellar aplasia': 15, 'patellar hypoplasia/agenesis': 8, 'Rapadilino syndrome': 12, 'patellar agenesis/hypoplasia': 1, 'patellar absence/hypoplasia': 1, 'patellar aplasia/hypoplasia': 14, 'RAPADILINO Syndrome': 7, 'Patellar hypoplasia/agenesis': 1, 'Genital anomalies Patellar hypoplasia': 1, 'humeral, radial, patellar, and tibial fractures': 1, 'humeral, radial, patellar and tibial fractures': 1, 'humeral, radial, patellar, and tibial fracture': 1, 'Patellar Aplasia syndrome': 1, 'patellar tendon aplasia': 3, 'Radial and patellar aplasia or hypoplasia': 1, 'hypoplasia of the patellar groove of the femur': 1, 'Patellar aplasia or hypoplasia': 4, 'patellar a/hypoplasia': 2, 'hypoplasia of the patellar groove': 1, 'patellar hypoplasia/dysplasia': 1, 'Patellar hypoplasia': 5, 'ischio-patellar hypoplasia': 1, 'patellar hypoplasia or absence': 1, 'radial and patellar aplasia': 1, 'Ischio-pubic-patellar hypoplasia': 1, 'and patellar aplasia': 1, 'PAtellar hypoplasia/aplasia': 1, 'dysplasia of the femoro-patellar joint': 1, 'Congenital patellar aplasia': 1, 'Congenital patellar aplasia and hypoplasia': 1, 'patellar aplasiaor hypoplasia': 1, 'radial, ulnar, femoral, and patellar fractures': 1, 'radial, femoral, patellar, and ulnar fractures': 1, 'Rapadilino syndromes': 1, 'patellar hypo/aplasia': 2, 'ischiopubic-patellar hypoplasia': 1, 'Bilateral patellar hypoplasia': 1, 'patellar aplasia or dysplasia syndromes': 1, 'patellar applasia/hypoplasia': 1, 'patellar a-/hypoplasia': 1, 'familial patellar a-/hypoplasia': 1, 'patellar defects (hypoplasia/agenesis) anomalies': 1, 'hypoplasia of the medial patellar facet': 1, 'Patellar Aplasia/hypoplasia': 1, 'PTLAH': 1, 'Patellar Aplasia Hypoplasia': 1, 'RAPADILINO and': 1, 'patellar hypoplasia/hypoplasia': 1, 'Rapadilino Syndrome': 2, 'RS': 1, 'patellar absence or hypoplasia': 1, 'patellar or radial aplasia/hypoplasia': 1, 'radial and patellar aplasia/hypoplasia': 1, 'radial and patellar aplasia or hypoplasia': 1, 'PAtellar aplasia': 1, 'Aplasia of the patellar apparatus': 1, 'RPA': 1, 'Patellar or femoral hypoplasia': 1, 'Rothmund-Thompson and Rapadilino syndrome': 1, 'patellar aplasia/ hypoplasia': 1}
|
RAPADILINO syndrome
|
Disease
|
MESH:C535289
|
{'Rapp-Hodgkin syndrome': 111, 'Rapp-Hodgkin Syndrome': 15, 'Rapp-Hodgkins type': 1, 'Rapp-Hodgkin syndromes': 4, 'Rapp-Hodgkin': 16, 'Rapp Hodgkin syndrome': 6, 'Rapp Hodgkin syndromes': 1, 'RHS': 44, 'Hay-Wells and Rapp-Hodgkin syndromes': 1, 'Rapp Hodgkin SyndromeFabry': 1, 'Rapp-Hodgkin ectodermal dysplasia syndrome': 6, 'Rapp-Hodgkin ED': 3, 'Rapp-Hodgkin ectodermal dysplasia': 11, 'Rapp-Hodgkin HED': 1, 'Rapp': 4, 'Rapp-Hodgkin/AEC': 1, 'Rapp-Hodgkin like syndrome': 1, 'Rapp Hodgkin disease': 1, 'Rapp-- Hodgkin Syndrome': 1, 'Rapp Hodgkin Syndrome': 3, 'RH': 1, 'RH syndrome': 1, 'RHS (': 1, 'Rapp-Hodgkin (RH) syndrome': 1, 'RHS (Rapp-Hodgkin) syndrome': 1, 'rapp-hodgkin': 1, 'Rapp-Hodgkin facies': 1, 'Rapp Hodgkin': 1, 'Rapp-Hodgkin-Syndrome': 1, 'Rapp-Hodgkin/Hay-Wells-like syndromes': 1, 'RAPPS': 2, 'RHS syndrome': 1, "Rapp-Hodgkin's Syndrome": 1, 'RHS syndromes': 1, 'rApp]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[ddC': 3, 'Rapp-Hodgkins syndromes': 1, 'Rapp-Hodkging syndrome': 1, "Rapp-Hodgkin's syndrome": 1, "Rapp-Hodgkin's ectodermal dysplasia": 2, 'Rapp-Hodgkin syndrome': 1, "Rapp Hodgkin's syndrome": 1, 'Rapp-Hodgkin hypohidrotic ectodermal dysplasia syndrome': 1, 'Rapp-Hodgkin and AEC syndromes': 1, 'Rapp-Hodgkin and Hay-Wells ectodermal dysplasia syndromes': 1, 'ectodermal dysplasia (Rapp-Hodgkin) syndrome': 1, 'Rapp-Hodgkin and Bowen-Armstrong': 1, 'Rapp-Hodgkin and Hay-Wells EDs': 1, 'Rapp-Hodgkin Ectodermal Dysplasia': 1, 'syndrome de Rapp-Hodgkin': 1}
|
Rapp-Hodgkin syndrome
|
Disease
|
MESH:C535290
|
{'SMD': 42, 'TMD': 106, 'IT': 1, 'Distance': 1325, 'ED': 157, 'DC': 23, 'MHD': 19, 'AVD': 17, 'HD': 662, 'DM': 42, 'MD': 25, 'MSD': 12, 'Distancing': 531, 'IPD': 92, 'ICD': 40, 'distancing': 199, 'distance': 470, 'PD': 52, 'MRMD': 16, 'Chord Distance': 2, 'VTC': 1, 'AD': 29, 'Carnot-Caratheodory Distances': 1, 'DTC': 6, 'LD': 11, 'FID': 43, 'Mahalanobis Distance': 45, 'Emotional distance': 1, 'CD-M': 1, 'IED': 7, 'DISTANCE': 169, 'OD': 2, 'SVD': 2, 'Sternovetebral Distance': 1, 'MNND': 18, 'Hamming Distance': 13, 'EMD': 41, 'AHD': 76, 'OF DISTANCES': 1, 'CED': 1, 'DE': 33, 'Riemannian Distance': 4, 'atlantooccipital distance impairment': 2, 'distance blur': 6, 'AFD': 3, 'ASD': 20, 'BD': 21, 'auditory distance': 2, 'DDB': 1, 'OLD': 2, 'Jousselme Distance': 1, 'NNDs': 5, 'Acromiohumeral Distance': 18, 'CDPA': 1, 'GD': 17, 'DH': 5, 'GCD': 4, 'MLD': 2, 'DI': 4, '-Distance': 24, 'MPD': 33, 'Distance Covered': 12, 'CS': 2, 'DTA': 7, 'TDD': 4, 'MEAN DISTANCES': 1, 'SD': 17, 'CD': 33, 'LCD': 5, 'CMD': 8, 'MO': 1, 'Distance education': 3, 'WCD': 1, 'dSCC': 1, 'distance disorder': 1, 'Manhattan Distance': 14, 'QUARTET DISTANCE': 1, 'Distance violations': 1, 'DF': 5, 'PED': 3, 'Distance Hijacking': 1, 'DB': 1, 'Distance Fraud': 1, 'MRMD 252D': 1, 'MRMD 185D': 1, 'MAD': 13, '-distance': 1, 'BOD': 1, 'DMs': 1, 'ADM': 2, 'SUCCESSFUL INTEROCULAR': 1, 'Distances': 22, 'IA': 1, 'Distancing/': 1, 'SDD': 15, 'Obstacle Distance': 2, 'Comfort with interpersonal distance': 1, 'CID': 5, 'DISTANCE II': 1, 'PCD': 6, 'SSMD': 1, 'DR': 10, 'DIoU': 1, 'WITH DISTANCE': 1, 'Binocular Distance': 1, 'Distanced': 5, 'IIDs': 2, 'DQD': 14, 'FDCs': 1, 'MNTD': 24, 'HAM': 1, 'MDA': 21, 'distance impairment': 4, 'Obstacle Distance Obstacle': 1, 'DIST': 6, 'GDM': 1, 'SDS': 1, 'NND': 29, 'MDM': 9, 'MHD ASD DICE': 1, 'MHD ASD': 1, 'ILD': 11, 'IND': 37, 'PPD': 2, 'Tonal Distances': 1, 'JD': 2, 'ID': 13, 'MED': 15, 'SpD': 3, 'SpD.': 1, 'MHDE': 1, 'and Distance': 4, 'AC': 1, 'DISTANCES': 8, 'DDR': 6, 'Interorbital Distance': 1, 'Frontothalamic Distance': 2, 'FTD': 4, 'Kullback-Leibler Distance': 3, 'distance and': 2, 'WMH*distance': 1, 'CSD': 2, 'IRD': 14, '-Distancing': 4, 'SR': 1, 'INTERATOMIC DISTANCE': 1, 'MVD': 1, 'IMD': 9, 'Edit Distance': 1, 'aHD': 5, 'cIPD': 1, 'SPD': 11, 'PSD': 6, 'DS': 22, 'IOD': 53, 'MCD': 12, 'DDM': 8, "Mover's Distance": 3, 'IBD': 5, 'IID': 26, 'FND': 2, 'AMD': 16, 'IDD': 4, "Kullback-Leibler's Distance": 1, 'EUCILDEAN DISTANCE': 1, 'GEODESIC DISTANCE': 1, 'SINKHORN DISTANCES': 1, 'DD': 18, 'FPD': 1, 'HD%': 1, 'OMD': 3, 'FODE': 2, 'EDZKP': 1, 'Frechet Inception Distance': 6, 'Inefficiency and Distancing': 1, 'PST': 1, 'JS': 4, 'RightEye IPD': 1, 'WD': 12, 'SSD': 14, 'NMe': 1, 'Distance to': 13, 'PW': 1, 'NN': 1, 'EDM': 2, 'MOMENT ARM IS DISTANCE': 1, 'Autonomy and Distance': 1, 'Endurance Distances II': 1, 'Slippage Distance': 1, 'IDI': 13, 'DV': 2, 'QD': 1, 'VIEWING DISTANCE': 1, 'Coil Distance': 1, 'mHD': 5, 'PERCEIVED DISTANCE': 6, 'SAD': 6, 'DAD': 14, 'DisRD': 1, 'DisFL': 1, 'GRAPHLET CORRELATION DISTANCE': 1, 'Online Distance': 2, 'Confron-tation Distancing': 1, 'EDIT DISTANCE': 4, 'TED': 3, 'IUD': 3, 'RCD': 2, 'ENN': 1, 'ISD': 13, 'AGD': 2, 'BDn': 1, 'RHD': 2, 'MID': 6, 'CAD': 2, 'supraglenoacromial distanc': 1, 'KRD': 1, 'TAD': 1, 'distanced overseers': 1, 'Distanced overseers': 1, 'interocular': 11, 'IODs': 2, 'dS': 1, 'HDs': 1, 'DIS': 5, 'GED': 5, 'distance triathlon': 1, 'Distance-IOU': 1, 'MD-ML': 1, 'AVG.FID': 1, 'Edge Distance': 2, 'DA': 5, 'COS': 3, 'MDRM': 5, 'Emotional Distance': 11, 'FFD': 1, 'Distance to HF': 1, 'DUNGSURV DISTANCE': 1, 'Rearrangement Distance': 2, 'DISADVANTAGES OF DISTANCE': 1, 'LTD': 1, 'MDN': 1, 'ERD': 5, 'IFD': 8, 'of the IFD': 1, 'nasolaryngeal distances': 1, 'Nasolaryngeal Distances': 1, 'GHD': 4, 'Synbody Distance': 2, 'Distance Hor': 1, '-CANTHAL DISTANCE': 1, 'MDC': 9, 'Speed Distance': 2, 'PALM DISTANCE': 1, 'Compliance Distance': 1, 'KS': 1, 'distance discrepancy': 1, 'Retailer Distance': 1, 'Distance Bias': 1, 'distance bias': 1, 'Distance Manipulation': 1, 'BDD': 3, 'EDs': 8, 'Emotional Distancing': 16, 'STMD': 2, 'MySD': 1, 'of Distance': 1, 'DCGs': 7, 'ATDD': 2, 'MNN': 3, 'eEID': 1, 'eCID': 1, 'Distance stereoacuity': 2, 'distance stereoacuity': 2, 'MDD': 4, 'Stellar Distances': 2, 'Internipple Distance': 1, 'JMD': 1, 'DCS': 1, 'TD': 10, 'TTD': 2, '-distance truck drivers': 1, 'Distance Loss': 2, 'Midpupil Distance': 1, 'APD': 7, 'IGD': 2, 'Hyperbolic Distance': 3, 'Acromiohumeral distance': 1, 'acromiohumeral distance': 6, 'abnormal interocular distance': 1, 'MRKLD': 1, 'ACD': 5, 'DFD': 1, 'ACD ASD': 1, 'Manhattan Distances': 1, 'MEAN DISTANCE': 1, 'IKDs': 1, 'DME': 6, 'distance hikers': 1, 'HDD': 4, 'MAHALANOBIS DISTANCE': 4, 'EDD': 1, 'Bhattacharya Distance': 1, 'IDAC': 1, 'TIP DISTANCE': 1, 'PwD': 1, 'MOVE DISTANCE': 1, 'Distance"[Mesh': 1, 'HMDR': 6, 'HMD': 12, 'GSD': 1, 'CCD': 5, 'SOD': 1, 'IWD': 1, 'Distance in': 1, '-DD': 1, 'IAR-DD': 1, 'Apex Distance': 2, 'apex distance': 2, 'Faith-PD': 1, 'SJ syndrome': 1, 'Steven Johnsen syndrome': 1, 'PDI': 6, 'Ironman-distance': 1, 'Ironman-Distance': 1, 'IAD': 3, 'Thyromental Distance': 3, 'Gonial Distance': 1, 'MBD A': 1, 'MBD': 2, 'DED': 1, 'MDR': 1, 'Distance Covariance': 1, 'DP': 4, 'FCD': 4, 'Sprint Distance triathlon': 1, '95HD': 4, 'EOD': 1, 'Distance Meas': 1, 'NED': 2, 'CULTURAL DISTANCE': 1, 'emotional distancing': 2, 'maxHD': 1, 'ASD HD': 1, 'MHBD': 1, 'DLD': 4, 'ATD': 4, 'Meniscocapsular Distances': 1, 'AED': 1, 'HAD': 1, 'STD': 1, 'DISTANCE.ppt': 1, 'DIFFERENT DISTANCES': 2, 'HD.Overall': 1, 'Distance of': 2, 'NUMERIC DISTANCE': 1, 'and distance': 2, 'CONCEPTUALIZATION OF DISTANCE': 1, 'DJ': 1, 'IVD': 4, 'Driving Distance': 6, 'Distance oneself': 1, 'NTD': 1, 'Distance Education': 2, 'KSD': 1, 'Comfort Distance': 2, 'Interocular blur': 2, 'Default Distance': 1, '-DISTANCE': 3, 'COMPARISONS OF DISTANCE': 1, 'PH.Distance': 1, 'DU': 2, 'DTH': 2, 'GPCD': 1, 'Calibrate Distances': 1, 'ODE': 3, 'Sdrint Distance': 1, 'THEIR DISTANCES': 1, 'DC HD': 2, 'Crimp Distance': 1, 'WAD': 3, 'ICAD': 1, 'TLED': 1, 'IoD': 1, 'INTERSECTION DISTANCE': 1, 'Hellinger Distance': 1, 'SKLD HD KD': 1, 'KD': 3, 'Kolmogorov Distance': 1, 'Bhattacharyya Distance': 2, 'Distance of posterior extremity': 1, 'IICD\\IPD': 1, 'Spent Distance': 1, 'HDUS': 1, 'Blended Distance': 1, 'DDL': 1, 'Dice-Distance': 1, 'SLD': 1, 'Intercapillary Distance': 1, 'Dalit Distance': 1, 'distance viewing impairments': 2, 'MMD': 5, 'A Distance': 1, 'a distance': 1, 'Comfortable Interpersonal Distance': 2, 'Rise Distance': 1, 'Mahalanobis Distances': 3, 'RMD': 2, 'Impairment in overall, distance or': 1, 'Impairment in overall, distance, or': 1, 'ADEI': 1, 'StID': 1, 'DICE': 1, 'OJMD': 1, 'Distance bet': 2, 'POWER DISTANCE': 1, 'CDS': 1, 'Shank Distance': 1, 'PWD': 5, 'Commensurability Distances': 1, 'dive distance': 1, 'Dive Distance': 1, 'DSCC': 1, 'Power Distance': 2, 'IHD': 11, 'CHD': 3, 'WKD': 1, 'ExD': 1, 'PSPD': 2, 'ODH': 1, 'AMPD': 1, 'Disappointment with Distance': 1, 'Setbacks Distance': 1, 'Distance stereopsis': 2, 'ND': 4, 'distance debriefing': 1, 'Distance Debriefing': 1, 'SVID': 2, 'EDO': 2, 'NID': 1, 'BSD': 1, 'in distance': 1, 'SIZE DISTANCE': 1, 'Interpupillary Distance': 4, 'DGPA': 1, 'DCC': 1, 'MEMD': 1, 'Distance impairment': 2, 'CD-POP': 1, 'EDS': 1, 'Confrontational Distance': 1, 'Distance SZ5': 1, 'IDPO': 1, 'ITD': 3, 'LevD': 1, 'SMIRNOV DISTANCE': 1, 'IOC': 2, 'TFD': 2, 'IO': 1, 'LFD': 1, 'PLD': 1, 'VALUES DISTANCES': 1, 'VDH': 1, 'FROBENIUS DISTANCES': 1, 'Headway Distance': 3, 'BOOSTED DISTANCE': 1, 'Wishart Distance': 2, 'EmD': 2, 'teardrop distance': 1, 'Teardrop Distance': 1, 'ICDs': 1, 'HAULAGE DISTANCE': 1, 'Venue Distance': 1, 'VDM': 1, 'EVDM': 1, "'s Distance": 1, 'the Scapholunate Distance': 1, 'the scapholunate distance': 1, 'ICD & OCD': 1, 'dcov': 1, 'NNDH': 1, 'Centre Distance': 1, 'MMDM': 1, 'AVGD': 1, 'PFD': 5, 'Distance and At-home Dad': 1, 'PMD': 2, 'BAD': 4, 'rVD': 1, 'PDB': 2, 'online distance': 1, 'TCD': 2, '-Lamina Distance': 1, 'Stopping Distance': 1, 'Distance hop': 1, 'distance hop': 1, 'CUE TO DISTANCE': 1, 'SED': 6, 'SCD': 4, 'MDE': 1, 'SIZE-DISTANCE': 2, 'CV-BD': 1, 'Pubofemoral Distance': 1, 'pubofemoral distance': 1, 'GLD': 1, 'ESTIMATING DISTANCE': 1, 'CPD': 1, 'collegiate distance': 1, 'Collegiate Distance': 2, 'PID': 1, 'DCD': 1, 'RD': 7, 'Scapholunate Distance': 2, 'DCE': 2, 'CLD': 2, 'thyromental distance': 2, 'Thyromental distance': 3, 'CHOICE AND DISTANCE': 1, 'rMD': 1, 'PDD': 1, 'DHD': 1, 'PLHD': 1, 'Generational Distance': 2, 'ADC': 2, 'TSD': 2, 'VD': 6, 'emotional distance': 3, 'CBD': 1, 'Moved Distance': 1, 'Postcoronary Distance': 1, 'PENALIZED DISTANCE': 1, 'FD': 9, 'EIDs': 1, 'Covered Distance': 2, 'DISTANCING': 1, 'Sibling Distance': 1, 'Distance Bug': 1, 'Distance bug': 1, 'Rostrum Nostril Distance': 1, 'Interocular Distance': 1, 'Internarinal Distance': 1, 'comfortable interpersonal distance': 1, 'Vitanyi Distance': 1, 'Causal Link Distance': 1, 'GGED': 1, 'Atomic Distance': 1, 'DT': 5, 'Complementarity Hamming Distance': 1, 'P-D': 1, 'MINIMUM DISTANCE': 2, 'IQD': 3, 'Patristic Distance': 1, 'Cover Traversal Edit Distance': 1, 'GTED': 2, 'ASDs': 1, 'lost distance': 1, 'PATRISTIC DISTANCES': 1, 'HAUSDORFF DISTANCE': 1, 'Distance to RTC': 1, 'MSHD': 2, 'HAMMING DISTANCE': 1, 'PDI-LTO': 1, 'ALD': 1, 'TARGET DISTANCE': 2, 'BASELINE DISTANCE': 1, 'CGD': 1, 'Maleollus Distance': 1, 'distance guitar': 1, 'STELLAR DISTANCES': 1, 'DTT': 1, 'Gower Distance': 1, 'Negotiation Distance': 1, 'MDDM': 1, 'DNs': 1, 'DN': 1, 'Stevens-Johnsen-Syndrome': 1, 'SJS': 2, 'EUCLIDEAN DISTANCE': 3, 'Defensive distance': 1, 'LGD': 1, 'FMD': 2, 'Chebychev Distance': 1, 'Caudothalamic Distance': 1, 'Biparietal Distance': 2, 'OFD': 1, 'Occipitofrontal Distance': 1, 'BPD': 2, 'CTD': 1, 'DTF': 1, 'ES': 1, 'PDS': 1, 'DSD': 1, 'UATOR_DISTANCE': 1, 'EXPERT_DISTANCE': 1, 'Distance Cost': 1, 'DUA': 1, 'IOICD': 1, 'Distance AT': 1, '-MDRM': 1, 'SR-MDRM': 1, 'Hop for Distance': 2, 'FJ': 1, 'SoVD': 1, 'Distance to limbus': 1, 'IZFD': 1, 'mDTA': 1, 'distance to': 2, 'DETERMINISTICALLY WITH DISTANCE': 1, 'DECREASE WITH DISTANCE': 1, 'Store Distance': 1, 'GDF': 1, 'IN': 5, 'SDP': 1, 'SDP-Z': 1, 'SDP-X': 1, 'Distance STATIS': 1, 'EmD.': 1, 'HP': 1, 'FRD': 1, 'Akdeniz Distance': 1, 'Ed': 1, 'Distance corr': 2, 'ENN-MN': 1, 'OCD': 3, 'ESTIMATES OF DISTANCE': 1, 'Screen Distance': 1, 'JND': 2, 'CADM': 3, 'ISR': 2, 'SID': 2, 'IDs': 1, 'Comfortable Distance': 1, 'AAD': 2, 'Unicity Distance': 1, 'SFD': 1, 'DoD': 1, 'DTN': 1, 'KLD': 2, 'DiCC': 1, 'Anovaginal Distance': 1, 'anovaginal distance': 1, 'PrD': 1, 'Distance oscillopsia': 1, 'Cropped Cropped FID': 1, 'ADD': 1, 'QTc': 1, 'PREVASCULAR DISTANCE': 1, 'PARAVERTEBRAL DISTANCE': 1, 'Flanker Distance': 1, 'flanker distance': 1, 'Canthal Distance': 1, 'CDE': 1, 'Distance Dangerousness': 1, 'CH': 1, 'SE': 1, 'CR': 1, 'MH': 1, 'SP': 1, 'Competition Distance': 1, 'Deliberate Distance': 1, 'loss of intermaxillary distance': 1, 'RDM': 1, 'SCAD': 1, 'LHD': 1, 'MOD': 1, 'IcD': 1, 'BVD': 1, 'NNND': 2, 'Distance metastasises': 1, 'IPDs': 2, 'DPD': 1, 'CDs': 1, 'Intercell Distance': 1, 'DCMIN': 1, 'EDR': 2, 'DISTANCE EDUCATION': 2, 'SWD': 1, 'dAVD': 1, 'DAC': 1, 'dominated distance': 1, 'Dominated Distance': 1, 'DST': 1, 'Educational Distances': 1, 'RAD': 1, 'SHD': 1, 'AHD*AHD%': 1, 'HDR': 1, 'PHFEs': 1, 'Distance Measuring': 1, 'Achilles Relief Distance': 1, 'ARD': 1, 'STS': 2, 'DTR': 2, 'Truncated Distance Kernel': 1, 'Retrieval of Distanced': 1, 'IOcD.': 1, 'ILDs': 2, 'Power distance': 1, 'power distance': 1, 'Least Square Distance': 1, 'CIPD': 1, 'MDS': 2, 'Centroidal Distance': 1, 'Distance parcourue': 1, 'Rhomboid Distance': 1, 'DISTANCE TO': 1, 'Diamagnetic Distance': 1, 'RIEMANNIAN DISTANCE': 1, 'Distance professionnelle': 1, 'Feasibility Distance': 1, 'MDIST': 1, 'DFL': 1, 'Huber Distance': 1, 'DAF': 1, 'TE': 1, 'UD': 1, 'DISTANCE-CUE': 1, 'impairment in distance stereoacuity': 1, 'DISTANCE OF': 1, 'MATCH_DISTANCE': 1, 'DISTANCE CORRELATION': 2, 'Kemel_meth MED': 1, '-MED': 1, 'INCREASED DISTANCE': 1, 'ABD': 1, 'MERGE_DISTANCE': 1, 'Stochastic Distance': 2, 'PNND': 1, 'Hamming Distances': 1, 'AILD': 1, 'DOC': 1, 'DTM': 1, 'Interpupillary Distances': 1, 'Itakura Distance': 1, 'Mash Distance': 1, 'Strength and Distance': 1, 'anoscrotal distance': 1, 'mNND': 1, 'IJD': 1, 'Choice of Distance': 1, 'Distance"[MeSH': 1, 'DC-SIS': 2, 'IDC': 1, 'MxD': 1, 'Hyomental Distance': 1, 'distance stigma': 1, 'DLs': 1, 'DAE': 1, 'Interneural Distance': 1, 'CDC': 1, 'COEXPRESSION DISTANCE': 1, 'or distance': 1, 'BOTTLENECK DISTANCES': 1, 'NCD': 1, 'Facet Distance': 1, 'ACHD': 2, 'AGD-AF': 1, 'LDM': 2, 'Distance to posterior extremity': 1, 'LDSNS': 1, 'DISTANCE ED': 1, 'IVD-': 1, 'IVD-CP': 1, 'interocular blur': 1, 'Sprint Distance': 1, 'DG/': 2, 'DISTANCE CLITIC': 1, 'Reach Distance': 2, 'distance discord': 1, 'NEG DISTANCE': 1, 'Interlamellar Distance': 1, 'Shortest Distance': 1, 'Diet Quality Distance': 3, 'SATELLITE DISTANCES': 1, 'OC4D OCD': 1, 'OCDs': 1, 'Swim Distance': 1, 'SOME CONFLICTING ESTIMANES OF DISTANCE': 1, 'INTEROCULAR DIFFERENCES': 1, 'iDR': 1, 'YED': 1, 'Shephard Distance': 1, 'Distance constraint': 1, 'HIM': 1, 'PBD': 1, 'LMD': 1, 'Frechet Distance': 1, 'Bhattacharyya Distances': 1, 'Distancing and blaming': 1, 'Distancing And Blaming': 1, 'MTP Distance': 1, 'SIDs': 1, '-md': 1, 'md': 1, 'CORAL Distance': 1, 'Aortosternal Distance': 1, 'Mahalanobis distance': 1, 'IAMP': 2, 'APHD': 1, 'DURATION-AS-DISTANCE': 1, 'Distance to Obstacles': 1, 'KDM': 1, 'EARTH MOVER DISTANCE': 1, 'MNPD': 1, 'DES': 1, 'SMDR': 1, 'ADs': 1, '1MWD': 1, 'OF DISTANCE EDUCATION ON': 1, 'Levenshtein Distance': 1, 'EAD': 1, 'AvD': 1, 'Onlooker Distance': 1, 'Retroactive Distance': 1, 'Retroactive Distances': 1, 'RhD': 1, 'interocular delays': 1, 'Stevens-Johnsen syndrome': 1, 'Md': 1, 'TOD': 2, 'Thalamooccipital Distance': 1, 'Negotiating Distance': 1, 'Nozzle Distance': 1, 'Distance Under': 1, 'betaMNTD': 2, 'Frchet Inception Distance': 1, 'NSD': 1, 'distance stereopsis': 1, 'PREDICT-HD': 1, 'EMED': 1, 'DISTANCE_IN': 1, 'DISTANCE*TASK': 1, 'ADS': 1, 'ESD': 1, 'Retired Distance': 1, '-DET DISTANCE': 1, 'reach distance': 1, 'NOZZLE DISTANCE': 1, 'CDO': 1, 'Distance tropia': 1, 'FICD': 1, 'Overshoot and Undershoot Distance': 1, 'MIDC': 1, 'SD Distance': 1, 'TGD': 1, 'residential distance': 1, 'Residential Distance': 1, 'interocular delay': 1, 'TA': 1, 'ESTIMATION OF DISTANCE': 1, 'ARRAY - TARGET DISTANCE': 1, 'JTBS': 1, 'Wiener and Distance Polynomials': 1, 'Distance delay': 1, 'CDPOP': 1, 'FD-CCD': 1, 'DIR': 1, 'Distance snout': 1, 'Apex distance': 1, 'MTD': 1, 'rDG': 1, 'Azimuth-Distance': 1, 'Marital Distance': 1, 'EUCLIDEAN_DISTANCE': 1, 'DM II': 1, 'DM I': 1, 'Distance Randot Stereotest': 1, 'Nostril Distance': 1, 'NOD': 1, 'Distance and': 1, 'DDMs': 1, 'DDs': 1, 'RoD': 1, 'Damerau-Levenshtein Distance': 1, 'Feeling Distance': 1, 'PLRD': 1, 'PMRD': 1, 'Distance Runner': 1, 'distance runner': 1, 'HCD': 1, 'GBDP': 1, 'IOUM': 1, 'Patristic Distances': 1, 'CDA': 1, 'Trip Distance': 1, 'TDT': 1, 'Shortest Path Edit Distance': 1, 'SPED': 1, 'distance anatomy': 1, 'Distance anatomy': 1, 'SPDD': 1, 'and Distancing': 1, 'Downtail Distance': 1, 'Distance-': 1, 'PRD': 1, 'PTD': 2, 'Loci Distance': 1, '-MONITOR DISTANCE': 1, 'Distancing through': 1, 'FDC': 1, 'ODI': 1, 'PWDs': 1, 'interpupillary distance': 1, 'EMDO': 1, 'Distance (A)': 1, 'Forgetfulness Distance': 1, 'Sonoanatomic Distances': 1, 'DRC': 1, '-HD': 1, 'IOD SE': 1, 'MDP.Mean': 1, 'MDP': 1, 'NPD': 1, 'BZD': 1, 'MULTIVARIATE DISTANCE': 1, 'Inter-Role Distance': 1, 'Distance insuff': 1, 'MAH': 1, 'BHD': 1, 'AWD': 1, 'Distancing in': 1, 'Impairment in Endpoint Distance': 1, 'Endpoint Distance impairment': 1, 'DIST*YEAR': 1, 'Heliocentric Distance': 1, 'ALDC': 1, 'iEMD': 1, 'DNN': 1, 'HDN': 1, 'DCA': 1, 'distance a': 1, 'Distance a': 1, 'Reassortment Distance': 1, 'Canthal Distances': 1, 'BD MI': 1, 'Overcome Distance': 1, 'DNC': 1, 'Distance of Lower': 1, 'Zenith Distance': 1}
|
Distance
|
Disease
|
MESH:C535292
|
{'arthrogrypotic syndromes': 4, 'Peterson defect': 4, "Peterson's defect": 22, 'arthrogrypotic': 48, 'Arthrogrypotic': 6, 'Smith-Peterson': 1, '-Peterson': 16, 'arthrogrypotic deformities of the limbs': 1, 'LVC': 12, 'arthrogrypotic extremities': 1, 'arthrogrypotic changes in': 1, 'CAMP': 2, 'Smith-peterson osteotomy': 1, 'PETERSON': 3, 'Peterson and': 1, 'lower extremity sensory changes': 1, 'arthrogrypotic syndrome': 4, '-Peterson or Ponte': 1, 'Smith-Peterson osteotomy': 5, 'SPO': 2, 'PEM': 6, 'arthrogrypotic lesions': 1, 'arthrogrypotic features': 1, 'arthrogrypotic deformities': 2, 'Brittberg-Peterson patella': 1, 'EDITH PETERSON': 4, 'Peterson type 5': 1, 'VHPT': 1, 'arthrogrypotic-like conditions': 1, 'arthrogrypotic limb deviations': 1, 'Faye-Peterson type': 1, 'Faye-Peterson': 1, 'Peterson type V fracture': 1, "Peterson's defects": 1, 'Peterson type 1': 1, 'S-P': 1, 'MSP': 1, 'OLIVIA T. PETERSON': 1, 'Limb change': 1, 'Peterson type I': 2, 'Peterson type II-V fractures': 1, 'Peterson fracture': 2, 'Peterson type II fractures': 1, 'Peterson type fractures': 1, 'Peterson type I fractures': 2, 'Smith-Peterson Osteotomy': 2, 'Peterson herniation': 1, 'Peterson III fractures': 1, 'Peterson II and III fractures': 1, 'Peterson fractures III-V': 1, 'Peterson II': 1, 'Peterson fractures': 1, 'Peterson I and II fractures': 1, 'Peterson II fractures': 1, 'Peterson I fractures': 1, 'Peterson V type fractures': 1, 'Peterson V fractures': 1, 'arthrogrypotic deformities of the extremities': 1, 'Peterson type I-V fractures': 1, 'arthrogrypotic changes of': 1, 'arthrogrypotic changes': 1, 'Peterson I': 1, 'Peterson VI': 1, 'Arthrogrypotic syndromes': 1, 'arthrogrypotic-like deformities': 1, 'arthrogrypotic defects': 1, 'Smith-Peterson and Ponte': 1, '-Peterson and Ponte': 1, 'Peterson osteotomies': 1, 'WPI': 1, "Peterson's type VI lesion": 1, 'Peterson type I lesion': 1, "Peterson's type I injury": 1, "Peterson's type I lesion": 1, "Peterson's osteotomies": 1, 'arthrogrypotic joints': 1, "and Peterson's defects": 1, "Peterson's": 1, "Peterson's or mesenteric defect": 1, 'Peterson type III': 1, 'Peterson type I injury of': 1, 'Peterson type I physeal injury': 1, 'arthrogrypotic-like deformity': 1}
|
arthrogrypotic
|
Disease
|
MESH:C535293
|
{"Malignant 'angioendotheliomatosis": 1, "cutaneous malignant 'angioendotheliomatosis": 1, 'Malignant angioendotheliomatosis': 26, 'Cerebral angioendotheliomatosis': 4, 'malignant angioendotheliomatosis': 61, 'MAE': 8, 'Neoplastic angioendotheliomatosis': 14, 'NAE': 9, 'neoplastic angioendotheliomatosis': 15, 'reactive angioendotheliomatosis': 72, 'angioendotheliomatosis': 61, 'Angioendotheliomatosis': 18, 'glomeruloid angioendotheliomatosis': 4, 'Reactive angioendotheliomatosis': 35, 'angioendotheliomatosis proliferaus systemisata': 1, 'proliferating angioendotheliomatosis.1': 1, 'REA': 1, 'Reactive Angioendotheliomatosis': 2, 'RAE': 24, 'cutaneous glomeruloid RAE': 1, 'Glomeruloid reactive angioendotheliomatosis': 1, 'Glomeruloid RAE': 1, 'angioendotheliomatosis proliferans systemisata': 22, 'malignant angioendotheliomatosis proliferans': 1, 'Malignant angioendotheliomatosis proliferans': 2, 'Systemic angioendotheliomatosis': 6, 'systemic angioendotheliomatosis': 7, 'systemic proliferative angioendotheliomatosis': 1, 'angioendotheliomatosis proliferans': 2, 'endothelial neoplasm-angioendotheliomatosis': 1, 'malignant angioendotheliomatosis of the gallbladder': 1, 'malignant proliferative angioendotheliomatosis': 1, 'Malignant proliferative angioendotheliomatosis': 1, 'RAE of the': 1, 'diffuse reactive angioendotheliomatosis': 2, 'Systemic angioendotheliomatosis of the lung': 1, 'FSRA': 1, 'FSRA lesions': 1, 'systemic reactive angioendotheliomatosis': 6, 'reactive angioendotheliomatosis lesions': 1, 'glomeruloid RAE': 1, 'glomeruloid reactive angioendotheliomatosis': 2, 'dermal angioendotheliomatosis': 1, 'cutaneous angioendotheliomatosis': 1, 'diffuse dermal reactive angioendotheliomatosis': 1, 'cutaneous reactive angioendotheliomatosis': 1, 'intravascular reactive angioendotheliomatosis': 2, 'RA': 2, 'reactive cutaneous angioendotheliomatosis': 2, 'cerebral angioendotheliomatosis': 1, 'angioendotheliomatosis proliferans systematisata': 1, 'Angioendotheliomatosis proliferans systematisata': 3, 'Systemic proliferating angioendotheliomatosis': 1, 'Angioendotheliomatosis proliferans systematizata': 1, 'Angioendotheliomatosis proliferans systemisata': 3, 'AEPS': 1, 'Systemic proliferative angioendotheliomatosis': 1, 'Systemic reactive angioendotheliomatosis-like syndrome': 1, 'benign reactive angioendotheliomatosis': 1, 'Benign reactive angioendotheliomatosis': 1, 'Angioendotheliomatosis of the nose': 1, 'Reactive cutaneous angioendotheliomatosis': 2, 'RCA': 1, 'Neoplastic Angioendotheliomatosis': 1, 'Angioendotheliomatosis of the lungs': 1, 'ANGIOENDOTHELIOMATOSIS PROLIFERANS SYSTEMATISATA': 1, 'APS': 2, 'RAE lesions': 1, "Tappeiner's angioendotheliomatosis": 1, 'Neuroma Vascular Angioendotheliomatosis': 1, 'intravascular angioendotheliomatosis': 1, 'reactive angioendotheliomatosis proliferans': 1, 'systemic reactive angioendotheliomatosis lesions': 1, 'SYSTEMIC REACTIVE ANGIOENDOTHELIOMATOSIS': 1, 'diffuse dermal angioendotheliomatosis': 2, 'proliferating angioendotheliomatosis': 1, 'Malignant systemic angioendotheliomatosis': 1, 'reactive intravascular angioendotheliomatosis': 1, 'Proliferative angioendotheliomatosis': 1, 'angioendotheliomatosis proliferans systemica': 1, 'proliferative systemic angioendotheliomatosis': 1, 'Malignant angioendotheliomatosis of the nose': 1, 'Pulmonary malignant angioendotheliomatosis': 1}
|
reactive angioendotheliomatosis
|
Disease
|
MESH:C535295
|
{'neurological, mental, or hearing problems': 1, 'loss of retardation': 1, 'ataxia/hearing loss': 1, 'hearing, visual and other physical and mental impairments': 3, 'Cavanagh syndrome': 4, 'motor, hearing, sight, and mental disabilities': 1, 'hearing, speech or mental disability': 1, 'Mental or hearing impairment': 2, 'hearing retardation': 1, 'ataxia-tremor-retardation syndrome': 5, 'visual, hearing and speech, intellectual, and mental': 1, 'hearing and neurodevelopmental sequelae': 1, 'hearing, sight or mental impairment': 2, 'mental, visual or hearing impairments': 1, 'mental, visual, or hearing impairments': 2, 'neurodevelopmental, intellectual, physical, visual, or hearing impairment': 4, 'hearing, visual, or other physical or mental impairments': 1, 'mental, visual or hearing impairment': 1, 'hearing or mentally impaired': 3, "Cavanagh's syndrome": 3, 'CAV': 1, 'visual, hearing, mental or physical impairment': 1, 'Developmental delay in movement': 1, 'impairment of hearing and mental retardation': 1, 'visual or mental hearing impairments': 1, 'hearing, speech, and mental disabilities': 1, 'hearing loss, ataxia,': 1, 'Neurodevelopmental and hearing sequelae': 1, 'mental, hearing and memory problems': 1, ', Hearing, and Mental Disabilities': 1, 'speech, hearing, or mental impairment': 1, 'hearing, visual, physical, or mental impairment': 1, 'Ataxia Rigidity Hearing loss': 1, 'hearing and mental impairments': 1, 'hearing, behavioural, emotional, or mental impairment': 1, 'visual, hearing, speech, physical, intellectual, and mental impairments': 1, 'mental and hearing impairment': 4, ', visual, hearing, mental, emotional impairment': 1, 'mental, movement, sight, and speech/hearing': 1, 'hearing and neurodevelopmental involvement': 1, 'Epilepsy, hearing loss and mental retardation syndrome': 1, 'neurodevelopmental and hearing impairment': 2, 'mental, hearing, and visual impairment': 1, 'mental, speech, or hearing impairment': 1, 'mental, hearing and visual impairments': 2, 'visual, hearing or mental impairment': 2, 'visual, hearing, mental, or physical impairment': 1, 'mental or hearing impairment': 2, 'speech, mental or hearing problems': 1, 'hearing, visual, and other physical and mental impairments': 1, 'Mental and hearing defects': 1, 'mental, hearing and speech impairments': 1, 'normal hearing retardates': 1, 'visual, hearing and mental impairments': 1, 'visual, hearing, physical, mental/intellectual impairment': 1, 'visual, hearing, physical, mental': 2, 'visual, hearing, mental/intellectual, physical and multiple impairments': 1, 'hearing or mental impairment': 3, 'Kozlowski-Reardon': 1, 'physical, visual, hearing, and mental impairments': 1, 'visual, hearing and mentally impaired': 1, 'Cavanagh disease': 1, 'hearing, speech and mental disability': 1, 'mobility, visual, hearing, intellectual, or mental health impairments': 1, 'ataxia with hearing loss': 1, 'sight, mental or hearing impairments': 1, 'neurodevelopmental loss': 1, 'impairments (motor, speech, seeing, hearing': 1, 'mental, visual, or hearing impairment': 1, "Cavanagh's": 1, 'mental, motor, visual, and hearing impairment': 1, 'impaired hearing Ataxia': 1, 'epilepsy, hearing loss and mental retardation syndrome': 1, 'EHLMRS': 2, 'mental or hearing impairments': 1, 'ataxia-deafness-retardation syndrome': 1, 'Ataxia-deafness-retardation syndrome': 1, 'visual, hearing, mental and physical impairment': 1, 'psychomotor hearing loss and retardation': 1, 'mental, hearing': 1, 'hearing and neurodevelopmental impairments': 1, 'mental, hearing or speech problem': 1, 'hearing and mental impairment': 1, 'visual, hearing, and mental impairments': 1, 'visual and/or hearing and/or mental impairment': 1, 'Cavanagh': 1, 'Hearing Ataxia': 1, 'visual, hearing, physical, mental, and cardiopulmonary impairment': 1, 'mental and hearing impairments': 3, 'neurodevelopmental and hearing impairments': 1, 'developmental retardation in hearing': 1, 'Familial Developmental delay': 1, 'epilepsy, hearing loss, and mental retardation syndrome': 1, 'syndromic ataxia-deafness': 2, 'ataxia and retardation': 1, 'neurodevelopmental and hearing problems': 1, 'hearing and neurodevelopmental concerns': 1, 'hearing, speech or mental impairment': 1, 'hearing and mental illness': 1, 'loss of neurodevelopmental': 1, 'visually, hearing or mentally impaired': 1, 'physical, intellectual, visual, hearing, speaking and mental impairments': 1, 'visual, hearing, tongue-speech and mental impairments': 1, 'hearing loss and retardation': 1}
|
ataxia-tremor-retardation syndrome
|
Disease
|
MESH:C535296
|
{'CSR': 236, 'Deficiency in homologous recombination': 4, 'HR': 2172, 'HR deficiency': 1035, 'homologous recombination deficiency': 1978, 'HRD': 2001, 'HR deficiencies': 105, 'CRF': 148, 'CRFs': 315, 'RIL': 635, 'ENGINEERED RECOMBINANT LIVE': 1, 'homologous recombination-deficient': 24, 'HRD tumors': 174, 'homologous recombination repair': 26, 'HRR': 249, 'HR defects': 89, 'recombinant chromosome 8 syndrome': 6, 'recombinant 8 syndrome': 6, 'Homologous Recombination Deficiency': 177, 'homologous recombination': 261, 'URF infections': 3, 'homologous recombination repair deficiency': 138, 'HRD neoplasms': 1, 'RILs': 204, 'homologous recombination (HR) deficiency': 113, 'HR+': 7, '-lui': 1, 'homologous-recombination deficient': 3, 'CSR defect': 10, 'CRFs.html': 37, 'BIOLOGICAL ROLES OF HOMOLOGOUS RECOMBINATION': 1, 'GENETICS OF HOMOLOGUS RECOMBINATION': 1, 'HR-deficiency': 152, 'HR-deficient': 175, 'HR deficient': 86, 'HR related defects': 1, 'homologous recombination (HR)-deficient': 5, 'HRD-': 12, 'Rec': 20, 'SR': 6, 'BR': 1, 'homologous-recombination deficiency': 30, 'recombination defects': 7, 'KREC': 29, 'TREC': 5, 'Homologous recombination deficiency': 415, 'MR': 11, 'non-Homologous Recombination Deficiency': 1, 'recombination': 178, 'KRECS': 1, 'V(D)J recombination defects': 3, 'Homologous recombination/end joining (HR/HEJ)-deficient cancers': 1, 'AR': 17, 'ARGs': 3, 'recombinant zoster': 3, 'HRR deficiencies': 13, 'CRF 02_AG': 3, 'CRF 01_AE': 2, 'lui': 13, 'NAHR': 176, 'RIL-': 5, 'RZV': 104, 'Homologous recombination (HR) deficiency': 10, 'RDR': 16, 'HRR deficiency': 133, 'HR deficient tumors': 10, 'rVOka': 1, 'HRDs': 15, 'homologous recombination repair (HRR) deficiency': 19, 'HR-defective tumors': 4, 'rAN-PEP': 1, 'RAG1 deficiency': 13, 'recombination activating gene 1 (RAG1) deficiency': 2, 'CLASS SWITCH RECOMBINATION': 4, 'RECs': 3, 'homologous recombination defect': 15, 'HR defective': 8, 'homologous recombination deficiencies': 58, 'RECOMBINATION': 120, 'homologous recombination-deficient (HRD) cancers': 1, 'Recombination Activation gene': 1, 'RAG': 25, 'recombination DNA': 11, 'Recombinant Virus Infection': 1, 'ORM': 2, 'Homologous Recombination Repair Deficiency': 12, 'homologous recombination repair deficiencies': 5, 'RSS': 64, 'RIL-4': 1, 'RIL-5': 1, 'HR-deficient tumors': 81, 'HRP BCs': 1, 'Homologous recombination repair deficiency': 28, 'CHORD': 16, 'HRP': 66, 'HRR dysfunction': 9, 'HRF': 5, 'HR impairment': 25, 'rNIF': 1, 'recAP': 7, 'rFN': 1, 'MMR': 1, 'recFSH': 1, 'Deficiency of the HR': 1, 'rAT': 2, 'IMMUNOGLOBULIN CLASS SWITCH RECOMBINATION': 1, 'homologous-recombination-repair deficiency': 2, 'ALVAC': 1, 'TAR': 30, 'URFs': 8, 'KAPPA-DELETING RECOMBINATION EXCISION CIRCLES': 1, 'HRP tumors': 23, 'HRD tumor': 35, 'homologous recombination defects': 23, 'HR-deficiencies': 5, 'IHR': 9, 'HRD-L': 2, 'MML': 3, 'HR and FP': 1, 'USE OF RECOMBINANT ANTIBODIES': 1, 'VALIDATION OF RECOMBINANT ANTIBODIES': 1, 'DEVELOPING RECOMBINANT ANTIBODIES': 1, 'DEVELOPING RECOMBINANT MABS': 1, 'RECOMBINANT ANTIBODIES': 2, 'rIDE': 1, 'recombination deficiency': 52, 'hyper-Rec': 1, 'HRD deficient disease': 1, 'homologous recombination deficient': 79, 'RF 2k/1b': 1, 'Homologous recombination': 29, 'AI-RILs': 3, 'HREs': 1, 'HRD homologous recombination deficiency': 14, 'RAG deficiency': 45, 'ISNR': 1, 'HDR': 19, 'HRD carcinoma': 9, 'deficiency in homologous recombination': 3, 'HR-deficient (HRD) tumors': 2, 'RITs': 30, 'recombination-activating gene protein (RAG) deficiency': 1, 'RAG-deficient': 20, 'RIAILs': 6, 'GARD': 24, 'RECOMBINANT': 58, 'homologous recombination deficient tumors': 17, 'rAAV': 1, 'rAAV-MEDIATED': 2, 'NAM RIL': 4, 'CSR defects': 14, 'rFSH': 8, 'RECOMBINANT FORMS': 1, 'RF': 3, 'RD': 1, 'rMIF': 7, 'rTCRV': 1, 'HR dysfunctions': 3, 'rOPN': 16, 'homologous recombination dysfunction': 7, 'rGSDMD': 2, 'SL': 10, 'SCR': 27, 'CHROMATID RECOMBINATION': 1, 'SISTER CHROMATID RECOMBINATION': 1, 'HRR deficient': 7, 'Myriad homologous recombination deficiency': 1, 'recHA': 1, 'URF': 23, 'homologous recombination repair (HRR) deficiencies': 5, 'LTF': 1, 'HTF': 1, 'HR and end-joining': 1, 'homologous recombination (HR': 10, 'HR-ness': 1, 'RIT': 20, 'Recombinant chromosome 4': 1, 'recombinant chromosome 4': 1, 'Recombinant chromosome 4 syndrome': 2, 'rec(4) syndrome': 1, 'recombinant chromosome 4 syndrome': 3, 'rec(4)': 2, 'rec(4) syndromes': 1, 'HRD pathway deficiencies': 1, 'rmOPN': 5, 'rLvIA': 1, 'PREDICTION OF PHYLOGENETIC RECOMBINATION': 1, 'HA': 2, 'San Luis Potosi': 4, 'HR Deficiency': 17, 'rMCO': 1, 'Recombinant zoster vaccine': 3, 'rRLC': 1, 'rP18 infection': 1, 'HRRm': 11, 'HRp': 4, 'HRd': 13, 'HRRm tumors': 1, 'epiRILs': 12, 'Hyper CSR': 1, 'Homologous Recombination (HR) deficiency': 3, 'HCP': 1, 'RDP': 12, 'LRNs': 1, 'Hypersensitivity to HR': 1, 'RECOMBINANT LEUCOTOXIN COMPONENTS': 1, 'recFH': 1, 'homologous recombination deficient (HRD) tumors': 17, 'OTHER FORMS OF ABERRANT RECOMBINATION': 1, 'rPA': 14, 'RECOMBINATION WITHIN': 2, 'FL': 1, 'FRT': 12, 'homologous recombination repair (HRR)-deficient': 2, 'HRR-deficiency': 9, 'SHR': 2, 'GENETIC RECOMBINATION': 16, 'RAG deficient': 4, 'HRR-deficient': 12, 'CRFs AE and AG of': 1, 'HR dysfunction': 30, 'Homologous recombination deficient': 14, 'Homologous Recombination': 10, 'TRMR': 5, 'homologous recombination repair deficient': 3, 'CONFIRMATION OF RECOMBINATION': 1, 'homologous recombination deficient (HRD) tumours': 1, 'meiotic recombination disorder': 1, 'HOMOLOGOUS RECOMBINATION': 13, 'rWSP': 1, 'DHR': 6, 'CRFs infections': 1, 'V(D)J recombination': 10, 'homologous recombination (HRD) deficiency': 1, 'ZH RIL': 2, 'SLV': 4, 'RTIN': 1, 'rRT': 1, 'CSR-D': 7, 'Transcription-associated recombination': 1, 'rA box': 1, 'rMOMP': 4, 'RAG (Recombination activating genes) deficiency': 1, 'RP': 8, 'Vaz-Luis': 6, 'HRIs': 1, 'homolgous recombination deficient': 1, 'RECOMBINANT EXTRACTED': 1, 'REC': 3, 'rPPAD': 1, 'recombination activating gene (RAG) deficiency': 4, 'RAG Deficiency': 6, 'San Luis Valley Syndrome': 2, 'A2 recombinant infection': 1, 'HDDR': 2, 'CLASS-SWITCH RECOMBINATION': 3, 'RMBT': 1, 'HRD) tumors': 5, 'BRED': 8, 'CSR impairment': 4, 'rTcpC': 1, 'RP-IIB': 1, 'SLP': 6, 'LT-RIL': 1, 'homologous recombination deficit': 4, 'CHARACTERIZATION OF RECOMBINATION-': 1, 'MDR': 2, 'RAG defects': 7, 'SURFACE RECOMBINATION': 1, 'CC RI': 1, 'rACT': 1, 'EVIDENCE OF GENETIC RECOMBINATION': 1, 'homologous recombination repair (HRR) dysfunction': 1, 'rhT': 1, 'RECOMBINANT ONCOLYTIC': 1, 'Luis': 7, 'HR-related defects': 1, 'SRADs': 1, 'HR proficient': 1, 'RAG-2-deficient': 1, 'Ig-CSR': 1, 'Ig class-switch recombination': 1, 'wang-bu-lui-xing': 1, 'ARC': 2, 'Recombination Activating Gene (RAG) deficiency': 1, 'ACTIVITY OF RECOMBINANT': 1, 'RECOMBINANT PROTEINS': 14, 'recombination defect': 4, 'RGCN': 1, 'TRAP': 7, 'MECHANISMS OF RECOMBINATION': 1, 'RECOMBINEERING': 4, 'GENERAL RECOMBINATION': 1, 'deficient HR': 3, 'rHBHA': 2, 'NAHR)': 1, 'non-allelic homologous recombination': 1, 'non-homologous recombination deficiency': 1, 'TR': 5, 'SCREENING FOR RECOMBINANTS': 1, 'TWO-STEP RECOMBINEERING FOR LARGE': 1, 'ONE-STEP RECOMBINEERING FOR MARKED INSERTIONS': 1, 'RECOMBINEERING FOR SEAMLESS DELETIONS': 1, 'RECOMBINEERING PLASMID': 1, 'deficiencies for Homologous Recombination': 1, 'HR-defective': 6, 'HRD)': 3, 'recombination-activating gene (RAG) deficiency': 3, 'Recombination-activating gene deficiency': 1, 'RTE': 1, 'Type II RTE': 2, 'Type IIR RTE': 1, 'RITE': 9, 'HR pathway deficiency': 4, 'MECHANISM OF SITE-SPECIFIC RECOMBINATION': 1, 'ARCHAEAL DNA RECOMBINATION TARGETS': 1, 'FIRST ACCOUNTS OF INTEGRASE-PROMOTED SITE-SPECIFIC RECOMBINATION': 1, 'ReC': 3, 'HR defect': 24, 'RHCIII-MPC': 2, 'San Luis Valley syndrome': 5, 'rKL': 1, 'homologous recombination-defective tumors': 1, 'HRRd': 1, 'RHCIII': 1, 'recombination DNA repair': 1, 'homologous recombination DNA repair deficiency': 1, 'Homologous recombination DNA repair deficiency': 1, 'BRILs': 6, 'CRF-related infections': 1, 'SARF': 2, 'homologous recombination (HR) repair': 1, 'HR-DDR': 1, 'HR gene': 2, 'KJ-RIL': 3, 'serous HRD': 1, 'DNA homologous recombination deficiency': 3, 'CRF02) infection': 1, 'USE OF RECOMBINANT ACTIVATED FACTOR VIIa': 1, 'use of recombinant activated factor VIIa': 1, 'Recombination': 4, 'HR-': 39, 'recombinant': 1, '-RHPS': 1, 'rhIns': 1, 'rhTRAIL': 1, 'HRD deficient': 4, 'RECOMBINATIONS': 3, 'RSA': 2, 'rAIM': 8, 'Recombination Deficiency': 26, 'homologous recombination defective tumors': 4, 'Homologous recombination (HR) repair deficiency': 1, 'HRR defects': 10, 'Homologous recombination molecular deficiencies': 1, 'Deficiency in HR': 3, 'INOCULATION OF RECOMBINANT VIRUS': 1, 'RC': 6, 'rsIL-7gly': 1, 'homologous recombination (HR) DNA': 1, 'RMCE': 22, 'tRE': 1, 'rHcABHD': 2, 'homologous recombinational (HR) repair deficiency': 1, 'PERSPECTIVES OF DEVELOPMENT OF LIVE RECOMBINANT': 1, 'rec-Prion': 1, 'RSSs': 3, 'rhLF': 2, 'DRR': 3, 'rE-DIII': 1, 'switch recombination defects': 1, 'Switch Recombination Defects': 1, 'CSRD': 1, 'GB RIL': 1, 'DSB': 1, 'rML': 5, 'recombination deficiency of DNA': 1, 'NAHR 22q11.2': 1, '-HDDR': 1, 'recombination-related': 1, 'Homologous-recombination deficiency (HRD)': 1, 'CHORD-': 1, 'CHORD-HRD': 1, 'HRD deficiencies': 2, 'CHORD-HRP': 1, 'HOmologous Recombination Deficiency': 5, 'RA': 6, 'RECOMBINATION-DEPENDENT': 1, 'Homologous recombination haploinsufficiency': 1, 'HR+/HER2-': 1, 'TISSUE RECOMBINATIONS': 1, 'TISSUE RECOMBINATION': 1, 'homologous-recombination-deficient (HRD) tumors': 1, 'CSR deficiencies': 5, 'V(D)J recombination defective': 1, '-RECOMBINANT': 1, 'HRD malignancies': 2, 'HRD abnormality': 1, 'HR-deficient (': 1, 'RAG deficiencies': 8, 'RCSL': 1, 'IRIP': 1, 'rhVTN': 1, 'OF RECOMBINATION': 2, 'Recombination Activating Genes (RAG) deficiencies': 1, 'homologous recombination (HR)': 11, 'RR': 3, 'deficiency of HRD': 1, 'IRV': 1, 'recombination abnormalities': 6, 'SUCCESSFUL RECOMBINATION OF FLOXED ALLELES': 1, 'RAC': 8, 'CRFs 01_AE': 3, 'RECOMBINATION SYSTEM': 1, 'homologous recombination repair defects': 3, 'RECOMBINATION STUDIES': 1, 'homologous recombination repair deficient (HRD) tumors': 1, 'CRF AG': 1, 'CRF AE': 1, 'immunoglobulin class switch recombination (Ig-CSR) deficiencies': 2, 'NR': 3, 'CR': 1, 'PR': 2, 'THEIR RECOMBINATION': 1, 'LT_Rec': 1, 'rHVT-LT': 2, 'homologous-recombination repair': 1, 'BF CRFs': 3, 'RECOMBINATION MECHANISM': 2, 'recombinational abnormalities': 1, 'RMPs': 1, 'MEIOTIC RECOMBINATION': 2, 'RECOMBINATION OF': 5, 'RCA': 2, 'RECOMBINATION AMONG': 1, 'P/LP HRR': 1, 'homologous recombination proficient': 2, 'RECAP': 3, 'Deficiencies in HR': 2, 'homologous recombination pathway (HRD) abnormalities': 1, 'LUMBAR PEDICLE SCREW FIXATION ON RECOMBINANT CT SECTION AFTER': 1, 'rPCN': 1, 'RDF': 14, 'AE-rMS': 1, 'ALT': 2, 'DR': 12, 'RTS': 2, 'RV': 1, 'EFFECT OF RECOMBINANT ADENOVIRUS-BONE MORPHOGENETIC PROTEIN': 1, 'RIL POPULATION': 1, 'HRR disorders': 1, 'HR reduction': 1, 'HOMI-RILs': 1, 'rSVAs': 2, 'homologous recombination (HR) proteins deficiencies': 1, 'rCN': 1, 'rec': 6, 'homologous recombination repair (HRR': 7, 'NRCs': 5, 'rEC-': 1, 'RECORD': 1, 'INHIBITION OF HOMOLOGOUS RECOMBINATION': 1, 'ARG': 5, 'EV-RNA': 1, 'rOVA': 1, 'rTMD1': 1, 'rED-A': 1, 'Homologous recombination defects': 3, 'COs': 1, 'NCOs': 1, 'HRDness': 2, 'Putative Recombination initiation Defects 2-3': 1, 'HRD Tumors': 2, 'rHCRD': 1, 'recDE': 1, 'ORBIT': 3, 'HR abnormalities': 6, 'AI-RIL': 5, 'homologous recombination DDR deficiency': 1, 'homologous recombination DNA': 5, 'RAG2-SCID': 1, 'HR-Deficient Tumors': 2, 'MHMR': 4, 'homologous recombination (HR) deficiencies': 7, 'T-ReCS': 1, 'rCCN2': 2, 'REPLICATIVE RECOMBINANT INFLUENZA': 1, 'rLH': 3, 'homologous recombination [HR] deficiencies': 1, 'RECOMBINING CHROMOSOMES': 1, 'HR-deficiency tumor': 1, 'rK39': 1, 'chromosomal recombination abnormalities': 1, 'Recombination-activating gene (RAG) deficiencies': 1, 'Rag': 1, 'deficient recombination-activating gene': 1, 'rF.': 1, 'FACTORS DURING RECOMBINATION': 1, 'rFMOD': 1, 'deficiency of HR': 6, 'recombination deficiencies': 5, 'Moreau HR deficiency': 1, 'deficiency of homologous recombination': 4, 'RIAIL': 2, 'rProt chassis': 1, 'Homologous-Recombination deficiency': 1, 'rSAA': 1, 'Homologous recombination DNA': 3, 'homologous recombination (HR)-deficient tumors': 2, 'CAAR': 1, 'RIV': 5, 'IS-RIL': 1, 'rSAF': 1, 'HR repair deficiency': 18, 'homologous recombination-': 1, 'recMAGE-A3': 1, 'RI': 4, 'rec pneumoniae': 1, 'Rec pneumoniae': 1, 'HRD disease': 1, 'Pima RIL': 1, 'RECOMBINATION-MEDIATED': 1, 'homologous recombination-deficient tumors': 11, 'rbOPN': 1, 'tumor HRD': 5, 'Recombination Activating Gene (RAG) defects': 1, 'RhTRAIL': 1, 'RPS': 3, 'homologous recombination repair (HRR) defects': 1, 'HRD deficiency': 10, 'HN RIL': 1, 'homologous recombination (HR) dysfunction': 1, 'tsOSHS': 1, 'deficiency in HR': 11, 'rCEM': 1, 'homologous-recombination': 3, 'mTS': 1, 'lui aussi': 2, 'lui-meme': 2, 'NHR': 7, 'CSR deficiency': 19, 'Recombination abnormalities': 1, 'K3N-RIL': 1, 'RO': 1, 'AARP': 1, 'RECOMBINATION DEFECTS': 1, 'MEIOSIS-SPECIFIC REGULATION OF RECOMBINATION NUCLEOFILAMENTS': 1, 'RECOMBINATION MEDIATORS': 1, 'tumor homologous recombination deficiency': 5, 'Luys body lesion': 1, 'DCM': 1, 'Recombination-activating gene 1 (': 1, 'homologous recombination deficient (HRD)': 2, 'UP-RIL': 2, 'HRD.Conclusions': 1, 'MRF': 3, 'PCRRC': 1, 'epiRIL': 4, 'CREATE': 1, 'R-iSAT': 1, 'rVT': 1, 'GSPS': 1, 'HOMOLOGOUS RECOMBINATION REPAIR OF REPLICATION INDEPENDENT': 1, 'rEP': 2, 'RRM': 1, 'homologous recombination system deficiency': 1, 'RILS': 1, 'HRRD': 4, 'PG-RIL': 4, 'homolog recombination deficiency': 2, 'MAGIC RIL': 1, 'rNP': 5, 'rH7HA': 1, 'M-CREATE': 1, 'DRF': 1, 'RAG deficiency': 1, 'EFFECT OF RECOMBINANT CO-EXPRESSION': 1, 'GRN': 1, 'deficiency of DNA homologous recombination': 1, 'rMSA': 2, 'mRCP': 2, 'SLVDS': 7, 'BIR': 2, 'RECOMBINANT FUSION': 1, 'CSRnc': 1, 'HRD-deficiency': 1, 'RHI': 2, 'SOMATIC RECOMBINATION': 1, 'BR-RIL': 2, 'recombination-activating gene': 1, 'rEC': 2, 'SK-RIL': 1, 'Homologous Recombination Defects': 1, 'SCRaMbLE': 4, 'of HR': 2, 'RISL': 1, '(CRF) 02_AG infected': 1, 'REQUIRED FOR CLASS SWITCH RECOMBINATION': 1, 'HRR pathway deficiency': 1, 'recombination activation gene (RAG)1 deficiency': 1, 'recombination activation gene 1 (': 1, 'RAG1) deficiency': 1, 'RECOMBINANT MUTSalpha': 1, 'rIAV infection': 1, 'Homologous Recombination (HR) deficient tumors': 1, 'homologous recombination deficiency (HRD)': 1, 'TSR': 1, 'HR-4': 1, 'HRD-defective': 1, 'HRD impairment': 1, 'recombination deficient': 2, 'HR-deficient tumor': 3, 'HR-Deficiency': 3, 'RPP': 3, 'LRR': 1, 'HRDsig': 1, 'malgre lui': 2, '23-RSS': 2, 'rAAV8': 1, 'HRR-deficient tumors': 5, 'IR': 9, 'LSR': 4, 'SLVHAS': 1, 'RMD': 1, 'recombination deficiencye': 1, 'HIGH RESOLUTION MAPPING OF PLANT MEIOTIC RECOMBINATION': 1, 'MANUPULATION OF MEIOTIC RECOMBINATION FOR': 1, 'homologous recombination-deficient (HRD) carcinoma': 1, 'Recombination-activating gene 1 (RAG1) deficiency': 1, 'rVvhA': 1, 'SITE-SPECIFIC RECOMBINATION': 2, 'HRD-deficient': 4, 'CRFs 1 and 2': 1, 'CRF 01_AE - 14_BG': 1, 'CRF 14': 1, 'recombination aberrations': 1, 'immunoglobulin class switch recombination (': 2, 'immunoglobulin class switch recombination deficiency': 4, 'Ig CSR) deficiencies': 1, 'LINKED RECOMBINATIONS': 1, 'rPvCSP': 1, 'Ig class switch recombination deficiencies': 1, 'rmCIRP': 3, 'HRR impairment': 3, 'homologous recombination repair (HRR)-defective': 1, 'V(D)J recombination deficiency': 5, 'MRTs': 1, 'MRT': 1, 'dHRD': 1, '-HRD': 1, 'rAAVs': 3, 'Homologous recombination (': 1, 'RECOMBINANT ACID PHOSPHATASE FROM': 1, 'Immunodeficient recombination activating gene-2': 1, 'homologous recombination deficiency (HRD': 3, 'rTF': 3, 'rPTH': 2, 'Homologous recombination deficit': 2, 'ARI': 6, 'HR-deficient malignancies': 2, 'Homologous recombination deficiencies': 6, 'HR-proficient': 3, 'CRJE': 1, 'CSR-D.': 4, 'Immunoglobulin class-switch recombination deficiency': 1, 'PRESUMED RECOMBINANTS': 1, 'rPR8 infection': 1, 'Homologous recombination (HR)-deficiency': 1, 'Ig-CSR deficiency': 2, 'Ig-CSR deficiency 1': 1, 'Ig-CSR deficiency 2': 1, 'Ig-CSR) deficiencies': 1, 'Ig-CSR deficiencies 3 and 4': 1, 'rhMD-2': 1, 'eARG': 1, 'ACS': 4, 'RHC I': 1, 'RHC III': 1, 'Deficiency of Homologous Recombination Repair': 1, 'rHGSF': 1, 'HD': 1, 'homologous recombination-deficient (HRD) tumors': 8, 'Tumor HRR deficiency': 1, "Luis's": 1, 'recombination-activating gene 1 deficiency': 2, 'RAG-related disorders': 1, 'HRR defect': 3, 'rAAT': 1, 'MECHANISMS OF HR': 1, 'rVS-I': 1, 'rHDM': 1, 'rAMH': 1, 'RAG1 deficient': 1, 'RS': 3, 'cRS SE': 1, 'NI-RIL': 2, 'ZRHC': 1, 'BXD-RI': 1, 'Cre': 2, 'HR-MT': 1, 'rBTI': 2, 'Homologous Recombination Repair (HRR) deficiency': 2, 'rARU': 1, 'GR': 2, 'GR deficiency': 1, 'RAAP': 1, 'RADIATIVE RECOMBINATION': 1, 'NOD.recombination activating gene': 1, 'HRR abnormalities': 3, 'CRFs infected': 1, 'rMR': 1, 'rMR virus': 1, 'RMC': 1, 'homologous DNA recombination deficiency': 1, 'RPESs': 1, 'Neurological Disorders and Stroke recombinant tissue plasminogen activator': 1, 'cCSR': 1, 'homologous recombination proficient (HRP) tumors': 4, 'recombination repair deficiency': 1, 'RTLs': 3, 'HR-L': 1, 'homologous-recombination-deficiency': 4, 'HR deficiency 3': 1, 'RIBA': 3, 'HRP tumor': 3, 'HR+ tumors': 3, 'rVLY': 1, 'RECOMBINANT PROTEIN': 6, 'scAAV': 2, 'SOME RECOMBINATIONAL': 1, 'rec-X': 1, 'FOR RESEARCH INVOLVING RECOMBINANT': 1, 'cell Recombination Excision': 1, 'rOmpF': 1, 'RECOMBINANT ALLERGENS': 1, 'RECOMBINANT HYPOALLERGENS': 1, 'homologous recombination pathway deficiency': 2, 'RAG2 deficiency': 4, 'homologous recombination (HR) deficient': 2, 'recombination deficit': 1, 'V(D)J recombination disorders': 1, 'Immunoglobulin class switch recombination deficiencies': 5, 'MZ-SLP': 1, 'HRDPS': 1, 'Neurological Disorders and Stroke Recombinant Tissue Plasminogen Activator': 3, 'PPV-Rec': 4, 'HDRR': 1, 'SLPMA': 1, 'class switch recombination deficiency': 3, 'Class switch recombination deficiencies': 2, 'CSR-related diseases': 1, 'Begonia lui': 1, 'Homologous-Recombination-Deficiency': 1, 'CRA viruses': 1, 'HRP) tumors': 1, 'homologous recombination (HR)-deficiency': 1, 'rBCG': 3, 'CRFs of HIV-1': 4, 'NON -ALLELIC RECOMBINATION': 1, 'rNE': 1, 'rMD-2': 1, '(HR)': 1, 'homologous recombination-based': 1, 'homologous recombination - deficiency': 1, 'CRF BC': 2, 'CRF AG viruses': 1, 'CRF CD': 1, 'HR repair gene deficiencies': 1, 'rAHF-PFM': 1, 'HRD ID6': 1, 'ORACLE': 1, 'r-hFSH': 1, 'Recombination-activating gene (RAG) deficiency': 1, 'OAGR': 2, 'ROPs': 1, 'ROP': 1, 'LR-PC': 2, 'LR': 4, 'rNDVs': 4, 'HR dysregulation': 2, 'RECOMBINANT FACTOR VIIa': 1, 'in HR': 3, 'CORe': 1, 'RTA': 3, 'rHuEPO deficiency': 1, 'recSIPC': 1, 'recombination in': 1, 'RECOMBINANT SINGLE CHAIN VARIABLE': 1, 'mNUS-RCD': 1, 'HRD-Dup': 2, 'HR deficient 7 tumors': 1, 'recombination activating gene 1': 1, 'NER and HR deficiencies': 1, 'HR-dysfunction': 1, 'HR deficits': 2, 'RECOMBINANT HEMOGLOBIN PROTEINS': 1, 'rFH': 1, 'rHA': 3, 'ML': 2, 'homologue recombination deficiency': 3, 'homologous recombination deficiency (HRD) tumors': 3, 'HRD-tumors': 2, 'Homologous recombination Deficiency': 2, 'Transformation-associated recombination': 2, 'HRD-carcinoma': 1, 'HRD Homologous Recombination Deficiency': 1, 'PRE': 1, 'NRHR': 2, 'ReCS': 1, 'tumor homologous recombination (HR) deficiency': 1, 'Homologous recombination repair (HRR) pathway deficiency': 2, 'rJ.MY135Q': 1, 'rJ': 2, 'rJ.': 1, 'HOTSPOT OF MITOTIC RECOMBINATION': 1, 'rGn': 1, 'hyperactivity of HR': 1, 'rRGNNV': 1, 'RECOMBINANT PROTEIN PRODUCTION': 3, 'UNUSUAL TRAFFICKING BEHAVIOR OF RECOMBINANT PROTEINS': 1, 'IBM RIL': 1, 'pRD': 2, 'class-switch recombination': 1, 'RE': 4, 'homologous recombination deficient carcinoma': 1, 'Homologous recombination deficiencie': 1, 'TPI': 1, 'RIP D': 1, 'RIP A': 1, 'homologous-recombination deficient tumors': 2, 'RECOMBINANT ANTIGENS': 1, 'recombination-related diseases': 1, 'HRDEM': 1, 'RECOMBINANT ADENOVIRUS': 2, 'RAP': 1, 'deficiency of HR-DSB': 1, 'NAHR-ARMD': 1, 'ARMDs': 2, 'NAHR-ARMDs': 1, 'recombinant zoster vaccine': 1, 'RPA-LFD': 1, 'DSDR': 1, 'HR tumors': 1, 'homologous-recombination repair (HRR) deficiency': 1, '-Rec': 1, 'HRR obstruction': 1, 'RECOMBINANT lv': 1, 'RAPID': 1, 'Ig-CSR-D': 1, 'RC-I': 1, 'MMRDR': 2, 'RECOMBINANT ADENOVIRUS VECTORS': 1, 'RECOMBINATION INTERFACE': 1, 'HypR': 1, 'partial recombination activating gene 1 (RAG1) deficiency': 1, 'RAG1/2 deficiency': 3, 'cRSSs': 1, 'UV-INDUCED MITOTIC RECOMBINATION': 1, 'HRR-deficient malignancies': 1, 'SUPPRESSION STRATEGY OF NONRADIATIVE RECOMBINATION': 1, 'seasonal flu recombinant and inactivated': 1, 'HRD-associated disease': 1, 'SLVS': 1, 'rColb-MDs': 1, 'HRd tumors': 2, 'LAHR': 1, 'MECHANISM OF GENETIC RECOMBINATION': 2, 'SFV': 1, 'PT-RIL': 1, 'homologous recombination genetic defects': 1, 'RAG-1 deficiency': 1, 'RIL-D': 1, 'RIL-C': 1, 'RIL-D.': 1, 'rhTE': 2, 'recombinational repair deficiency': 1, 'Homologous Recombination (HR) repair deficiency': 1, 'SSA': 1, 'CURRENT MODELS FOR RECOMBINATION IN': 1, 'homologous recombinational repair deficiency': 1, 'homologous recombination (HR) repair deficiency': 1, 'rHSC70TKD': 1, 'PROTEOMIC CHANGES OF RECOMBINANT YEAST': 1, 'INTRA-H-2 RECOMBINANT': 1, 'deficiency of the HR': 1, 'rMuVs': 1, 'homologous recombination disorders': 1, 'RECOMBINANT T-TYPE CHANNELS': 1, 'RECOMBINATION FREQUENCY PER CHROMOSOME': 1, 'HR deficit': 7, 'type II RTE': 1, 'type IIR RTE': 1, 'Type I RTE': 1, 'IIR RTE': 1, 'HR-MUT': 1, 'rhOMD': 1, 'ELISAS BASED ON RECOMBINANT': 1, 'REcombination': 2, 'Luis Potosi': 1, 'HR-HPV infections': 1, 'HDR deficiency': 1, 'homologous recombination repair-deficient (HRD)': 1, 'TRANSFER OF TAR': 1, 'BXD RI': 3, 'RM': 1, 'rFBD': 1, 'rAD': 1, 'rmHBHA': 1, 'rPLTP': 2, 'homologous recombinant deficiency': 6, 'WRY': 1, 'Homologous Recombination-Deficiency': 1, 'ALLELIC RECOMBINATION': 3, 'homologous recombination (HR) deficient tumors': 4, 'rGel-Mel': 1, 'rN': 4, 'Recombination-activating gene 1': 1, 'homologous recombination-deficiency': 5, 'rCap': 1, 'rPGRN': 1, 'rhFSH': 1, 'rLF': 1, 'MRHC': 3, 'MINIMUM-RECOMBINANT HAPLOTYPE CONFIGURATION': 1, 'recombination activation gene (RAG)-deficient': 1, 'defective homologous recombination': 2, 'Recombinant chromosome 8 syndrome': 2, 'HRm': 1, 'gHRm': 1, 'CRF 19_cpx': 1, 'homologous recombination deficient (HRD) carcinoma': 3, 'BXD ARI': 1, 'EVIDENCE OF SUPPRESSED RECOMBINATION WITHIN LARGE LD': 1, '-ReCS': 2, 'CRFs 01, 02, 06, 11': 1, 'RECOMBINANT FACTOR CONCENTRATES': 1, 'Homologous recombination (HR)-deficient': 1, 'impaired HR': 2, 'rNDPKs': 1, 'class-switch recombination (CSR) deficiencies': 1, 'rPP': 2, 'LUIs': 1, 'ROLE OF RECOMBINANT FACTOR': 1, 'CRFs B/F1': 1, 'CRFs B/C': 1, 'Meiotic Recombination Defects': 1, 'RCL': 1, 'HRD-EXCUTE': 1, 'HRD-EXCTUTE': 1, 'rTNC': 1, 'Homologous-recombination deficiency': 6, 'HRD-S': 1, 'recombination-deficiency': 2, 'RECOMBINANT COLLAGEN SCAFFOLDS': 1, 'SIB RILs': 1, 'defects of CSR': 1, 'RAG2-deficiency': 1, '3homologous recombination deficiency': 1, 'LABELING OF RECOMBINANT PROTEINS': 1, 'HRD+': 5, 'homologous recombination repair (HR) deficiency': 3, 'tumor homologous recombination': 1, 'SLRC': 1, 'rNMB': 1, 'RAIL': 1, 'deficiencies in homologous recombination': 1, 'RECOMBINANT HIV-1': 1, 'HR factors': 1, 'HR Repair Deficiency': 1, 'HR-defect': 3, 'ST-RILs': 1, 'rLACVs': 1, 'HRD-associated tumors': 2, 'Deficiency in HRR': 3, 'GBM.rec': 2, 'THEIR RECOMBINATION PRODUCTS': 1, 'RECOMBINATIONAL': 6, 'specific meiotic recombination defects': 1, 'Loss of Heterozygosity-Homologous Recombination Deficiency': 1, 'SAR': 3, 'RAG-deficiency': 2, 'rHNE': 1, 'CO': 2, 'rLDP': 1, 'rLDP-AE': 1, 'recN9': 1, 'recombination repair': 2, 'rJ infection': 1, 'COP-RIL': 1, 'HRR-': 2, 'RVS': 2, 'NMRIL': 1, 'rMVAs': 1, 'RAG-1': 1, 'Hyper-recombination': 1, 'deficiency of homologous recombination repair': 1, 'WT': 1, 'Recombination Repair Deficiency': 2, 'MEIOTIC RECOMBINATION IN': 1, 'rHlFERs': 1, 'RECOMBINANT PLASMIDS': 1, 'MRC': 1, 'RCP': 1, 'HR proficient tumors': 1, 'Luis A Coloma': 1, 'ReMB': 1, 'PART-O': 6, 'EVALUATION OF GENE RECOMBINATION': 1, 'RAGD': 1, 'RHEpo': 1, 'rAOAH': 1, 'RECOMBINANT VLPs': 1, 'Homologous Recombination deficiency': 4, 'TRP': 1, 'transcription-associated recombination': 3, 'Non-Homologous Recombination Deficiency': 1, 'HRD carcinomas': 3, 'EFFECT OF RECOMBINANT': 2, 'recombination activating gene 1 or 2 deficiency': 1, 'HRp tumors': 1, 'OTHER FORMS OF BEHAVIOR WITH RECOMBINANT MICE': 1, 'or HR': 1, 'RIL-ZD': 1, 'ARMD': 6, 'HETEROGENEITY OF RECOMBINATION': 1, 'HR Impairment': 1, 'CRF candidate 1': 1, 'rMOMP- c.l': 1, 'rMOMP-': 1, 'rMOMP-c.l': 1, 'rbST': 1, 'SCREENING OF RECOMBINANT VIRUS': 1, 'RECOMBINATION EVENTS': 3, 'LFK': 1, 'San Luis': 1, 'CRE': 1, 'CREATES RECOMBINATION': 1, 'Deficiency of HR': 1, 'conducente - lui': 1, 'insegnante-lui': 1, 'pensionato - lui': 1, 'insegnante - lui': 1, 'lei lui lei lui lei lui': 1, 'FEM - lui': 1, 'passeggera - lui': 1, 'conducente-lui': 1, 'SPECIALIZED FUNCTIONS OF HR': 1, 'ARF': 1, 'PML': 1, 'RMCE ES': 1, 'HR deficient malignancies': 1, 'AMGT': 1, 'HRR)': 1, 'RCSLs': 1, 'HNR': 1, 'RECOMBINANT EXPRESSION': 2, 'RRMI': 1, 'deficiency of HR repair': 1, 'rHSA-LR': 1, 'recombination (': 3, 'rYN': 1, 'seasonal influenza rHA': 1, 'CSR-deficient': 2, 'Switch Recombination Deficiencies': 1, 'CSR Defects': 1, 'CSR-defects': 1, 'CSR-deficiencies': 1, 'NRR': 3, 'Recombination Defects': 1, 'AMR': 1, 'rIAV': 1, '-RSS': 1, 'homologous recombination repair deficient tumors': 2, 'Rec8 syndrome': 2, 'recombinant chromosome 8 (Rec8) syndrome': 1, 'RECOMBINANT ANTI-INFLUENZA': 1, 'RCNILs': 1, 'Defects in HR': 3, 'prTE': 1, 'HR non-deficient': 1, 'HR pathway deficiencies': 1, 'GENERATION OF RECOMBINANT': 3, 'PNHR': 1, 'nickHR': 1, 'Homologous recombination defect': 3, 'HGSOC HR deficiency': 1, 'HR proficient or': 1, 'HRD defects': 2, 'recombination activating gene-1 deficiency': 1, 'INACTIVATED RECOMBINANT FACTOR VIIa': 1, 'rc-TGL': 1, 'HR defective (HRD) tumors': 1, 'VARIABLE RECOMBINATION': 1, 'LARGE RECOMBINANT': 1, 'Ig class switch recombination (CSR) deficiencies': 2, 'Ig CSR deficiency': 1, 'Immunoglobulin class switch recombination (CSR) deficiencies': 1, 'class switch recombination deficiencies': 1, 'mutHR tumors': 1, 'rrSCF': 1, 'rPHO': 1, 'HRU': 1, 'homologous recombination deficient (HRD)-tumors': 1, 'rec (3) syndrome': 1, 'rORFVs': 1, 'rHVT-F': 1, 'rPDA': 1, 'THE RIL': 1, 'RLP': 1, 'Demande-lui': 1, 'GENOME RECOMBINATION': 1, 'Homologous recombination deficient (HRD) tumors': 1, 'aut-rec': 1, 'homologous recombination repair proficient (HRP) tumors': 1, 'recombination activation gene (RAG) deficiency': 1, 'IRIL': 2, 'r-Moj-MN': 1, 'r-Moj-MP': 1, 'ICL': 1, 'RECOMBINANT INTERFERON- alpha2b': 1, 'RMP': 1, 'rCRT': 1, 'rRBD': 1, 'rEC-SOD': 1, 'CRF-B/C.': 1, 'HRD-H': 1, 'LM RIL': 1, 'rMCC': 1, 'NRRCs': 1, 'homologous recombinant repair pathway deficiency': 1, 'RAG-': 2, 'SoyNAM RIL': 1, 'rJ2.2': 1, 'CPE-E9-G4S-R9-rGel': 1, 'HRI tumors': 1, 'HRI': 2, 'deficiencies in HR': 3, 'HR-deficient (HRD) carcinomas': 2, 'RECAP Tumor': 1, 'rADI': 1, 'Homologous-recombination-deficient (HRD) tumors': 1, 'rh-UTI': 1, 'nonobese diabetic recombination activating': 1, 'Nonobese diabetic recombination activating': 1, 'impairment of HR': 1, 'rEPO': 1, 'deoxyribonucleic acid (DNA) homologous recombination repair deficiency': 1, 'correct to homologous recombination repair (HRR) deficiency': 1, 'rVACVs': 1, 'FIRRM': 1, 'homologous recombination- (HR-) deficient': 1, 'Homologous Deficient Recombination deficiency': 1, 'RECOMBINANT HUMAN': 3, 'RIL MO038': 1, 'HR-GE': 1, 'rHNC': 1, 'rRVs': 1, 'RPYD': 1, 'AHR': 2, 'PURIFICATION OF RECOMBINANT': 2, 'deficiency in CSR': 2, '-homologous recombination deficiency': 1, 'RECOMBINANT PRODUCTION OF ANAC089 PROTEIN': 1, 'Switch Recombination': 1, 'RIL POPULATIONS': 1, 'RIL POPULATION SIZE': 1, 'BETWEEN RIL': 1, 'RECOMBINANT ANTI-IgE': 1, 'RDFs': 1, 'rDIP': 1, 'AUTOMATION OF HIGH-THROUGHPUT RECOMBINANT PROTEIN': 1, 'HRR genetic abnormalities': 1, 'IHSR': 1, 'HFR': 1, 'HIGH FREQUENCY OF RECOMBINATION': 1, 'PURIFIED RECOMBINANT APO(a': 1, '1b CRF': 1, 'Homologous recombination proficient (HRP) tumors': 1, 'recombination (HR)': 3, 'INITIATION OF MEIOTIC RECOMBINATION': 1, 'RECOMBINANT HYPOALLERGENIC MOLECULES': 1, 'RECOMBINANT N9 PROTEINS': 1, 'HRR Deficiency': 1, 'homologous recombinant': 3, 'RVP': 1, 'tumor HR deficiency': 2, 'CRLs': 1, 'PHI': 1, 'rEpo': 1, 'recombination-': 1, 'congenital luis': 1, 'rMA15 infection': 1, 'rMA15': 1, 'rMA15 disease': 1, 'IGHR': 1, 'RJHM infection': 1, 'INHIBITION OF RECOMBINATION BY': 1, 'rFL HA': 1, 'RECOMBINANT ADENO-ASSOCIATED VIRUS': 1, 'BIPARENTAL MOLECULAR RECOMBINATION': 1, 'Immunoglobulin (Ig) class switch recombination (CSR) deficiencies': 1, 'homologous recombination genetic deficiencies': 1, 'RHE': 1, 'inflammatory RHE': 1, 'homologous recombination gene deficiency': 2, 'or homologous recombination deficient': 1, 'RIL-L': 1, 'luis': 2, 'recombinational deficiencies': 1, 'che lui': 1, 'aspetto che lui': 1, 'Homologous recombination repair (HR) deficiency': 2, 'SEXUAL RECOMBINATION': 1, 'EFFECTS OF SEXUAL RECOMBINATION': 1, 'HRR deficient tumors': 1, 'rLCMV': 1, 'Dysfunction of homologous recombination': 1, 'CC RIL': 1, 'CT RIL': 1, 'HRR-deficiencies': 1, 'NSRS': 1, 'HRD-Del': 1, 'Recombinant 8 syndrome': 3, 'CSR-N': 1, 'CSR-N.': 1, 'HGR': 1, 'HRP-positive': 1, 'AVIAN RECOMBINANT': 1, 'SPECIFIC RECOMBINATION OF': 1, 'Homologous Recombination Deficiencies': 3, 'rec(4)parental syndrome': 1, 'rPVPs': 1, 'RECOMBINATION BY': 1, 'RECOMBINATION INITIATION': 1, 'homologous recombination abnormalities': 1, 'TBR': 1, 'recN': 1, 'ISR-C': 1, 'IRP': 1, 'POPULATION RECOMBINATION DYNAMICS': 1, 'homologous recombination deficiency tumors': 1, 'rTE': 1, 'IUMS.rec': 1, 'NsT-RIL': 1, 'S-RILs': 1, 'R-RILs': 1, 'homologuous recombination deficiency': 1, 'homologous recombination-deficient (HRD)': 1, 'RECOMBINATION SUPPRESSION': 1, 'recombination activating genes (RAG) disorders': 1, 'RAG Deficiencies': 1, 'hypomorphic recombination-activating gene': 1, '-rRI': 1, 'IRILs': 2, 'MEIOTIC RECOMBINATION TRACT LENGTH': 1, 'PRDM9-INDEPENDENT RECOMBINATION': 1, 'RECOMBINANT VIRUS': 1, '-SAR': 1, 'mitotic recombination defect': 1, 'RECOMBINATIONAL LETHALS': 1, 'RHC': 3, 'X-linked CSR-D': 1, 'class-switch recombination deficiency': 1, 'switch recombination': 1, 'immunoglobulin class-switch recombination deficiencies': 1, 'Ig-CSR-Ds': 1, 'Immunoglobulin class-switch recombination deficiencies': 1, 'RN': 1, 'gHRD': 1, 'transcriptional HRD': 1, 'gHRD- tumors': 1, 'tHRD': 1, 'HRD+ tumors': 3, 'THEIR RECOMBINATIONS': 1, 'homologous recombination (HR)/Fanconi pathway deficiency': 1, 'GENETIC RECOMBINATIONS': 3, 'CS-RHCMA': 1, 'RHCMA': 1, 'RECs tumors': 1, 'RIBT': 1, 'San Luis Valley recombinant chromosome 8': 1, 'San Luis Valley Recombinant Chromosome 8': 1, 'multiple homologous recombination (HR) deficiency tumors': 1, 'CRFs of HIV': 1, 'RFs': 1, '(HRR': 2, 'HRD diseases': 2, 'rGIII': 1, 'RECOMBINANT ANTIGEN': 1, 'RECOMBINANT RETROVIRUSES': 1, 'RREC': 1, 'rhAm': 1, 'HR-deficient neoplasms': 2, 'HR repair-deficient': 1, 'HR DNA': 1, 'homologous recombination (HR)-defective': 1, 'GRR': 1, 'RH': 1, 'rTEV': 1, 'HRR-deficient disease': 1, 'HRD.64': 1, 'CRFs-': 1, 'rLvSWD-WAP': 1, 'RECOMBINANT ENGINEERED FOOD PROTEINS': 1, 'HR DNA damage': 1, 'rgD': 1, 'RECOMBINANT ANTIBODY': 1, 'HR recombination deficiency': 1, 'HR recombination': 1, 'homologous recombination deficient malignancies': 1, 'SPECIFIC RECOMBINATION': 2, 'rVIIa': 2, 'HR-d': 2, 'or homologous recombination (HR)-deficient': 1, 'FRP': 1, 'AR-CSR': 1, 'CSR/': 1, 'SLOH': 1, 'homologous recombination repair (HRR)-deficient tumors': 1, 'homologous recombination deficiency (HRD) carcinomas': 1, 'homologous recombination deficient carcinomas': 1, 'fHR': 1, 'fHRD': 1, 'fHRD tumors': 1, 'RIL disease': 2, 'RECOMBINANT ANTIGEN SYNTHESIS': 1, 'Homologous Recombination Repair': 1, 'HRD-MILN': 1, 'rec-tal': 1, 'Rec-1 disease': 1, 'homologous recombination repair (HR': 1, 'RAG diseases': 1, 'ruPAR': 1, 'Homologous Recombination Defect': 1, 'LARD': 1, 'pRD-': 1, 'pRD-CID': 1, 'pRD-N': 1, 'partial recombination-activating gene (RAG) deficiency': 1, 'Recombination Deficiency Poliovirus': 1, 'rND1': 1, 'lui donnera raison': 1, 'DNA Double-Strand Breaks and Homologous Recombination (HR) Deficiency': 1, 'HR/DSBR (double strand break repair) deficiency': 1, 'FRUIT': 1, 'ROLES OF RECOMBINATION': 1, 'RAG1/2': 1, 'RAG1/2 deficiencies': 1, 'recombination activating gene 1/2': 1, 'RAG-2 deficiency': 1, 'LIPS-NIE': 1, 'HRD + tumors': 1, 'HRC': 1, 'HeR': 3, 'recombination (HR': 1, 'NSL': 2, 'Homology Recombination Deficiency': 1, 'RECOMBINANT VECTORS': 2, 'rNTD': 1, 'HR deficiency.7': 1, 'RC-LE hanging': 1, 'dHR': 2, '-recombination deficiency': 1, 'RECOMBINANT ADENOVIRAL': 1, 'Maiestas trispinosa n. rec': 1, 'r-HLH': 1, 'Cryptic RS': 1, 'CHORD HR deficiency': 1, 'recombination binding protein Jkappa': 1, 'HRR-CIN': 1, 'adeno-hepatitis recombinant': 1, 'rHVT': 1, '-RIL': 1, 'RICLs': 3, 'AS': 1, 'ZRA': 1, 'RECOMBINANT BONE MORPHOGENETIC PROTEIN': 1, 'RAGs': 2, 'recombination-deficient tumors': 1, 'V(D)J Recombination Defects': 1, 'recombination dysfunction': 1, 'LRDs': 1, 'betaERKO': 1, 'Ascochyta blight RIL': 1, 'homologous recombination repair deficiency.9': 1, 'HRRmut': 1, 'HRD) defects': 1, 'Homologous recombination deficiency (': 1, 'ACG': 1, 'X-linked recombination-defective': 1, 'HEMOGLOBIN RECOMBINATION': 1, 'RECOMBINATION CONSTRAIN NEUTRAL DIVERGENCE': 1, 'recIAPP': 1, 'recIAPP+C': 1, 'Re-KL': 1, 'RMN': 1, 'rCan': 1, 'iRSS': 1, 'RECOMBINANT SENDAI VIRUS VECTORS': 1, 'deficient in HR': 1, 'homology recombination deficiency': 2, 'INTERALLELIC RECOMBINATION': 2, 'RPS tumors': 1, 'RCS-10': 1, 'DDM Homolgous Recombination Deficiency': 1, 'rPR3': 1, 'Recombination-': 1, 'SLS': 1, 'HR (homologous recombination) deficient': 1, 'Homologous recombination pathway deficient (HRD) tumors': 1, 'HR-RMS': 1, 'rOka': 1, 'reqSC': 1, 'Homologous Recombination Deficiency (HRD) tumors': 2, 'non-allelic homologous recombination (NAHR) syndromes': 1, 'HR-repair deficiency': 1, 'rMS': 2, 'HOMOLOGOUS_RECOMBINATION': 3, 'SSDR': 1, 'hLIF': 1, 'HRD-positive tumors': 1, 'Homologous recombination deficiency (HRD)-positive tumors': 1, 'HR proficient (HRP) tumors': 1, 'SDR': 1, 'homologous recombination deficency': 1, 'THE INDUCTION OF MITOTIC RECOMBINATION': 1, 'Neopanorpa lui Chou': 1, 'RAG 1/2 Deficiency': 1, 'Recombination activating genes (RAG) 1/2 deficiency': 1, 'GWRR': 1, 'BRIL': 4, 'rMePUL': 1, 'RECOMBINATION PROTEIN RMUC': 1, 'RECOMBINATION REGULATOR': 1, 'RID': 1, 'pLIF': 1, 'MITOTIC RECOMBINATION': 1, 'HGS': 1, '2N-HGS': 1, '2N2Q-HGS': 1, 'ESTIMATING RECOMBINATION RATE': 1, 'rfVIIa': 2, 'CSR to IgE': 1, 'LRN': 1, 'NOBMP': 1, 'B-19 RIL': 1, 'P/B-19 RIL': 1, 'homologous-recombination (HR) deficiency': 1, 'Luis lang carcinoma': 1, 'rDIII': 1, 'Oligo-rec': 1, 'RECOMBINANT STRATEGIES OF INTEREST': 1, 'PPV Rec': 1, 'rHLF': 1, 'IMPACT OF RECOMBINANT': 1, 'PRIMVAC': 1, 'deficiency in HRR': 1, 'rIT': 1, 'RECOMBINANT FACTOR VIIA': 1, 'rhPTH': 2, 'recombination-activating gene deficiency': 1, 'HeR.': 1, 'Recombinant 4 syndrome': 2, 'recombinant 4 syndrome': 1, 'hrLIF': 1, 'mCRISTAR': 1, 'HR-mediated repair deficiency': 1, 'rLC-TD/A': 1, 'Col/Ler RILs': 1, 'HRR gene deficiencies': 1, 'TC-HR': 1, 'X-RAY INDUCED MITOTIC RECOMBINATION': 1, 'Recombinant activating gene (RAG)1 deficiency': 1, 'HRR Deficiencies': 1, 'homologous-recombination-repair': 1, 'LST': 1, 'HRD-LST': 1, 'LOH': 1, 'HRD-TAI': 1, 'homologous recombination repair (HRR) deficient': 2, 'HUMAN RECOMBINANT': 1, 'recombination (HR) deficiency': 2, 'HRD) disease': 1, 'NHL of RILs': 1, 'EREC': 1, 'Swarna RIL': 1, 'SCREENING RECOMBINANT': 1, "B'/C CRFs": 1, 'BF1 CRFs': 1, 'ROLE OF RECOMBINANT': 1, 'immunoglobulin class-switch recombination (Ig-CSR) deficiencies': 1, 'RECOMBINATION DEFICIENCY': 1, 'MR.IMPORTANCE': 1, 'ENGINEERED RECOMBINATIONS': 1, 'RECOMBINANT FRUTALIN': 1, 'PRODUCTION OF RECOMBINANT FRUTALIN': 1, 'sufletului lui': 1, 'DELOCALISED RECOMBINATION': 1, 'homologous recombination (HR) repair pathway deficiencies': 1, "Luis's neurological symptoms": 1, 'OM': 1, 'Homologues recombination deficiency': 1, 'NRB': 1, 'RECOMBINATION OF ALLELIC CYSTEINE': 1, 'HR-WT tumours': 1, 'HR-WT': 1, 'GB13 RIL': 1, 'homologous recombination repair (HRR) pathway deficiency': 2, 'IRIs': 1, 'Sleep-TRAP': 1, 'HR gene deficiencies': 1, 'HR gene deficiency': 1, 'homologous recombinant (HR)-deficient': 1, 'PATRIOT': 1, 'MTVrec': 1, 'MakMN RIL': 1, 'inherited immunoglobulin class-switch recombination deficiency': 1, 'Immunoglobulin class-switch recombination defects': 1, 'CSR-Ds': 1, 'Immunoglobulin CSR defects': 1, 'RECOMBINATION SYSTEMS': 1, 'homologous recombination repair disorders': 1, 'rEV': 1, 'H-HRD': 1, 'NRY': 1, 'SLA': 1, 'GEMINATE RECOMBINATION': 1, 'abnormalities in HR': 1, 'homologous recombination repair (HRR)': 2, '-strand break-induced recombination': 1, 'DSBR': 1, 'ABERRANT RECOMBINATION': 1, 'Tennis Rec': 1, 'rAPSE': 1, 'RECOMBINANT EXPRESSION OF COLLAGEN IV': 1, 'RPs': 1, 'HR-GT': 1, 'MRE11 associated diseases': 1, 'SCREENING OF RECOMBINANT': 1, 'RECOMBINEERING WITH': 1, 'SCREENING FOR OLIGO RECOMBINANTS': 1, 'SCREENING FOR UNSELECTED RECOMBINANTS': 1, 'FOLLOWING RECOMBINEERING': 1, 'RECOMBINEERING PLASMIDS CONTAINING': 1, 'SCREENING FOR UNSELECTED PLASMID RECOMBINANTS': 1, 'CANONICAL ROLE OF RAG PROTEINS': 1, 'FA/HR deficiencies': 1, 'RECombinations': 1, '-RECs': 1, 'rcIL': 1, 'insufficiency of autonomic recativity': 1, 'LXS RI': 1, 'homology recombination': 1, 'RAM': 3, 'homologous recombination (HR) deficient malignancies': 1, 'HRmu': 1, 'rhIDE': 1, 'HRDCNA': 1, 'rCedPV': 1, 'IMMUNOGENIC RECOMBINANT PROTEINS': 1, 'MRD': 1, 'dHRR': 1, 'deficiency of homologous recombination repair system': 1, 'HURDLES OF RECOMBINANT ADENO-ASSOCIATED': 1, 'rLCN2': 2, 'SGR': 1, 'CSR abnormality': 1, 'CRFs-BF': 1, 'CHROMOSOMES AFTER RECOMBINATION SUPPRESSION': 1, 'V(D)J recombination deficiencies': 1, 'HRP:11.3': 1, 'class switch recombination defect': 1, 'S-HRD tumors': 1, 'rSLH': 1, 'rSSps': 1, 'V(D)J Recombination Disorders': 1, 'rCU': 1, 'rCedV-Luc': 1, 'impaired homologous recombination': 1, 'STOICHIOMETRY OF TEMPLATE-DIRECTED RECOMBINANT': 1, 'RECOMBINANT SALMONELLA': 1, 'cRSS': 1, 'ER': 1, 'recombinant 4': 1, 'CRF02-AG': 1, 'SRS': 1, 'Luis Borderias': 1, 'YEAST RECOMBINATIONAL SYSTEM': 1, 'URF viruses': 1, 'rec(8)': 1, '8[Rec(8)] syndrome': 1, 'Rec(8)': 1, 'NLL RIL': 1, 'of homologous recombination': 2, 'LD-BASED RECOMBINATION MAPS': 1, 'T cell deficient recombination activating protein 1': 1, 'MOLECULAR MECHANISM OF GENETIC RECOMBINATION': 2, 'RWARA-ZR': 1, 'Homologous-recombination-repair deficiency': 1, 'RECOMBINANT AAV': 1, 'RECOMBINANT PROBIOTIC TO': 1, 'DNA recombination deficiencies': 1, 'rBCG-infected': 1, 'J-RS': 1, 'rAAV-': 1, 'HoRReR': 1, 'CRF 02_AG%': 1, 'PUTATIVE RECOMBINATION INITIATION DEFECTS 2': 1, 'RSP': 1, 'Rec-mas': 1, 'Rec-': 1, 'homozygous recombination deficiency': 1, 'rHCI': 1, 'homologous recombination-deficient (HRD': 1, 'rRSVs': 1, 'RECOMBINATION QUARTILE': 1, 'Immunoglobulin class switch recombination deficiency type 1': 1, 'rPADI4': 1, 'ITMI RIL': 1, 'rCVN': 2, 'inborn errors of recombination': 1, 'SLV potato': 1, 'rMD': 1, 'Tumor HRD': 1, 'tumors with homologous recombination (HR) deficiency': 1, 'PLAQUE-TYPE RECOMBINATION': 1, 'recNP': 1, '(CRFs) infections': 1, 'CRFs) infections': 1, 'POLYMERASE CHAIN REACTION (PCR)-BASED RECOMBINATION': 1, 'EFFICIENT RECOMBINATION': 1, 'Rec-Obst': 1, 'Col/Rec': 1, 'Ht-REC': 1, 'SCAR': 1, 'deficiencies in CSR': 1, 'San Luis Valley [SLV] syndrome': 1, 'Recombinant chromosome 8 (Rec8) syndrome': 1, 'HDR SSA': 1, 'sporadic abnormalities in the HR': 1, 'tumour-specific homologous recombination (HR) deficiency 7, 8': 1, 'rMIH': 1, 'AR infections': 1, 'RAG ("recombination activating genes"': 1, 'RAG-deficiencies': 1, 'homologous recombination deficiency(HRD) tumors': 1, 'HR repair-deficient tumors': 1, 'RECAP-HRD tumors': 1, 'RECAP-': 1, 'RECAP-HRI': 1, 'MECHANISM OF HOMOLOGOUS RECOMBINATION': 1, 'RECOMBINATION -': 1, 'homologous recombination-deficient tumor': 1, 'HRD-deficient malignancies': 1, 'rEgCaM': 1, 'PREPARATIONS OF RECOMBINANT': 1, 'PUTATIVE RECOMBINATION SITES': 1, 'PrEST': 1, 'recombination gene deficiency': 1, 'ISRC': 1, 'rGOD': 2, 'TARGETING HR DEFICIENCY WITH': 1, 'recombination activation gene (RAG)1/2 deficiency': 1, 'QUADRIVALENT RECOMBINANT': 1, 'deficiencies of the homologous recombination': 1, 'B/C CRFs': 1, 'HIV CRFs': 1, 'rnGSDMD': 1, 'ECTOPIC OSTEOGENESIS EVALUATION OF RECOMBINANT HUMAN': 1, 'rJosiah': 1, 'EFFECTS ON SOMATIC RECOMBINATION': 1, 'CELLS ENGINEERED TO EXPRESS RECOMBINANT': 1, 'HR-d.': 1, 'HR-d tumors': 1, 'tumors deficient in HR repair': 1, 'CI/3R': 1, 'rhTPO': 3, 'RECOMBINATION SPOTS': 1, 'RECOMBINATION SITES': 1, 'RIPEs': 1, 'CRF 2k/1b': 1, 'rILT': 1, 'PART-S': 1, 'BCRIL': 1, 'Homologous recombination-deficient': 1, 'MIL': 1, 'rAbCTLD': 1, 'CHARACTERISTICS OF RF RECOMBINANTS': 1, 'homologous-recombination (HR)': 1, 'RECOMBINANT-BASED INNOVATIONS': 1, 'GENETIC RECOMBINATION BETWEEN RELATED INFLUENZA': 1, 'HRD gene deficiency': 1, 'AM RILs': 1, 'AM RIL': 3, 'rTLM': 1, 'Homologous recombination repair protein deficiency': 1, 'RECOMBINEERING TO NON-MODEL MICROORGANISMS': 1, 'ssDNA-RECOMBINEERING': 1, 'class-switch recombination defects': 1, 'recombination-activating gene-2': 1, 'HR hyperactivity': 1, 'FRIP': 1, 'of Homologous Recombination Deficiency': 2, 'Recombination Abnormalities': 1, 'CRC': 1, 'rmhTNF': 1, 'RS-SCID': 1, 'HR-related deficiency': 1, 'nrTW I infections': 1, 'nrTW I infection': 1, 'nrTW I': 1, 'NRP': 1, 'RQI': 1, 'recombination deficient tumors': 1, 'Tums.vcr.rec': 1, 'RECOMBINATION ON': 1, 'recombinant coronaviruses': 1, 'homologous recombination-deficient malignancy': 1, 'HTZ': 1, 'CONSTRUCTION OF RECOMBINANT PLASMIDS': 1, 'RECOMBINANT BACILLUS CALMETTE-GUERIN': 1, 'rVDAC': 1, 'homologous recombinant repair': 1, 'Homozygous Recombination Deficiency': 1, 'recombination activating gene 1,2 deficiency': 1, 'HRR-proficient': 1, 'Hypoxic suppression of HR': 1, 'Rec Q abnormalities': 1, 'Recombination-activating gene (RAG) 1 and 2 deficiency': 1, 'rSCoVN': 1, 'rCFES': 1, 'CSR-': 1, 'ICR': 1, 'HRD abnormalities': 1, 'CSR abnormalities': 1, 'SHAPE OF THREE-BODY RECOMBINATION': 1, 'RESONANT THREE-BODY RECOMBINATION': 1, 'RECOMBINANT COLONIES': 1, 'HR Defects': 1, 'FOR RECOMBINEERING': 1, 'RECOMBINEERING-READY CELLS': 2, 'homologous recombination repair pathway deficiency': 1, 'rCLU': 1, 'homologous recombinant repair (HRR) disorders': 1, 'NIRD': 1, 'RECOMBINANT PROTEIN STUDIES': 1, 'homologous-recombination-deficient carcinoma': 1, 'NAHR-mediated genomic disorders': 1, 'rTau': 1, 'mpRILs': 1, 'mpRIL': 1, 'synaptic and recombination abnormalities': 1, 'Synaptic and recombination abnormalities': 1, 'CORRELATED AMONG RECOMBINATION': 1, 'RECOMBINATION GENE EVOLUTION': 1, 'RECOMBINATION GENES DISPLAY': 1, 'RECOMBINATION GENES': 1, 'recombination-activating gene 1 or 2 deficiency': 1, 'Homologous recombination deficiency ECM': 1, 'rAPC': 1, 'HFIR': 1, 'RC-IIFA': 1, 'BaGTA-MEDIATED RECOMBINATION': 1, 'rTCS': 1, 'rEPM': 1, 'HR repair': 1, 'I. lui': 1, 'RL': 1, 'RECOMBINATION DURING': 1, 'RECOMBINATION DURING DSB REPAIR DRIVES REPEAT INSTABILITY': 1, 'Hispanic rec(8) syndrome': 1, 'rec(8) dup(': 1, 'PRODUCTION OF COLICINE BY RECOMBINATION PRODUCED': 1, 'recombinant activating gene (RAG) deficiency': 1, 'NM': 1, 'Homologous recombination repair (HRR': 1, 'recombinant insulin allergy': 1, 'HRD-deficient tumors': 1, 'Homologous-recombination-deficient tumors': 1, 'CHORD HRD': 1, 'Ir.ssu.medicine.rec.1396.26': 1, 'dHR tumors': 1, 'pHR': 1, 'PRM': 1, 'rMVA': 1, 'SRMR': 1, 'HRD VUS': 1, 'Homologous Recombination Deficient': 1, 'rCV-N': 1, 'rCV-N.': 1, 'Homologous Recombination-Deficient Tumors': 1, 'rDWV': 1, 'Luis AN': 1, 'recombination abnormality': 1, 'HRGs': 1, 'PARI-deficient': 1, 'Homologous recombination (HR) deficiencies': 1, '115-RI': 1, 'CSR defective': 1, 'homologous recombination-defective': 1, 'Homologous recombination-defective (HRD) cancers': 1, 'rmLCN2': 1, 'RAd-FTS': 1, 'rTCR': 1, 'IVRR': 1, 'R-BSX': 1, 'RIL-6': 1, 'L-mRCP': 1, 'S-mRCP': 1, 'HRD- tumors': 1, 'rMDVs': 1, 'MEIOTIC RECOMBINATION PROTEIN': 1, 'ARILs': 1, 'BB RIL': 1, 'rSap2-parapsilosis': 1, 'rhLIF': 1, 'RECOMBINATION CONTRIBUTES': 1, 'RECOMBINATION MAPS': 1, 'HRD homologous recombination deficient': 1, 'NRR 19': 1, 'NRRs': 1, 'HRR Defect': 1, 'homologous recombination disorder': 1, 'HRR-Deficiency': 1, 'homolgous recombination deficiency': 1, 'BRCAness and Homologous Recombination Deficiency': 1, 'HRD Deficiency': 1, 'tHRR': 1, 'HRRwt': 1, 'HRRmt': 1, 'tumor HRR': 1, 'HRD homologous-recombination deficiency': 1, 'rec (4) syndrome': 1, 'rec (4)': 1, 'recombinant (4) syndrome': 1, 'Rec (4) syndrome': 1, 'recombinant (4)': 1, 'rec 4 syndrome': 1, 'R-hc': 1, 'RECOMBINATION-ACTIVATING GENES': 1, 'HR and HR deficiency': 1}
|
HR
|
Disease
|
MESH:C535297
|
{'Laryngeal papillomas': 49, 'laryngeal papilloma': 404, 'respiratory papillomatosis': 1380, 'Respiratory Papillomatosis': 144, 'Laryngotracheal Recurrent Papillomatosis': 1, 'RRP': 629, 'laryngeal papillomas': 414, 'laryngeal respiratory papillomatosis': 2, 'Respiratory papillomatosis': 43, 'recurrent respiratory papillomatosis': 290, 'adult onset recurrent respiratory papillomatosis': 1, 'Recurrent respiratory papillomatosis': 165, 'juvenile onset recurrent respiratory papillomatosis': 6, 'JORRP': 75, 'Recurrent Respiratory Papillomatosis': 60, 'recurrent papillomatosis': 6, 'tracheal or laryngeal papillomas': 2, 'Malignant degeneration of laryngeal papilloma': 1, 'juvenile respiratory papillomatosis': 27, 'JRP': 4, 'laryngeal and tracheal papillomas': 4, 'papillomatosis of lung': 1, 'oropharyngeal and laryngeal papillomas': 1, 'AO-RRP': 10, 'juvenile-onset RRP': 10, '-onset RRP': 9, 'JO-RRP': 16, 'Juvenile laryngeal papilloma': 9, 'pulmonary papillomatosis': 18, 'RRP disease': 30, 'RRP lesions': 28, 'LP': 16, 'Laryngeal papilloma': 66, 'respiratory papillomatosis lesions': 4, 'malignant laryngeal papilloma': 1, 'recurrent respiratory papillomas': 6, 'recurrent respiratory papilloma': 7, 'juvenile recurrent respiratory papillomatosis': 21, 'glottic respiratory papillomatosis': 1, 'benign laryngeal papillomas': 14, 'JRRP': 20, 'juvenile-onset recurrent respiratory papillomatosis': 22, 'Respiratory Papillomatosis MesotheliomaAdenocarcinomaSquamous cell carcinomaPancoast tumor': 1, 'recurrent laryngeal/respiratory papillomatosis': 1, 'juvenile- and adult-onset RRP': 1, 'AoRRP': 8, 'JoRRP': 29, 'RRP infections': 2, 'RRP Disease': 2, 'respiratory and laryngeal papillomatosis': 2, 'JLP': 5, 'juvenile laryngeal papilloma': 16, 'respiratory papillomatosis (': 4, 'RRP) lesions': 3, 'anal, head and neck, penile, and RRP diseases': 1, 'Respiratory Papillomatosi': 1, 'RP': 7, 'Congenital juvenile respiratory papillomatosis': 1, 'congenital juvenile respiratory papillomatosis': 1, 'Pulmonary papillomatosis': 8, 'pharyngeal and laryngeal papilloma': 1, 'juvenile laryngeal papillomas': 7, 'AORRP': 18, 'adult-onset RRP': 3, 'RRP tumor': 2, 'recurrent laryngeal papilloma': 12, 'adult laryngeal papilloma': 1, 'RRP LMS': 1, 'tracheal or laryngeal papilloma': 1, 'juvenile-onset recurrent oral and respiratory papillomatosis': 1, 'hypopharyngeal, oesophageal, laryngeal and respiratory papillomatosis': 1, 'benign sinonasal and recurrent laryngeal papillomas': 1, 'Laryngeal Papillomas': 3, 'laryngeal HPV(-) tumors': 1, 'laryngeal papilloma with': 1, "laryngeal papilloma's malignant change": 1, 'Papillomatosis of trachea and lung': 1, 'Juvenile recurrent respiratory papillomatosis': 7, 'juvenile on-set recurrent respiratory papillomatosis': 1, 'Juvenile on-set recurrent respiratory papillomatosis': 1, 'respiratory laryngeal papillomatosis': 3, 'oral and laryngeal papilloma': 3, 'oral, pharynx, or laryngeal papilloma': 1, 'Recurrent respiratory (laryngeal) papillomatosis': 2, 'sinonasal and laryngeal papilloma': 2, 'Laryngeal Papilloma': 7, 'Recurrent respiratory (laryngeal) papillomas': 2, 'sinonasal and laryngeal papillomas': 2, '-onset recurrent respiratory papillomatosis': 12, 'onset RRP': 4, 'Jo-RRP': 2, 'Ao-RRP': 2, 'laryngeal recurrent respiratory papillomatosis': 4, 'laryngeal and oral papillomas': 2, 'respiratory/laryngeal papillomas': 1, 'pulmonary and laryngotracheal papillomatosis': 2, 'upper respiratory papillomatosis': 1, 'respiratory papillomatosis infection': 1, 'Juvenile Onset Recurrent Respiratory Papillomatosis': 3, 'Juvenile-onset recurrent respiratory papillomatosis': 19, 'RRP-related lesions': 1, 'ARRP': 2, 'adult recurrent respiratory papillomatosis': 5, 'Laryngeal Recurrent Respiratory Papillomatosis': 1, 'ano-genital, oropharyngeal, and respiratory papillomatosis': 1, 'juvenile recurrent respiratory papilloma': 1, 'benign laryngeal papilloma': 3, 'recurrent laryngeal papillomas': 12, 'Juvenile Laryngeal Papilloma': 2, 'vocal fold RRP': 1, 'respiratory papillomatosis of': 1, 'RRP lesion': 3, 'RRP) disease': 1, 'Respiratory Papillomatosis (': 1, 'Recurrent respiratory papilloma': 3, 'laryngeal recurrent respiratory papillomas': 1, 'JoRPP': 1, 'RRP-infected': 1, 'Obstructing Respiratory Papillomatosis': 1, 'laryngeal and/or tracheobronchial papillomas': 1, 'RRP papillomas': 1, 'RRP papilloma': 1, 'pulmonary RRP': 5, 'respiratory papillomatosis (RRP) lesions': 1, 'IP and RRP lesions': 1, 'malignancy of laryngeal papilloma': 1, 'papilloma recurrence': 1, 'recurrent laryngeal squamous papillomas': 1, 'ALP': 2, 'adult type laryngeal papilloma': 1, 'LARYNGEAL PAPILLOMA': 4, 'RRP aggressiveness': 3, 'laryngeal papilloma type': 1, 'Adult-type RRP': 1, 'RRP degeneration': 1, 'RRP malignant degeneration': 1, 'infantile laryngeal papilloma': 1, 'recurrent papilloma': 3, 'tracheal, bronchial, and pulmonary papillomatosis': 1, 'tracheal or pulmonary papillomatosis': 1, 'Tracheal, bronchial, and pulmonary papillomatosis': 1, 'Tracheal and pulmonary papillomatosis': 1, 'Juvenile respiratory papillomatosis': 1, 'laryngeal HPV disease': 1, 'sinonasal and recurrent laryngeal papillomas': 1, 'Adult Recurrent Respiratory Papillomatosis': 1, 'Juvenile-Onset Recurrent Respiratory Papillomatosis': 8, 'respiratory and cutaneous papillomatosis': 1, 'Adult respiratory papillomatosis': 1, 'respiratory papillomatosis': 2, 'Congenital juvenile recurrent respiratory papillomatosis': 1, 'RRP)-related symptom': 1, 'RRP aerodigestive lesions': 1, 'RPP': 3, 'respiratory Papillomatosis': 1, 'juvenile-RRP': 1, 'RRP infection': 2, 'Juvenile-RRP': 1, 'juvenile RRP': 2, 'adult-RRP': 1, 'respiratory (laryngeal) papillomas': 1, 'RRP tumorigenesis': 1, 'lung papillomatosis': 4, 'oro-laryngeal papillomas': 1, 'RRP 9': 1, 'Respiratory Papillomatosis Complication': 1, 'laryngeal and papilloma': 2, 'Recurrent respiratory papillomas': 2, 'adult onset RRP': 1, 'juvenile onset RRP': 2, 'Juvenile-onset Recurrent Respiratory Papillomatosis': 3, 'respiratory or laryngeal papillomatosis': 1, 'laryngeal and pulmonary papillomas': 1, 'respiratory recurrent papillomatosis': 4, 'Papilloma of the Right Laryngeal Ventricle': 1, 'congenital juvenile recurrent respiratory papillomatosis': 1, 'onset recurrent respiratory papillomatosis': 4, 'adult-onset recurrent respiratory papillomatosis': 1, 'RRP involvement': 1, 'Juvenile-onset RRP': 1, 'laryngeal, tracheal, and bronchial papillomas': 1, 'Adult-onset RRP': 1, 'benign sinonasal and laryngeal papillomas': 1, 'laryngeal and tracheal papilloma': 2, 'RRP.HPV': 1, 'juvenile onset of RRP': 1, 'adult onset of RRP': 1, 'Congenital juvenile respiratory papillomatosis of the larynx': 1, 'juvenile-onset respiratory papillomatosis': 3, 'Juvenile and adult laryngeal papillomas': 1, 'oral-, laryngeal- and bronchial papillomas': 1, 'RRP condition': 1, 'Respiratory Recurrent Papillomatosis': 1, 'Respiratory recurrent papillomatosis': 2, 'recurrent papilloma of the': 1, 'Papillomatosis of the lung': 1, 'multiple laryngeal papillomas': 1, 'multiple laryngeal papilloma': 3, 'tracheal and laryngeal papillomas': 1, 'juvenile recurrent respiratory papillomas': 1, 'infected LP': 2, 'respiratory papillomatosis.4': 1, 'Tracheobronchial and pulmonary papillomatosis': 1, 'COUNSELING RRP PATIENTS': 1, 'RRP.98': 1, 'RRP.9': 1, 'RRP.23': 1, 'fold RRP.89': 1, 'AO-RRP.4': 1, 'JO-RRP.99': 1, 'RRP.61': 1, 'RRP.49': 1, 'RRP-associated dysplasia': 1, 'juvenile-onset-RRP': 1, 'benign LP': 1, 'JO-RRP lesions': 1, '-RRP': 1, 'pharyngeal and laryngeal papillomas': 3, 'recurrent eyelid papilloma': 1, 'Laryngeal carcinoma ex-papilloma': 1, 'JOP': 1, 'LARYNGEAL PAPILLOMAS': 4, 'laryngeal papilloma disease': 1, 'RRPs': 1, 'Onset Recurrent Respiratory Papillomatosis': 1, 'conjunctival and laryngeal papillomas': 1, 'laryngeal and conjunctival papillomas': 2, 'laryngeal papillomae': 1, 'Recurrent laryngeal papillomas': 1, 'oro-laryngeal and -pharyngeal papillomas': 2, 'oral or laryngeal papillomas': 1, '5 , 6 RRP': 1, 'Juvenile Recurrent Respiratory Papillomatosis': 3, 'laryngeal multiple papilloma': 1, 'Juvenile RRP': 1, 'respiratory papillomatosis infections': 1, 'Juvenile onset recurrent respiratory papillomatosis': 1, "laryngeal papilloma*':ti": 1, 'Laryngeal papilloma*[Title': 1, 'respiratory papillomatosis[MeSH': 1, 'RRP[Title': 1, 'Pulmonary Papillomatosis': 1, 'laryngeal and urethral papillomas': 1, 'malignant laryngeal papillomas': 1, 'JO-RRP papillomas': 1, 'JoRRP aggressiveness': 1, "JoRRP's lesions": 1, 'JoRRP lesions': 2, 'Juvenile-onset Recurrent respiratory papillomatosis': 1, 'laryngeal RRP': 2, 'RRP type 6 1': 1, 'laryngeal polyps and papillomas': 1, 'RRP to': 1, 'Laryngeal papillomas and': 1, 'RRP complication': 1, 'LPs': 1, 'obstructive laryngeal papilloma': 1, 'laryngeal papilloma virus-infected': 1, 'recurrent multiple laryngeal papilloma': 1, 'juvenile recurrent papilloma': 1, 'Laryngeal papilloma lesions': 1, 'Adult-onset laryngeal papilloma': 1, 'recurrent laryngeal and respiratory papillomatosis': 1, 'laryngeal and respiratory papillomatosis': 1, 'respiratory papillomatosis acute infection': 1, 'Malignant Transformation of Respiratory Papillomatosis': 1, 'laryngeal, tracheal and pulmonary papilloma': 1, 'primary laryngeal RRP': 1, 'laryngeal, tracheal, and pulmonary papilloma': 1, 'laryngotracheal and pulmonary papillomatosis': 1, 'Respiratory papillomatosis tumor': 1, 'JLPs': 1, 'recurrent respiratory papillomatosis 3': 1, 'adult laryngeal papillomas': 1, 'oral, pharyngeal and laryngeal papillomas': 1, 'recurrent nasal papilloma': 1, 'oral and laryngeal papillomas': 2, 'respiratory and laryngeal papillomas': 1, 'infantile recurrent respiratory papillomatosis': 1, 'Respiratory papillomatosis of lung': 1, 'respiratory papillomatosis disease': 1, 'papillomatosis of the lungs': 1, 'sinonasal and recurrent respiratory papilloma': 1, 'laryngeal dysplastic papilloma': 1, 'onset current respiratory papillomatosis': 1, 'Laryngeal papilloma with moderate dysplasia': 1, 'Transitional laryngeal papilloma': 1, 'transitional laryngeal papilloma': 1, 'JORRP tumors': 1, 'laryngeal or nasal papilloma': 1, 'RRP Hyperplasia': 1, 'laryngeal papillomas and': 1, 'laryngeal papillomas 12, 13': 1, 'Laryngeal and other mucosal papillomas': 1, 'laryngeal papilloma and genital warts': 1, 'RRP symptoms': 1, 'HPV-infected laryngeal': 1, 'laryngeal Recurrent Respiratory Papillomatosis': 1, 'Papilloma Recurrence': 1, 'inguinal and laryngeal papillomas': 1, 'RRP lesions.9': 1, 'Respiratory Papillomatosis II': 1, 'RRP 16': 1, 'RRP 32': 1, 'genital and laryngeal papillomas': 1, 'Juvenile-Onset recurrent respiratory papillomatosis': 1, 'TREATMENT OF LARYNGEAL PAPILLOMAS': 1, 'tracheal, lung, or paranasal sinuses papillomatosis': 1, 'Laryngeal and oral papillomas': 1, 'JORRP-': 1, 'JORRP disease': 1, 'Laryngeal respiratory papillomas': 1, 'benign recurrent laryngeal papillomas': 1, 'adult-onset laryngeal papilloma': 1, 'juvenile-onset laryngeal papilloma': 1, 'ALP)': 1, 'juvenile recurrent laryngeal papilloma': 1, 'recurrent respiratory laryngeal papillomatosis': 1, 'juvenile or adult laryngeal papillomas': 1, 'RRP 4': 1, 'RRP Hemangioma': 1, 'Chronic cavitary respiratory papillomatosis': 1, 'JORRP.Methods': 1, 'RRP Lesions': 2, 'JoRRP)': 1, 'Respiratory Laryngeal Papillomatosis': 1, 'JO-RRP tumors': 1, 'JoRRP disease': 1, 'JORRP of the larynx': 1, 'JORRP of the': 1, 'RRP carcinogenesis': 1, 'Oral and laryngeal papilloma': 1, 'Laryngeal and oral papilloma': 1}
|
respiratory papillomatosis
|
Disease
|
MESH:C535298
|
{'DSPC': 24, 'vascular leakiness': 57, 'Leaky Gut Syndrome': 25, 'PC': 2104, 'POPC': 83, 'red blood cell membrane disorder': 12, 'RBC membrane disorders': 39, 'inherited red cell membrane disorders': 7, 'red blood cell hemolysis': 8, "leaky gut' syndrome": 4, 'leaky': 16, 'Red blood cell (RBC) membrane protein deficiency': 1, 'RBC membrane defect': 3, 'RBC membrane': 8, 'RBC membrane disorder': 6, 'leaky gut syndrome': 565, 'leaky integrate-and fire': 1, 'LIF': 83, 'haemolytic red cell diseases': 1, 'Lung leakiness': 1, 'occlusive and leaky vasculitis': 1, 'red blood cell (RBC) membrane disorders': 8, 'LCA': 6, 'PC deficiency': 30, 'Red cell membrane disorders': 13, 'red cell membrane disorders': 54, 'PC-Os': 1, 'RBCM': 24, 'inherited red cell membrane defects': 4, 'cation-leaky disorder': 1, 'PCs': 8, 'inherited red cell membrane disorder': 2, 'red cell alloimmune hemolytic disease': 2, 'ePC-O': 1, 'ePC-P': 1, 'CH': 2, 'platelet, red cell or clotting disorders': 1, 'leaky gut': 87, 'red blood cell membrane disorders': 15, 'PPC': 21, 'SPC': 8, 'leaky gut disorder': 1, 'gut leakiness': 30, 'leaky-gut-syndrome': 5, 'congenital red blood cell membrane disorders': 1, 'Leaky integrate-and-fire': 11, 'DLPC': 12, 'Leaky gut syndrome': 43, 'Leaky-ReLU': 2, 'Leakiness': 5, 'red cell membrane disorder': 19, 'leaky gut symptoms': 3, 'leaky integrate-and-fire': 4, 'Red cell membrane diseases': 1, 'C. PC': 1, 'PC-PLC': 30, 'inherited RBC membrane disorders': 6, 'PDCT': 3, 'red blood cell membrane damage': 1, 'capillary leakiness': 5, 'MePC': 1, 'leakiness': 40, 'leaky gut syndromes': 7, 'PHOSPHATIDYLCHOLINE': 14, 'leaky-gut syndrome': 22, 'OxPC': 13, 'pulmonary vascular leakiness': 7, 'PTPS': 1, 'red blood cell membrane defects': 6, 'leaky choriocapillaris': 1, 'red cell membrane abnormalities': 6, 'RCM': 3, 'pulmonary endothelial leakiness': 1, 'hemolysis of red blood cells': 3, 'red cell membrane protein': 1, 'FMP': 1, 'leaky gut"': 13, 'deficiency of PC': 4, 'leaky lung syndrome': 10, 'Leaky Pipeline': 2, 'RBC membrane abnormalities': 5, 'Hemolytic phosphatidylcholine': 1, 'leaky vessel syndrome': 1, 'LGS': 29, 'Leaky gut': 38, 'Red Blood Cell Hemolysis': 10, 'PC-DC': 3, 'Red cell membrane': 1, 'SAPC': 1, 'red blood cell membrane defect': 4, 'CV leakiness': 1, 'leaky SCID': 2, 'PC dyscrasias': 1, 'leaky brain': 5, 'Leaky Syndrome': 1, 'leaky gut condition': 2, 'leaky syndrome': 4, 'cell DSPC': 1, 'DHPC': 3, 'red cell-membrane disorder': 1, 'D9-PC': 1, 'LPC': 7, 'Complete phosphatidylcholine-sterol acyltransferase deficiency': 1, 'phosphatidylcholine-sterol acyltransferase deficiency': 1, 'leaky gut and': 2, 'LGS-associated diseases': 1, 'Leaky gut" syndrome': 2, 'PC-deficiency': 5, 'DMPC': 1, 'Leaky ReLU': 3, 'PC Homeostasis': 1, 'RBCM rupture': 3, 'PtC': 8, 'Red Cell Membrane Disorder': 2, 'Red cell membrane inherited disorders': 1, 'phosphatidylcholine deficiency': 5, 'vessel leakiness': 3, 'congenital red cell membrane disorder': 1, 'SPC-OA': 1, 'phosphatidylcholine': 3, 'RBC membrane damage': 3, 'Leaky Gut': 15, 'red blood cell (RBC) membrane disorder': 4, 'leaky intestine syndrome': 1, 'ZGOCS@MSN@RBM': 1, 'leaky capillary syndrome': 12, 'Red blood cell (RBC) hemolysis': 1, 'ocular vessel leakiness': 1, 'red blood membrane defects': 1, 'ePC': 7, 'red blood cell membranes': 1, "leaky gut'": 3, 'Vascular leakiness': 14, 'leaky gut" syndrome': 10, 'red blood cell membrane diseases': 3, 'aPC': 1, 'Disorders of red': 2, 'red cell membrane abnormality': 2, 'LIAF': 2, 'hemolysis of RBCs': 5, 'leaky-integrate-and-fire': 3, 'red cell membrane': 3, 'Leaky mitochondria': 2, 'LS': 2, 'mucosal organ leakiness': 1, 'leaky bladder': 3, 'RBC Hemolysis': 3, 'Capillary leaky syndrome': 1, 'vascular leaky syndrome': 2, 'Vascular leaky syndrome': 1, 'CLS': 1, 'capillary leaky syndrome': 2, 'RBC Membrane Disorders': 2, 'LRS': 1, 'Cerebrovascular leakiness': 1, 'cerebrovascular leakiness': 1, 'PTC': 3, 'PHOSPHATIDYLCHOLINES': 1, 'ELVIS': 5, 'RBC membrane defects': 4, 'Red cell membrane abnormalities': 3, 'SLIF': 2, 'LGS (2)': 1, 'leaky lymphatics': 1, 'cognitive leakiness': 1, 'lung vascular leakiness': 3, 'PC-': 2, 'PC-deficient': 4, 'LSPCE': 1, 'PC-SD': 1, 'LPPC': 1, 'PC-P': 1, 'Leaky pipes': 1, 'LEAKINESS': 1, 'leaky integrate and fire': 7, 'LLMS': 1, 'pPC': 8, 'Leaky SCID': 1, 'leaky capillary syndromes': 1, 'leaky brain syndrome': 2, 'SOPC': 4, 'Inborn errors of red cell membrane': 1, 'PC[20:4': 1, 'PC[o': 1, 'deficiency in phosphatidylcholine': 1, 'PC.aa': 6, 'PC.a': 3, 'PC.e': 2, 'PC-20:4': 2, 'RBC membrane inherited disorders': 1, 'RBM': 1, 'DPhPC': 3, '16-1PC': 1, 'pulmonary leakiness': 2, 'high phosphatidylcholine hemolytic anemia': 1, 'LCX': 2, 'Dysfunction of the red blood cell membrane': 1, 'hemolysis of RBC': 1, 'Red Blood Cell Membrane Disorder': 1, 'Gut leakiness': 3, 'PCae': 7, 'Indo-PC': 1, 'Gut leaky syndrome': 1, 'gut leaky syndrome': 2, 'CPC': 1, 'red blood cell membrane abnormalities': 2, 'red drupelet disorder': 2, 'AsPCs': 2, 'ELIF': 1, 'lung leakiness': 1, 'red cell enzyme and membrane disorders': 1, 'L-ReLU': 1, 'cation-leaky membrane disorders': 1, 'ALIF': 4, 'leaky intestinal syndrome': 3, 'LEAKY': 1, '-PC': 1, 'Capillary leakiness': 1, 'Leaky muscle fibers': 1, 'autosomal dominant red cell membrane protein disorder': 1, 'leaky mast cell syndrome': 1, 'leaky gut wall': 1, 'red-cell enzyme and membrane defects': 1, 'leaky gut-related diseases': 2, 'Membrane damage of RBC': 1, 'congenital red blood cell (RBC) membrane defects': 1, 'RBC hemolysis': 3, 'PC.n3': 1, 'PC.n6': 1, 'PE': 4, 'Leaky Gut and Leaky Brain': 1, 'Leaky-integrate-and-fire': 1, 'PECPC': 1, 'leaky legs': 1, 'SDPC': 3, 'PC loss': 2, 'RBC membrane diseases': 1, 'Red blood cell membrane disorders': 3, 'gut leaky': 2, 'red blood cell membrane protein deficiency': 2, 'Heterogeneous red blood cell (RBC) membrane disorders': 1, 'LIF,': 1, 'Hemolysis of red blood cells': 4, 'tumor vascular leakiness': 1, 'red cell membrane diseases': 3, 'OSPC': 1, "'Leaky gut' syndrome": 1, "'leaky' syndrome": 1, 'Leaky': 6, 'Leaky Brain': 2, "Leaky gut' syndrome": 1, 'PC-TG': 1, 'congenital red cell membrane disorders': 2, 'LIT': 2, 'PC-Laden': 1, 'Leaky Splicing Defects': 1, 'leaky splicing defects': 1, 'LPs': 1, 'HPCHA': 2, 'PHOSPHATIDYLCHOLINE-STEROL ACYLTRANSFERASE': 1, 'PC defects': 1, 'FGLIF': 1, 'leaky vascular lesions': 1, 'gastrointestinal (GI) leakiness': 1, 'Leaky-SCID': 1, 'Leaky-SCID-Patienten': 1, 'LReLU': 4, 'PCF': 1, 'red cell membrane defects': 2, 'Inherited red cell membrane disorders': 1, 'red cell membrane protein deficiencies': 1, 'red cell membrane protein deficiency': 1, 'PPoPC': 1, '5al-PC': 1, 'injury to red cell membranes': 1, 'NanoEL': 8, 'leaky vessels': 2, 'leaky choroi': 1, 'PC(': 4, 'RBC membrane dysfunction': 1, 'inherited RBC membrane disorder': 1, 'Leaky Gut syndrome': 1, 'PC-O': 1, 'leaky pulmonary capillary syndrome': 1, 'Leaky gut, clotting': 1, 'autosomal dominant inherited red blood cell (RBC) membrane disorder': 1, 'leaky bowel disease': 1, 'DEPC': 1, 'OxPCs': 3, 'RBC membrane and enzyme disorders': 1, 'DPPC': 2, 'gastroduodenal leakiness': 1, 'LG': 1, 'LIf': 1, 'PC.ae': 4, 'Red blood cell (RBC) membrane disorders': 3, 'gastrointestinal leakiness': 1, 'inherited and acquired red cell membrane disorders': 1, 'Leaky vessel': 1, 'PE-PLC': 1, 'LIAF Neuron': 1, 'LIAF neuron': 1, 'leaky-membrane diseases': 1, 'LIFL': 2, 'PC-PLCs': 1, 'endothelial leakiness': 1, 'NANOPARTICLE INDUCED ENDOTHELIAL LEAKINESS MECHANISM': 1, 'leaky diarrhea': 2, 'HOHA-PC': 1, 'HOOA-PC': 1, 'PDAT': 1, 'leaky-gut condition': 1, 'DSPC in type II': 1, 'OPC': 1, 'LMPC': 1, 'PC-CH': 1, 'PC disorders': 1, 'Leaky gut syndromeHow': 1, 'red cell membrane defect': 2, 'abnormal capillary leakiness': 2, 'congenital red blood cell membrane defect': 1, 'RM': 1, 'Painful or leaky urine': 1, 'Gut leaky': 1, 'leaky bowel': 2, 'red flag disorders': 1, 'Red Cell Membrane Disorders': 2, 'abnormalities of the red cell membrane': 1, 'PC-PLs': 1, 'disorders of the red': 1, 'aPG': 1, 'd63-POPC': 1, 'PHOSPHATIDYLCHOLINE CHALLENGE': 1, 'Leaky Gut and Autoimmune Disorders': 1, 'RPNs': 1, 'OV-PC': 1, 'HV-PC': 1, 'ON-PC': 1, 'LI': 1, 'Red Cell Membrane Abnormalities': 1, 'leaky gut disease': 1, 'Red Colour Defect': 1, 'red colour defect': 1, 'red cell membrane anomaly': 1, 'Leaky ryanodine receptors': 1, 'Hemolysis of RBCs': 1, 'red blood cell membrane abnormality': 1, 'PHOSPHATIDYLCHOLINE METABOLISM': 1, 'd3-PC': 1, 'HSPC': 3, 'LGS-like symptoms': 1, 'cerebral vessel leakiness': 1, 'Leaky brain': 1, 'Disorders of red cell membrane': 1, 'leaky-gut"': 2, 'PhPC': 1, 'leaky bladder syndrome': 1, 'SC': 1, 'LV leakiness': 1, 'PC:18:0': 1, 'Leaky "feet': 1, 'PC[34:1': 1, 'PC[32:1': 1, 'leaky gum syndrome': 1, 'to the red cell membrane': 1, 'leaky retinopathic': 1, 'Deficiency of phosphatidylcholine transferase': 1, 'SM': 1, 'RPANs': 1, 'POPE': 1, 'leaky red cell syndrome': 3, 'IgMPC': 2, 'OxPAPC': 2, 'PC 32:0': 1, 'leaky pipe': 1, 'deficiency of red cell membrane protein band 4.2': 1, 'PCOOH': 1, 'PC-EHP': 1, 'leaky gut-related disorders': 1, 'leaky gut syndrome-related diseases': 1, 'POPG': 1, 'DO-PC': 1, 'RAPESEED PHOSPHATIDYLCHOLINE HYDROLYSIS': 1, 'LLS': 2, 'Leaky vessels': 2, 'Leaky gut symptoms': 2, 'chronic red cell hemolysis': 1, 'Leaky Gut"': 1, 'PE & PC': 1, 'n-3 PC': 1, 'Leaky central': 1, 'leaky integrate and': 1, 'DiPhPC': 1, 'RBC membrane anomaly': 1, 'Inherited red blood cell (RBC) membrane disorders': 1, 'Inherited RBC membrane disorders': 1, 'GLIF': 1, 'congenital high red cell membrane phosphatidylcholine hemolytic anemia': 1, 'Red Blood Cell Membrane Disorders': 1, 'leaky RBC syndrome': 1, 'red blood cell (RBC) membrane abnormalities': 1, 'mRFP': 2, 'vascular leaky lesions': 1, 'ePCs': 1, 'Red cell membrane defects': 1, 'leaky-gut-like symptoms': 1, 'leaky gut disorders': 1, 'lung vessel leakiness': 1, 'rigid-red-cell hemolytic syndrome': 1, 'Leaky Glomeruli': 1, 'Leaky attention': 1, 'QHS reactions': 1, 'AA-PC': 1, 'Leaky bladder': 1, 'Ama and Leaky Gut Syndrome': 1, 'Leaky integrate-and-fire with': 1, 'RBCH': 1, 'of RBC membrane': 1, 'red cell membrane protein 4.2': 1, 'p-PC': 1, 'red blood cell membrane disease': 1, 'red disorders': 1, 'urinary leakiness': 1, 'SM-PC': 1, 'P-PC': 1, 'inherited red blood cell (RBC) membrane disorder': 3, 'RBCMDs': 1, 'Leaky syndrome': 1, 'leaky gut" diseases': 1, 'leaky pits': 1, 'Equine leaky gut syndrome': 1, 'leaky home syndrome': 1, 'membrane phosphatidylcholine hemolytic anemia': 1, 'Leaky gut syndromes': 1, 'gut-leaky syndrome': 1, 'leaky cell membrane syndrome': 1, 'Red blood cell membrane abnormalities': 1, 'PC deficiencies': 1, 'OA-PC': 1, 'TEPC': 1, "'leaky' (subtotal) immunodeficiency syndromes": 1, 'to phosphatidylcholine': 1, 'Aortic leakiness': 1, 'PhL': 1, 'leaky pipes': 1, 'LIFT': 1, 'PHOSPHATIDYLCHOLINE SYNTHESIS': 2, 'Leaky pathological': 1, 'Leaky microvasculature': 1, 'Leaky tissues': 1, 'Re-PC': 1, 'Gut Leakiness': 1, 'oxPC': 1, 'BILIARY PHOSPHATIDYLCHOLINE': 1, 'IBUPROFEN-PHOSPHATIDYLCHOLINE': 1, 'red-cell membrane abnormalities': 1, 'Lymphatic leakiness': 1, 'PCH': 1, 'PCH deficiency': 1, 'PC P': 1, 'leaky guts syndrome': 1, 'RBC membrane impairment': 1, 'LA': 1, 'and red disorders': 1, 'PLPC': 1, 'PC-Ps': 1, 'TAA': 1, 'lky deficiency': 1, 'lky': 1, 'mitochondrial PC deficiency': 1, 'PDC Causes Cell Death': 1, 'PDC': 1, 'RBC membrane fragility diseases': 1, 'hemolytic phospholipid': 1, 'LMN': 1, 'Red blood cell membrane storage lesion': 1, 'PHOSPHATIDYLCHOLINE IS CRUCIAL FOR AGROBACTERIUM VIRULENCE': 1, 'Leaky integrated-and-fire': 1, 'PC to': 1, 'inherited red blood cell membrane disorder': 2, 'Pulmonary vascular leakiness': 1, 'leaky-gut symptoms': 1, 'PCaa': 1, 'PC decline': 1, 'leaky incontinence': 1, 'Leaky cell syndrome': 1, 'Red cell membrane disease': 1, 'RH condition': 1, 'Leaky cyst': 1, 'Leaky-Gut Syndrome': 1, 'Paz-PC': 1, 'LEAKY INTEGRATION MODEL': 1, 'LWA': 1}
|
PC
|
Disease
|
MESH:C535299
|
{'Autoimmune progesterone dermatitis': 94, 'autoimmune progesterone dermatitis': 69, 'Autoimmune Progesterone Dermatitis': 18, 'progesterone dermatitis': 37, 'APD': 31, 'AUTOIMMUNE PROGESTERONE': 1, 'progesterone or estrogen dermatitis': 1, 'AIPD': 10, 'autoimmune progesterone dermatitis of pregnancy': 2, 'autoimmune progesterone urticaria': 2, 'urticarial APD': 1, 'Autoimmune progesterone dermatosis': 2, 'Autoimmune progesterone urticaria': 3, 'progesterone dermatitis dermatitis': 1, 'Autoimmun-Progesteron-Dermatitis': 1, 'Autoimmune Progesterone Dermatitis of Pregnancy': 1, 'autoimmune progesterone anaphylaxis': 1, 'Autoimmune progesterone anaphylaxis': 2, 'AIPA': 1, 'mucosal autoimmune progesterone dermatitis': 1, 'eczematous AIPD': 1}
|
Autoimmune progesterone dermatitis
|
Disease
|
MESH:C535300
|
{'anger outbursts': 147, 'Anger outbursts': 8, 'temper outbursts': 409, 'outbursts': 411, 'angry outbursts': 105, 'violent outburst': 5, 'IPS': 43, 'neurological outbursts': 2, 'emotional outbursts': 161, 'Excito-maniac outburst': 1, 'outburst': 66, 'angry outburst': 5, 'COMPEL': 4, 'Compelling': 61, 'photic': 74, 'violent outbursts': 111, 'Photic injury': 10, 'HELIOS deficiency': 1, 'temper outburst': 30, 'photic injury': 74, 'abnormal outburst of laughter': 1, 'photic epilepsy': 28, 'outbursts of temper': 23, 'Angry outbursts': 8, 'outbursts of anger': 83, 'Temper outburst': 2, 'OF PHOTIC STIMULATION': 1, 'behavioural outbursts': 7, 'photic disturbance': 4, 'photic phenomena': 11, 'photic seizures': 5, 'vocal outbursts': 12, 'photic disturbances': 4, 'rage outbursts': 30, 'photic retinopathy': 29, 'photic damage': 9, 'Helios': 4, 'Photic skin injurues': 1, 'outbursts of laughter': 2, 'autosomal dominant compelling helio-ophthalmic outburst syndrome': 2, 'ACHOOs': 1, 'helio-ophthalmic outburst syndrome': 3, 'PZE': 2, 'Emotional outburst': 2, 'outbursts of': 5, 'Helios deficiency': 8, 'PSR': 2, 'compulsive helio-ophthalmic outbursts': 1, 'ACHOO) syndrome': 2, 'Outbursts': 14, 'temper outbursts that': 1, 'outburst of anger': 1, 'outbursts of fury': 1, 'Emotional outbursts': 10, 'PNP': 1, 'CO': 1, 'Photic epilepsy': 4, 'ACHOO': 3, 'Autosomal Dominant Compelling Helio-Ophthalmic Outburst) syndrome': 1, 'dystonic outbursts': 1, 'outburst disaster': 3, 'Temper Outbursts': 6, 'Violent outbursts': 4, 'PS': 7, 'Temper outbursts': 20, 'photic symptoms': 10, 'PHOTIC INTERMITTENCY': 1, 'HELIOS': 9, 'HELIOS-A': 1, 'temper tantrums and outbursts': 2, 'outburst disasters': 1, 'OF DIFFERENCE COMPELLING': 1, 'photic injuries': 5, 'Photic retinopathy': 9, 'abnormal outbursts': 1, 'Autosomal Cholinergic Helio-Ophtalmologic Outburst': 1, 'photic impairment': 1, 'Anger Outbursts': 3, 'photic lesions': 6, 'PRM': 1, 'photic phenomenon': 4, 'psychotic-like outbursts': 2, 'Emotional Outburst': 1, 'emotional outburst': 5, 'rageful outbursts': 2, 'myoclonic outbursts': 1, 'outbursts of frustration': 1, 'Photic macular injuries': 2, 'photic macular injuries': 2, 'IPS sensitivity': 1, 'PHOTIC STIMULATION': 2, 'Compelled': 1, 'Compelled Body': 1, 'Compelled body': 1, 'EMOTIONAL OUTBURST': 1, 'anger outburst': 4, 'Violent Outbursts': 1, 'PSS': 2, 'photic sneeze syndrome': 2, 'autosomal dominant compelling helio-ophthalmic outburst (ACHOO) syndrome': 1, 'PSS.6': 1, 'PSS.4': 1, 'Photic sneeze syndrome': 2, 'photic sneezing': 4, 'PHOTICALLY EVOKED POTENTIALS': 1, 'PEPS': 1, 'delusiional outbursts': 1, 'PHOTIC FOLLOWING': 1, 'psychotic outbursts': 9, 'Impairing emotional outbursts': 1, 'impairing emotional outbursts': 1, 'photic toxicity': 1, 'Outbursts of anger or rage': 1, 'Photic': 3, 'photic symptom': 1, 'PHOTIC ENVIRONMENT': 1, 'outbursts of emotion': 1, 'helioophthalmic outburst': 2, 'Outburst': 1, 'Emotional Outbursts': 2, 'photic trauma': 2, 'temper outbursts and rage': 1, 'Photic disturbances': 1, 'temper-outburst': 1, 'Photic sneezing': 2, 'LP': 1, 'temper outbursts you': 3, 'anger-rage outbursts': 2, 'UNILATERAL PHOTIC STIMULATION': 1, 'Outbursts of violence': 1, 'outburst of': 1, 'CAS': 1, 'Rage Outbursts and': 1, 'temper tantrums/outbursts': 1, 'PHOTIC ENTRAINMENT': 1, 'Photic injury to the': 1, 'PHOTIC': 1, 'outbursts of violence': 1, 'Rage Outbursts': 5, 'photic lesion': 2, 'COMPELLING IMPERATIVE': 1, 'TO': 2, 'rage-outbursts': 1, 'Photic ocular injuries': 1, 'photic macular injury': 1, 'outbursts of rage': 9, 'temper-outbursts': 1, 'gadoid outburst': 1, 'involuntary outbursts': 1, 'PHOTIC EPILEPSY': 2, 'PR': 1, 'tantrums or outbursts': 1, 'PHOTIC PHENOMENA': 1, 'outburst of emotion': 1, 'COMPELLING': 1, 'Autosomal dominant compelling helio-ophthalmic outburst syndrome': 1, 'or outbursts of anger': 1, 'THERAPEUTIC TRIAL OF IMIPRAMINE IN DELIRIANT OUTBURSTS': 1, 'PHOTIC REGULATION': 1, 'SINE-WAVE PHOTIC': 1, 'COMPELLING ISSUE': 1, 'anxious outbursts': 1, 'PPR': 1, 'paroxysmal photic response': 1, 'photic retinopathy lesion': 1, 'ACHOO syndrome': 1, 'autosomal dominant compelling helio-ophthalmic outburst (': 1, 'Meltwater outburst': 1, 'anger-outbursts': 1, 'outbursts of bad temper': 1, 'developmentally inappropriate temper outbursts': 2, 'COMPELLING NEED': 1, 'ELECTROCLINICAL CORRELATION OF PHOTIC DRIVING RESPONSES': 1, 'COMPELLING MANDATE': 1, 'Autosomal-dominant Compelling Helio-Ophthalmic Outburst) syndrome': 1, 'photic sneeze': 1, 'compel symptom': 1, 'AO': 1, 'developmentally-inappropriate temper outbursts': 1, 'inappropriate temper outbursts': 1, 'HELIOS deficiencies': 1, 'outbursts of racism': 1, 'photic complications': 1, 'maniac outbursts': 1, 'Photic damage': 1, 'TEMPER OUTBURSTS': 1, 'Compelling Symptoms of Problematic': 1, 'outbursts with self-harm': 1, 'DURING PHOTIC HABITUATION': 1, 'photic adverse effects': 1, 'Photic adverse effects': 1, 'rage outburst': 1, 'PHOTIC SENSITIVITY OF CIONA INTESTINALIS': 1, 'APS': 1, 'compelling': 1, 'helio': 1, 'Outbursts of anger': 1, 'CIRCADIAN PHOTIC ENTRAINMENT': 1, 'COMPELLING EVIDENCE': 1, 'photic complaints': 1, 'outburst of emotions': 1, 'Photic injury at the': 1, 'COMPELLING CAUSAL CLAIMS': 1, 'Helio': 2, 'has outbursts': 1, 'EFFECTS OF STRONG PHOTIC IMPULSES': 1, 'Rage outburst': 1, 'Rage Outbursts and Anger': 1, 'Anger outburst': 1, 'Lake Agassiz outburst': 1, 'PHOTIC RESPONSES': 1, 'ALTERATIONS OF AVERAGED PHOTIC EVOKED POTENTIALS': 1, 'Helio-Ophthalmic Outburst Syndrome': 1, 'PD': 4, 'photic eye damage': 1, 'Photic Injury': 1, 'Angry outburst': 1, 'temper outbursts': 1, 'assaultive outbursts': 1, 'Photic damage to the eye': 1, 'COMPELLING INTERESTS': 1, 'PHOTIC ACTIVATION OF': 1, 'COMPELLING PARALLEL TREND': 1, 'Photic retinal toxicity': 1, 'Violent outburst': 1, 'or emotional outbursts': 1, 'helios': 1, 'Postoperative photic symptom': 1, 'PDRs': 1, 'PDR': 1, 'photic retinopathies': 1, 'violent temper outbursts': 1, 'outburst of temper': 1}
|
outbursts
|
Disease
|
MESH:C535301
|
{'Congenital hypomyelinating neuropathy': 22, 'CHN': 813, 'congenital hypomyelinating neuropathy': 113, 'Congenital Hypomyelination': 1, 'CH': 6, 'congenital hypomyelination': 89, 'CHN.4': 1, 'congenital hypomyelinating': 4, 'Fe': 1, '125-2-CHN': 1, '4e': 5, 'congenital neuropathy': 50, 'CHN.ASN.000451': 1, 'amyelination': 33, 'Congenital neuropathies': 2, 'Congenital Hypomyelinating Neuropathy': 13, 'CHN-19': 4, 'CMT4E': 11, 'CHIldren with severe congenital heart Disease': 1, 'ORCHID': 1, 'CHN-DC1': 6, 'CHN#1': 1, 'congenital amyelinating neuropathy': 5, '4E': 11, 'Congenital Neuropathies': 1, 'congenitally blind or severely visually impaired': 1, 'congenital hypomyelination neuropathy': 26, 'congenital hypomyelinating neuropathy 2': 2, 'CHN-HN-': 2, 'CHN-HG-': 1, 'CHN-HK': 1, 'recessive neuropathy': 10, 'congenital neuropathies': 31, 'AR neuropathy': 2, 'autosomal recessive neuropathy': 26, 'CHN2': 1, 'Congenital neuropathy': 6, 'CHN1': 18, 'CMT4E.': 1, 'CHN-I': 5, 'CHN-IV': 4, 'CHN-II': 4, 'CHN-V': 3, 'CHN-III': 3, 'Amyelination': 4, 'CHN-EA': 1, 'Charcot-Marie-Tooth disease type 4E': 2, 'SCC 4E': 1, 'congenital autosomal recessive neuropathy': 1, 'autosomal recessive congenital neuropathy': 13, 'CHN-HN-1601': 2, 'NVS-CHN': 1, 'congenital motor neuropathy': 2, 'CHN&CHC': 1, 'CHN-': 12, 'CHN-S': 1, 'congenital severe electrical disease': 1, 'congenital entero-neuropathy': 1, 'congenital entero-neuropathies': 1, 'MAST-4E': 1, 'CHN-H1': 1, 'CHN-H2': 1, 'Congenital hypomyelination neuropathy with': 1, 'CHN-SCMY 2021': 1, '4e and': 1, 'CHN hyperactivity': 1, 'Congenital hypomyelination neuropathy': 7, 'autosomal recessive and neuropathy': 1, 'CHN-HN-2014': 1, 'Autosomal recessive hypermyelinating neuropathy': 1, 'amyelinic lesions': 1, 'congenital and severe childhood diseases': 1, 'CHN1, 3, and 4': 1, 'CHN-HB': 3, 'CHN-JS': 1, 'CHN 12': 1, 'CHN-NP1-2016': 1, 'amyelinated': 1, 'SD': 1, 'CHN_SH': 1, 'congenital severe hearing impairment': 2, 'autosomal-recessive neuropathies': 1, 'congenital hypomyelinating neuropathies': 7, 'congenital severe heart disease': 1, 'hypomyelinating neuropathy, congenital, 2': 1, 'DECA': 1, 'OCTA': 1, 'DDA': 1, 'CHN-RD4': 1, 'CHN-RD1': 3, 'CHN-RD2': 1, 'CHN I-': 1, 'CHN-X': 2, 'CHN-IX': 3, 'CHN I, III and V.': 1, 'CHN III and V': 1, 'CHN-I, V': 1, 'congenital hypomyelinated': 1, 'recessive neuropathies': 3, 'CHN-B3': 1, 'AWARD-CHN1': 1, 'congenital hypomyelination neuropathy 2': 1, 'CHM': 1, 'CHMN': 1, 'congenital hypomyelinating neuropathy syndrome': 1, 'congenital severe visual impairment': 2, 'CHN/11': 1, 'CHN IDN': 1, 'CHN-VI/VII': 3, 'CHN-X.': 1, 'CHN-VIII': 3, 'CHN-VI': 1, 'hypomyelination and congenital contract': 1, 'CHN-HN': 4, 'PLV-CHN': 1, 'dDD': 1, 'dOD': 1, 'Congenital hypomyelination': 4, '4E-Ts': 1, 'SCHD': 2, 'peripheral amyelination': 2, 'congenital hypomyelinating (CHN) neuropathies': 1, 'congenital hypomyelinization': 1, 'CHN-JS-2017 infection': 1, 'CHN-JS-2017': 1, 'sCHD': 4, 'CHN-GD16': 1, 'CHN-TS1-2019': 1, 'CHN 2': 3, 'CH neuropathy': 2, 'CHN:72': 1, 'CHN:24': 1, 'Congenital Hypomyelination Neuropathy': 2, 'CHN Asia': 1, 'CHN I-V': 1, 'CHN I': 2, 'CHN VIII': 2, 'congenital severely impaired hearing': 1, 'Charcot-Marie-Tooth (CMT) disease type 4E': 1, 'congenital hypomyelinating neuropathy type 2': 1, 'CHN_HEN01': 2, 'recessive Mendelian neuropathy': 1, 'CHN 2016': 1, 'THA CHN': 1, 'THA CHN': 1, 'THA CHN': 1, 'CHN-2018': 1, 'CHN-2014': 1, 'CHN-HG': 2, 'CHN-2017': 2, 'CHN-QH-2017-1': 1, 'congenital pansensory neuropathy': 2, 'CHN-KOR': 1, 'CHN-CIH': 1, 'Tt-CHN': 1, '4e vertebre': 1, 'RIM 4E': 1, '4E-': 1, 'CHN tumors': 1, 'CHN disease': 1, 'CHN.B7': 1, 'elF4E Dependence': 1, 'autosomal recessive neuropathies': 3, 'Dam 4E': 1, 'congenital hypomyelinations': 1, 'CHN-VI/VII.2a': 1, 'CHN-VI/VII.2': 1, 'CHN-VI/VIII.2a': 1, 'CHN-VI/VII.1': 1, 'CHN/2019': 1, 'CHN corder': 1, '4e-19': 1, 'CHN/20': 1, 'PANES-CHN': 1, 'CHN-XIN-1': 2, 'CHN-QH': 1, 'CHN 6': 1, 'CHN 5': 1, 'CHN 4': 2, 'CHN 1': 2, 'congenital hypomyelinated neuropathy type 2': 1, 'congenital dysmyelinating neuropathy': 2, 'EXCAVATION-CHN1': 1, '4E-1': 1, 'CHU-9D': 2, 'congenital amyelinating or demyelinating neuropathy': 1, 'CHN-2E': 2, 'CHN-2B': 2, 'CHN-2D': 2, 'CHN-2I': 1, 'CHN-2H': 2, 'CHN-2F': 1, 'CHN-2': 1, 'CHN-2C': 2, 'CHN-2A': 2, 'CHN-189': 1, 'CHN.34': 1, 'autosomal recessive Neuropathy': 1, 'CHN.A': 1, 'Congenital hypomyelination with axonopathy': 1, 'CHN 9': 1, 'CHN Wu': 1, 'CHN neuropathy': 1, 'CHN-1': 1, 'DD': 2, 'HD': 1, 'OD': 1, 'recessive congenital neuropathy': 1, 'congenital amyelination': 1, 'CHN.ASN.000337': 1, '-CHN': 1, 'CHN (2': 1, 'CHN Dai': 1, 'CHN-EDA': 1, 'CHN-HG-2017': 1, 'CHN-HG-2017 infection': 1, 'congenital severe HI': 1, 'CAC - CHN': 1, 'CHN VI': 1, 'CHN IV': 1, 'CHN V': 1, 'CHN III': 1, 'CHN II': 1, 'DF0102.4e': 1, 'AR neuropathies': 1, 'CHN 3': 1, 'congenital severe disease': 1, 'congenitally hypomyelinated': 1, 'CHN-RR3': 1, 'CHN-RR1': 1, 'CHN-14': 1, 'CHN-8': 1, 'CHN-23': 1, 'LM-CHN': 1, 'WAP-4E': 1, 'CHN-SD-sHEV': 1, 'CHN 22': 1, 'CHN CHN': 1, 'CHN 3': 1, '4E-IND': 1, 'neural amyelinic degeneration': 1, 'EWS-CHN type 1': 1, 'EWS-CHN type 2': 1, 'CHN-11-48': 1, 'congenital hypomyelinating neuropathy type 1': 1, 'amyelinated lesion': 1, 'CHN N': 1, 'CHN Depression': 1, 'recessive syndromic neuropathy': 1}
|
CHN
|
Disease
|
MESH:C535302
|
{'CMTNS': 3, 'Charcot-Marie-Tooth 2 disease': 2, 'Charcot-Marie-Tooth type 2': 97, 'CMT type 2': 49, 'CMT2': 72, 'Charcot-Marie-Tooth neuropathy type 2': 19, 'Charcot-Marie-Tooth 2 L': 1, 'Charcot-Marie-Tooth Type 2': 18, 'CMTNSv2': 4, 'CMTNSv2-R': 1, 'Neuropathy 2': 6, 'X- linked recessive CMT phenotype': 1, 'X-linked recessive CMTX5': 1, '-recessive Charcot-Marie-Tooth disease type 2': 1, 'CMT Type 2': 5, 'Charcot Marie Tooth type 2 neuropathy': 1, 'Charcot Marie Tooth Type 2 neuropathies': 1, 'CMTNS-2': 1, 'CMTNS2': 2, 'CMT-2': 2, 'Charcot-Marie-Tooth type 2 peripheral neuropathy': 3, 'CMT 2': 24, 'Charcot-Marie-Tooth disease type 2 neuropathy': 2, 'Charcot-Marie-Tooth 2': 13, 'Charcot-Marie-Tooth type 2 axonal neuropathy': 1, 'Charcot-Marie-Tooth type 2 neuropathy': 5, 'Charcot-Marie-Tooth (CMT) neuropathy type 2': 1, 'Charcot-Marie-Tooth axonal neuropathy type 2': 2, 'X-linked recessive Charcot-Marie-Tooth disease': 1, 'CMT': 2, 'type 2 CMT': 4, 'CMTNS v2': 1, 'axonal neuropathy CMT type 2': 1, 'Charcot Marie Tooth Type 2': 2, '2 CMT': 2, 'Charcot-Marie-Tooth type 2 (': 5, 'Charcot-Marie-Tooth disease 2': 9, 'Charcot-Marie-Tooth (CMT) type 2': 4, 'Charcot Marie Tooth type 2 O': 1, 'Charcot Marie Tooth type 2': 5, 'Charcot-Marie Tooth Neuropathy Type 2': 1, 'CMT.2': 2, 'Charcot-Marie-Tooth type 2 neurodegeneration': 1, 'autosomal recessive Charcot-Marie-Tooth neuropathy type 2': 1, 'CMTESv2-R': 1, 'autosomal recessive CMT type 2': 1, '2 axonal CMT': 1, 'Charcot-Marie Tooth Type 2': 2, 'Charcot-Marie-Tooth type 2 A': 3, 'Charcot-Marie-Tooth 2 DD': 1, 'Charcot-Marie-Tooth peripheral neuropathy type 2': 3, 'Charcot Marie tooth type 2': 1, 'DNM2 neuropathy': 1, 'CMT#2': 1, 'Charcot-Marie-tooth type 2 neuropathy': 1, 'CMT (type 2': 1, 'Charcot-Marie-Tooth type-2': 1, 'CMT2 type 2 B': 1, 'CMT2B': 1, 'CMT type 2 N': 2, 'CMT2N': 1, 'axonal neuropathy type 2 Charcot-Marie-Tooth': 1, 'Charcot-Marie-Tooth disease type 2 neuropathies': 1, 'Charcot-Marie-Tooth (CMT) type 2 neuropathies': 2, 'Charcot Marie Tooth 2 neuropathy': 1, 'Charcot-Marie Tooth type 2': 2, 'CMT subtype 2 N': 1, 'Charcot Marie Tooth type 2 axonal neuropathy': 1, 'CMT2 neuropathies': 2, 'Autosomal recessive Charcot-Marie-Tooth type 2': 1, 'Charcot-Marie-Tooth Neuropathy Type 2': 2, 'Charot Marie Tooth Type 2': 1, 'CN 2 neuropathy': 1, 'Charcot-Marie-Tooth disease, Type 2 (CMT 2) 5/': 1, 'CMT 2': 1, 'X-linked recessive motor-neuron neuropathy': 1, 'autosomal recessive Charcot-Marie-Tooth type 2': 1, 'DNM2-CMT': 1, 'Charcot Marie Tooth Decay type 2': 1, 'CMT2 +': 1, 'autosomal recessive disease CMT type 2': 1, 'LO-CMT2': 1, 'autosomal recessive CMT2': 1, 'genetico-diabetoid-2 neuropathy': 1, 'Charot-Marie-Tooth disease type 2': 2, 'CMT2 neuropathy': 4, 'CMT tylpe 2': 1, 'Charcot neuroarthropathy 2': 1, 'autosomal recessive and X-linked recessive bleeding': 1, '2 Charcot-Marie-Tooth disease': 1, 'CMT type 2 neuropathy': 2, 'neuropathy.2': 2, 'Charcot-Marie-Tooth neuropathies (type 2)': 1, 'autosomal recessive Charcot Marie Tooth type 2': 1, 'Charcot-Marie-Tooth-2': 1, 'autosomal-recessive Charcot-Marie-Tooth disease type 2': 1, 'MFN2 neuropathy': 1, 'charcot foot neuropathy type 2': 1, 'type 2 Charcot-Marie-Tooth neuropathy': 1, 'Marie-Tooth type 2 neuropathies': 1, 'AR-CMT': 1, 'Charcot-Marie-Tooth type 2 neuropathies': 2, 'Charcot-Marie-Tooth type 2 L': 1, 'CMT2L)': 1, 'CMT2A': 3, 'Charcot-Marie-Tooth neuropathy type 2 A': 1, 'CMT2K': 1, 'CMT type 2 K': 1, 'CMT2K.': 1, 'CMT neuropathy type 2': 1, 'CMT2)': 1, 'CMT2W peripheral neuropathy': 1, 'Charcot-Marie-Tooth 2 neuropathy': 1, 'Charcot-Marie-Tooth type 2 subtype A': 1, 'autosomal recessive Charcot-Marie-Tooth disease type 2': 1, 'X-linked recessive CMT': 4, 'CMTX2-5': 1, 'Charcot-Marie-Tooth, type 2': 1, 'type 2 Charcot Marie Tooth -like neuropathy': 1, 'CMT2 Neuropathy': 1, 'GARS CMT2': 1, 'AR CMT2': 1, 'Charcot-Marie Tooth type 2 A': 1, 'Charcot-Mare-Tooth disease type 2': 1, 'neuropathy 2': 1, 'Charcot-Marie-Tooth type 2;CI': 1, 'Marie-Charcot-Tooth type 2': 1, '(X-linked) Charcot-Marie-Tooth disease 2': 1, 'Charcot Marie Tooth neuropathy type 2': 1}
|
Charcot-Marie-Tooth type 2
|
Disease
|
MESH:C535305
|
{'HES': 155, 'CHEST': 6, 'HEDS': 6, 'THEOS': 1, 'HED': 14, 'HET': 5, 'PHEMA': 37, 'HET-P': 3, 'HEC': 49, 'HEI': 4, 'HEMA': 62, 'HEA': 14, 'HBS': 2, 'MHET': 10, '2-HEMA': 1, 'PHMA': 1, 'Hepes': 3, 'HEM': 3, 'HEAA': 3, 'HECS': 3, 'GD': 1, 'HEMA-PV': 1, 'HEIA': 3, 'HYDROXYETHYL': 1, 'PHEA': 4, 'EMT': 1, 'HI': 1, 'HE-lesions': 2, 'HeC': 2, 'BHIS': 1, 'HYDROXYETHYL METHACRYLATE/': 1, '-HEMA': 1, '2-hydroxyethylating carcinogens': 1, 'HE-PPD': 1, 'EFFECTS OF HYDROXYETHYL': 1, 'HESs': 3, 'HYDROXYETHYLATION OF AMINO': 1, 'HE': 2, 'HETA': 1, 'CA-HEMA': 1, 'CHEC': 1, 'hypoxic HBS': 1, 'HA': 1, 'UPHM': 2, 'ETHM': 2, 'PCNSs': 1, 'PCNSs-Ph': 1, 'IJA-HBS': 1, 'BETA-HYDROXYETHYL': 2, 'HEMIM': 1, 'GAMA': 1, 'HEH': 1, 'hydroxyethyl (HE) lesions': 1, 'pHH': 1, 'pHEMA': 2, 'CMCH': 1, 'CHITOSAN CHLORIDE-beta-GLYCEROL PHOSPHATE DISODIUM-HYDROXYETHYL': 1, 'HER': 1, 'LHM': 1, 'HPPH': 1, 'BLEEDING VOLUME INDICES OF HYDROXYETHYL': 1, 'HHS': 1, 'HEMABM': 1, 'TRI-HYDROXYETHYL-RUTOSIDE': 1, 'HEMC': 1, 'HEIDI': 1, '2-HYDROXYETHYL METHACRYLATE-CO-ITACONIC ACID': 1, 'PHN': 1, 'HEDC': 1, 'HECS-cc-OA': 1, 'DMRIE': 1, 'HES IONS': 1, 'HIDA': 1, 'HEDTA': 2, 'HES toxicity': 1, 'TZ': 1, 'HG-MCM': 1, 'BDH': 1, 'BDM': 1, 'pHEMDP': 1, 'PHS': 1, 'PHS-': 1, 'THEIC': 1}
|
HES
|
Disease
|
MESH:C535306
|
{'D-2-hydroxyglutarate dehydrogenase': 1, 'l-2-hydroxyglutaric aciduria': 30, '1-2-hydroxyglutaric aciduria': 1, 'HGA': 138, '2-hydroxyglutaric aciduria': 49, 'L-2-HGA': 44, 'L-2-Hydroxyglutaric aciduria': 36, 'L-2-hydroxyglutaric aciduria': 181, '(L)-2-hydroxyglutaric aciduria': 2, 'L-2 hydroxyglutaric aciduria': 23, 'D-2-HG aciduria': 4, 'L2HGA': 31, 'L-2-hidroxiglutaric aciduria': 1, '2-hydroxyglutarate aciduria': 2, 'L-2-hydroxyglutaric acidaemia': 1, 'L-2-Hydroxyglutaric acidaemia': 1, '2-HGA': 13, '2-Hydroxyglutaric acidurias': 2, '2-Hydroxyglutaric aciduria': 6, 'l-2-hydroxyglutaric-aciduria': 1, 'D-2-HGA': 36, 'D-2-hydroxyglutaric aciduria': 114, 'FIAU': 5, 'd-2- and l-2-hydroxyglutaric aciduria': 4, 'd-2-hydroxyglutaric aciduria': 21, 'hydroxyglutaric aciduria': 17, 'Tumor 2-HG': 3, 'tumor 2-HG': 2, '2-HG': 32, 'D2HG': 11, 'L 2': 1, 'l-2-Hydroxyglutaric aciduria': 9, 'CPS-L': 1, 'L2HGDH (L-2-hydroxyglutarate dehydrogenase) deficiency': 1, 'L.P. 2': 1, 'type L-2': 1, 'D-2-Hydroxyglutaric Aciduria': 3, '2 hydroxyglutaric aciduriaCerebrotendinous xanthomatosis': 1, 'D2HGA type I': 1, 'D- and L-2HG aciduria': 1, '2HGAs': 3, '2HG acidurias': 2, 'D-/L-2HGA': 1, 'D-2- and L-2-hydroxyglutaric aciduria': 22, 'D(2)Rs': 1, 'HGAs': 14, 'D-2-hydroxyglutaric acidurias (': 1, 'D-2-HGA) types I and II': 1, 'CNDAC': 8, 'L-2-hydroxyglutaric aciduria disease': 1, 'deficiency of 2-hydroxyglutarate dehydrogenase': 1, 'LTCC': 2, 'Type II D-2-HGA': 4, '2-Hydroxyglutaricaciduria': 1, 'L-2-hydroxyglataric aciduria': 1, '2F-Fuc': 1, 'D.2': 1, 'L, Less, type 2': 1, 'D-2 DISTILLER': 1, 'Df(2 L': 2, '/II 2-L': 1, 'DHGA': 6, 'L2HGA disease': 3, 'D-2HGA type II': 1, 'D-2-hydroxyglutaric aciduria (D-2HGA) type II': 1, 'T1(2)D': 2, 'Amyg_L_2': 2, 'weak D type 4.2.2': 2, 'D Type 4.2.2': 1, 'D type 4.2.2': 2, 'L-2-HG aciduria': 5, 'D/L-2-HGA': 8, 'D/L-2-hydroxyglutaric aciduria': 4, '3-hydroxyglutaric aciduria': 3, 'ALPHA-HYDROXYGLUTARATE': 1, 'l-2-HG aciduria': 1, 'l2 hydroxyglutaric aciduria': 1, 'l-2-Hydroxyglutaric (l-2-HG) aciduria': 1, '(l-2-HG) aciduria': 1, 'HGa': 3, 'L-2-OHG aciduria': 1, '2 D': 1, 'l-2 hydroxyglutaric aciduria': 6, 'Type II D-2-Hydroxyglutaric Aciduria': 1, 'Type II D-2-hydroxyglutaric aciduria': 1, 'type II D-2-hydroxyglutaric aciduria': 1, 'Type I D-2-HGA': 2, 'II D-2-HGA': 1, 'Type I and Type II D-2-hydroxyglutaric aciduria': 1, 'D,L-2-HGA': 4, 'd,l-2-hydroxyglutaric aciduria': 2, 'l-2-HG-related diseases': 1, 'D- and/or L-2-hydroxyglutaric acidurias': 1, 'L-2HGA': 4, 'FEAU': 2, 'D^2': 1, 'L2-hydroxyglutaric aciduria': 10, '+L 2': 1, 'L-2-HGDH deficiency': 1, 'D2L2AD': 2, 'L-2': 8, 'L-2-or D-2-hydroxyglutaric aciduria': 1, 'D-2-hydroxyglutaratic aciduria': 1, 'D(2)': 4, 'X-linked recessive 2-Hydroxyglutaric Aciduria': 1, '2HGA': 4, 'LHGA': 5, "2HGA's": 1, 'D(2': 1, 'L-2HG dehydrogenase (L2HGDH) deficiency': 1, 'D2-HGA': 1, '-HGA': 3, 'D2HGA': 9, 'D/L-2HGA': 1, 'd-2 hydroxyglutaric aciduria': 1, '2-hydroxyglutaric acidurias': 13, '2-hydroxyglutaric acidemia': 1, 'd-2-hydroxyglutaricaciduria': 1, 'D(2) agonist': 1, 'D- and L-2-hydroxyglutaric acidemias': 1, 'FAU-P': 1, 'FMAU': 3, 'FAU': 1, 'FMAU-P': 1, 'D-2': 4, 'D-2-hydroxyglutaric and gamma-hydroxybutyric acidurias': 1, 'L-2 hydoxyglutamic aciduria': 1, 'D-2-Hydroxyglutaric aciduria': 12, 'PHOSPHATIDYL-L-2-': 1, 'ISOLATION OF 2-AMINO-2-DEOXY-D-GALACTOSIDE DISACCHARIDE': 1, 'D2L2AD syndrome': 1, 'MED.D.2': 1, 'D- and L-2-hydroxyglutaric aciduria': 6, 'DL-2HGA': 2, '2-L': 1, 'D- and L-2 hydroxyglutaric aciduria': 1, 'D-and L-2-hydroxyglutaric aciduria': 1, 'type I and D-2-hydroxyglutaric aciduria': 1, 'NEWS2-L': 1, '(D)-2-hydroxyglutaric aciduria': 1, '(L)- or (D)-2-hydroxyglutaric aciduria': 1, '2-HG aciduria': 3, 'deficiency of (L)-2-HG dehydrogenase': 1, 'L-hydroxyglutaric aciduria': 2, 'L 2-hydroxyglutaric aciduria': 2, 'L-2- hydroxyglutaric aciduria': 2, 'D2-hydroxyglutaric aciduria': 4, 'MC-D2HGA': 1, 'Okonynedo (L) 2': 1, 'D-2-hydroxyglutaric acidurias': 1, 'D-2-hydroxyglutaric aciduria type I.': 3, 'D-2-hydroxyglutaric aciduria type II': 7, '9 D-2-hydroxyglutaric aciduria': 1, 'D-2-hydroxyglutaric aciduria type I and type II': 1, 'D, L-2-hydroxyglutaric aciduria': 1, 'D-2-hydroxyglutaric aciduria type I': 3, 'D-2-HGDH deficiency': 4, 'D-2-hydroxyglutaric acidaemia': 1, 'D-2-HGA (type II)': 1, 'L: -2-Hydroxyglutaric aciduria': 2, '2-hydroxyglutarate dehydrogenase deficiencies': 2, '2-hydroxyglutarate dehydrogenase deficiency': 3, 'd-2-hydroxyglutaric aciduria 2': 1, 'L-A-2': 3, 'L2hgdh deficiency': 1, 'L-2-OHGA': 1, 'hidratare orala 2 L': 1, 'D- or L-2-hydroxyglutaric aciduria': 2, 'Weak D Type 4.2.2': 1, 'LMH': 3, 'CHA 2 D': 1, 'L-2-hydroxyglutaric acidemia': 4, 'L(2)': 1, 'ASD-2': 1, 'Combined D,L-2-hydroxyglutaric aciduria': 1, 'D2-/L2-hydroxyglutaric aciduria': 2, 'METABOLISM L-2-HYDROXYGLUTARIC': 1, 'D-2-HYDROXYGLUTARIC ACIDURIA TYPE I': 1, 'D-2-hydroxyglutaric aciduria type 2.53': 1, 'L-2-Hydroxyglutaric Aciduria': 6, 'Combined D,L-2-Hydroxyglutaric Aciduria': 2, 'combined D,L-2-hydroxyglutaric aciduria': 1, 'D2HGA2': 4, 'HGA.Rifampin': 1, 'L-2 Chance fracture': 1, 'HICA': 1, 'd-l-2-hydroxyglutaric aciduria': 1, 'D,L-2HGA': 1, 'D,L-2- Hydroxyglutaric Aciduria': 1, 'Combined D,L-2HGA': 1, 'Combined D, L-2-Hydroxyglutaric Aciduria': 1, 'D- or L-hydroxyglutaric aciduria': 1, 'FIAU toxicity': 1, 'hydroxyglutaric aciduria metabolic disorders': 1, 'D. leontia AO-2': 1, 'LGA': 1, 'D-2HGA': 2, 'L-/D-2-hydroxyglutaric acidaemia': 1, 'inborn deficiency of L-2HG dehydrogenase': 1, 'L-2-hydroxyglutatric aciduria': 1, 'D-2 hydroxyglutaric aciduria type 2': 1, 'L2CH': 1, 'L2CP': 1, 'D2CH': 1, 'L2CB': 1, 'L2-Hydroxyglutaric aciduria': 2, 'D-2-BROMO LYSERGIC': 1, '- LABELLED 2-BROM-D-LYSERGIC': 1, 'BOL': 1, 'hydroxyglutaric acidurias': 2, 'd-2-hydroxyglutaric aciduria type II': 2, 'd-2-hydroxyglutaric aciduria (type I)': 1, 'D,l-2-hydroxyglutaric aciduria': 1, 'HgA': 4, 'HGA-Excess': 1, 'HGA-': 1, 'D-2-Deox': 1, '2.0 D': 1, 'd-2-/l-2-hydroxyglutaric aciduria': 1, 'D2HA': 2, 'OM 2 D': 1, 'L-2-haloacid': 4, 'R-2-hydroxyglutaric aciduria': 2, '2HG dehydrogenase deficiency': 1, 'GSDMD#2': 2, 'L. 1121-1-2': 1, 'D.II.2': 1, 'd-2-hydroxyglutarate aciduria syndrome': 1, 'L-2-HG': 1, 'D-2-HG': 7, 'L2-HGA': 2, 'AEC': 1, 'THROUGH 2-D': 1, 'L-2-ALNM': 1, 'type II d-hydroxyglutaric aciduria': 1, 'type I d-hydroxyglutaric aciduria': 1, 'BEN-GAL': 1, 'EFFECTS OF BENZYL 2-ACETAMIDO-2-DEOXY-alpha-D-GALACTOPYRANOSIDE': 1, 'combined D-2- and L-2-hydroxyglutaric aciduria': 1, 'D-2- and L-2-hydroxyglutaric aciduriaCongenital myasthenic syndrome': 1, 'D-2-hydroxyglutaric acidura type 1 or type 2': 1, 'D,L-2-hydroxyglutaric aciduria': 4, 'D-2-HGA type I': 3, 'L2HGDH (L2HG dehydrogenase) deficiency': 1, 'L2HGDH deficiency': 2, 'L2HG': 2, 'increased type 2 plus type 3 hydroxyglutaric acid': 1, 'D 2': 2, 'L-2-hydroxyglutaric Aciduria': 2, 'HGA-OLPs': 1, 'L- and D-2-hydroxyglutaric aciduria': 2, 'D2HGA1': 1, 'D-2-hydroxyglutaric aciduria type 1': 1, 'D-2-Hydroxyglutaric aciduria type 1': 1, 'SIOP 2': 1, 'l-2-HGA': 6, 'l-2-HGA aciduria': 1, 'EFFECTIVENESS OF VIDEIN D-2': 1, 'L-2/D-2-hydroxyglutaric aciduria': 1, 'CHA(2)D-VASc': 1, 'D-A-2': 1, 'OXIDIZE D(-)-1,2-PROPANEDIOL': 1, 'HGAU': 1, 'CDCS 2': 1, '2-D': 1, 'D-2HG aciduria': 3, 'L-2HG aciduria': 3, '-2-HG aciduria': 1, 'TPOS': 1, 'of L-2- hydroxyglutarate dehydrogenase': 1, 'L2HGDH': 4, 'D2HGDH-deficient diseases': 1, 'type I D-2-hydroxyglutaric aciduria': 2, 'type II D-2-HGA': 1, 'type I D-2-HGA': 2, 'deficiency of L2HGDH': 1, 'D2HGDH dysfunction': 1, 'COMPARATIVE STUDIES OF HELLEBORUS ORIENTALIS L. 2': 1, 'type I D-2HGA': 1, 'type II D-2HGA': 1, 'O-(2-acetamido-2-deoxy-D-glucopyranoseylidene) TKT': 1, 'HGA) tumors': 1, 'D-PIN': 1, 'D-THREONINE-2-C14': 1, 'D2HGA type II': 1, 'D-2-hydroxyglutaric aciduria (D2HGA) type II': 1, 'D: -2-hydroxyglutaric aciduria': 2, 'D: -2-HGA': 1, 'types 1 and 2 D-2-hydroxyglutaric aciduria': 1, 'D2HG aciduria': 1, 'L2-hydroxyglutaric-aciduria': 1, 'ENANTIOMERIC SYNTHESIS OF 2-C-METHYL-D-ERYTHRITOL 2,': 1, 'L-2OHGA aciduria': 1, 'glutaric aciduria type 1 and D, L-hydroxyglutaric aciduria': 1, 'D- and L-2OHGA aciduria': 1, '2.00 D': 3, 'L 2 hydroxyglutaric aciduria': 1, 'DL- 2HGA': 1, 'SOLID D(2)': 1, 'D-2-hydroxyglutaric aciduria 2': 2, 'L-2 Hydroxyglutaric aciduria': 2, 'D-2-hydroxyglutaric aciduria (D-2-HGA) type II': 1, 'D-2-Hydroxyglutaric Aciduria Type II': 1, 'D-2-HGA type II': 4, 'd-2-Hydroxyglutaric aciduria': 2, 'D-2 and L-2-hydroxyglutaric aciduria': 1, 'FDG incidentaloma': 1, 'L-2-': 1, 'L. brevis 2': 1, 'D- and L-2-Hydroxyglutaric Aciduria': 1, 'HGA-ACO': 1, 'TBC-D': 1, 'd-2-HGA': 3, 'd-2-HG': 2, 'Metaphyseal chondromatosis with D-2-hydroxyglutaric aciduria': 2, 'MC-HGA': 4, 'ADM': 1, 'L-2 Hydroxyglutaric Aciduria': 4, 'HPCD': 1, 'Hydroxyglutaric aciduria': 4, 'deficiency of L-2-hydroxyglutarate dehydrogenase': 6, 'D- or L-2-HG aciduria': 1, 'D-2- and L-2 hydroxyglutaric aciduria': 1, '2-L-hydroxyglutaric acidaemia': 1, '-HYDROXYGLUTARIC': 1, '2 PAmp;D': 1, 'd-2-hydroxyglutaric acid dehydrogenase deficiency': 1, 'deficiency of d-2-hydroxyglutaric acid dehydrogenase': 1, 'D-2-hydroxyglutaric acid dehydrogenase deficiency': 1, 'hydroxyglutaricaciduria': 1, 'L-2-hydroxiglutaric aciduria': 1, 'LGMD 2 L': 1, 'inborn errors of 2HG': 1, 'L.2': 2, 'L.2-cut': 2, 'D-APV': 1, 'D-2-BROMO-LYSERGIC': 1, 'L(2)GL': 1, 'HGA oxidase deficiency': 1, 'l-2-hydroxyglutaric acid aciduria': 1, 'nDi.2.2.D. immitis': 1, 'L2 or D2 hydroxyglutaric aciduria': 1, 'HGA tumors': 1, 'HGA of the thalamus': 1, '2dDR': 3, 'L-2-hydroxyglutaricaciduria': 2, 'L-2_HGA': 1, 'L-2-hydroxyglutarate dehydrogenase deficiency': 2, 'L-ISOMERS OF 2-': 1, 'Morcher Type 2 L': 1, 'OFFICINALE L. 2': 1, 'DDR': 1, 'LHGuria': 1, '2-DEOXY-D-RIBOSE': 1, 'OF D-2HG': 1, 'type 2 D-2-HGA': 1, 'L2-Hydroxyglutaric Aciduria': 2, 'D2-Hydroxyglutaric Aciduria': 1, 'D-2-HGA type I and II': 1, 'H-2 D': 1, 'l-2 hydroxyglutaric acidemia': 1, 'L2HG aciduria': 1, 'L-2-hydroxyglutarate Dehydrogenase deficiency': 1, 'H2A.L.2': 1, '2-hydroxyglutaric aciduria syndrome': 1, '2HG aciduria': 2, 'Bruceine D (2)': 1, 'FR': 1, 'I(2)D.': 1, 'deficiency of D2-HG dehydrogenase': 1, 'D2HGDH': 1, 'D-2HG': 1, 'D-2-, L-2-hydroxyglutaric aciduria': 1, 'inborn error D-2-HGA Type I': 1, '-2-HGA': 1, 'D-2-HGA Type II': 1, 'D-2-HGA Type I': 1, 'D-2-hydroxyglutaric aciduria Type I': 1, 'D2HGA syndrome': 1, 'type II D2HGA': 1, 'D,L2-hydroxyglutaric aciduria': 1, '16 L-2-hydroxyglutaric aciduria': 1, 'L.2-cut haiku': 1, 'L.2-': 1, 'd- or l-2-hydroxyglutaric aciduria': 1, '2HG': 2, '2-hydroxyglutaric aciduria disease': 1, 'l-2 Hydroxyglutaric aciduria': 1, 'D-2-HGDH-deficient diseases': 1, 'D-2-HGDH-deficient': 1, 'autosomal dominant D-2-hydroxyglutaric aciduria-2': 1, 'R-2-HG': 2, 'D2-HG': 1, 'D2 and L2 hydroxyglutaric aciduria': 1, 'L.A.FANS-2': 1, 'L-2-HYDROXYGLUTARIC ACIDURIA': 1, 'COMBINED D-2- AND': 1, 'pLGA-HGA': 1, 'D-2 hydroxyglutaric aciduria': 1, 'L2HDH': 1, '2-HGA type I': 1, 'D-2-HGA type I.': 1, 'd-2-Hydroxyglutarate': 1, 'L -2-hydroxyglutaric aciduria': 1, 'L: -2-OHGA': 1, 'L -2-OHGA': 1, 'L -2-Hydroxyglutaric aciduria': 1, 'LLA': 1, 'D-2-': 1, 'L-2- HGA': 1, '-2-hydroxyglutaric aciduria': 1, 'd,l-2-HGA': 1, 'IDENTIFICATION OF 2-ACETAMIDO-1-beta-(L-beta-ASPARTAMIDO)-1,2-DIDEOXY-D-GLUCOSE FROM PARTIAL': 1, 'l-2-Hydroxyglutarate aciduria': 1, 'glutaric and 3-hydroxyglutaric aciduria': 1, 'D2-/L2- hydroxyglutaric (HG) aciduria': 1, 'SEPARATION OF D,L-THREO-1-P-NITROPHENYL-2-AMINO-1,3-PROPANEDIOL': 1, 'Intermittent SW D (IFSWD) 2': 1, 'D(2) blockade': 1, 'l-2-HG': 1, 'type I d-2-hydroxyglutaric aciduria': 1, '2-AMINO-2-ISOXY-D-GLUCURONIC': 1, 'D- and L-acidurias': 1, '2-HG acidurias': 2, 'D- and L- acidurias': 1, 'L-2-HG acidurias': 1, 'Combined D-2- and L-2-hydroxyglutaric aciduria': 1, 'L-2 anomalies': 1, 'CNDAC-TP': 1, 'ST-2-L': 1, 'ST-2-L.': 1, 'FGD 2-L': 1, 'beta-hydroxyglutaric aciduria': 1, 'ACIDS AFTER 2-DEOXY-D-': 1, 'D-2-OHGA': 2, '2-D-hydroxyglutaric aciduria': 1, 'HgAS': 1, 'IRT 2 D': 1, 'L-2-Hydroxyglutaric (L-2-HG) aciduria': 1, 'L-2-hydroglutaric aciduria': 1, 'MES D': 1, '2-amino-apidic and 2 oxoapidic aciduria': 1, 'L: -2-hydroxyglutaric aciduria': 1, 'D-2-hydroglutaric aciduria': 1, 'metaphyseal chondromatosis with D-2-hydroxyglutaric aciduria': 1, 'D(2)-TYPE DOPAMINERGIC': 1, 'D-2- and L-2-HGA': 1, 'd-2-hydroxyglutaric aciduria type I and II': 1, 'D-2-HGA types I and II': 1, 'D-2-HGA type I and type I': 1, '-HGA type II': 1, 'D-2-HGA type I or II': 1, 'D-2-HGA type I D-2-HGA type II': 1, 'D-2-HGA type I or type II disease': 1, 'D-2-HGA defect': 1, 'D-2-HGA type I and II disorders': 1, 'D-2-HGA type I and type II': 1}
|
L-2-hydroxyglutaric aciduria
|
Disease
|
MESH:C535307
|
{'2-methylacetoacetyl-coenzyme A thiolase) deficiency': 1, '2-methylacetoacetyl-CoA thiolase deficiency': 11, '2-methylacetoacetyl CoA thiolase deficiency': 3, 'MAT deficiency': 4, 'Methylacetoacetyl-coenzyme A thiolase (MAT) deficiency': 1, 'THI': 1, 'methylacetoacetyl-CoA thiolase deficiency': 1, 'beta-Ketothiolase (2-methylacetoacetyl-CoA thiolase) deficiency': 1, '2-methylacetoacetyl-coenzyme A thiolase deficiency': 2, 'trypanosomal thiolase': 1, 'thiolase': 2, 'THIO deficiency': 1, 'THIO': 1, 'mitochondrial methylacetoacetyl-coenzyme A thiolase deficiency': 1, '2-methylacetoacetyl-coenzyme A thiolase (beta-ketothiolase': 1, 'MATD': 1, '2-methylacetoacetyl-coenzyme A thiolase (beta-ketothiolase) deficiency': 1, 'peroxisomal thiolase deficiency': 6, 'thiolase-deficient': 1, 'thiolase deficiency': 2, 'Mitochondrial 2-methylacetoacetyl-CoA thiolase deficiency': 2, 'mitochondrial 2-methylacetoacetyl-CoA thiolase deficiency': 2, '2-methyl-ketoacetyl-CoA-thiolase deficiency': 1, 'mitochondrial 2-methylacetoacetyl CoA thiolase deficiency': 1, '2-methylacetoacetyl-coenzyme A (beta-keto)thiolase deficiency': 1, 'deficiency of 2-methylacetoacetyl-CoA thiolase': 1, '2-methylacetoacetyl-coenzyme A thiolase (MAT) deficiency': 1, 'MAT deficient': 1, 'acetoaceyl-CoA thiolase deficiency': 1, 'THIOLASE': 1}
|
2-methylacetoacetyl-CoA thiolase deficiency
|
Disease
|
MESH:C535308
|
{'MCCs': 571, 'RP-I': 1, 'I-SCAN-3': 2, 'CDC': 1, '3-methylcrotonyl-CoA carboxylase (MCC) deficiency': 9, 'MCC deficiency': 24, '3-methylcrotonyl-CoA carboxylase deficiency': 110, '3-methlycrotonyl-CoA carboxylase deficiency': 2, 'CCR': 2, 'I stage 3': 1, 'Deficiency of 3-methylcrotonyl-coenzyme A carboxylase': 1, 'alpha-1,3-mannosyltransferase deficiency': 3, 'ACC': 4, 'primary cutaneous MCCs': 3, '3-Methylcrotonyl-CoA carboxylase 1 deficiency': 2, '3-methylcrotonyl-CoA dehydrogenase deficiency': 1, '3-MCC': 12, '3-methylcrotonyl CoA carboxylase deficiency': 16, '3-methylcrotonyl-coa-carboxylase': 1, 'I 3': 4, 'MCCD': 40, '3MCCD': 6, 'MCCs of': 3, 'mcc': 11, '3-methylcrotonyl-coenzyme A carboxylase deficiency': 12, 'methylcrotonylglycinuria': 17, 'Deficiencies in MCC': 2, '3-methylcrotonylglycinuria': 32, 'MCG': 7, 'MCC': 20, 'mCC': 32, 'Mcc-facp': 3, '3-MCC, 3-Methylcrotonyl-CoA carboxylase deficiency': 1, '-Methylcrotonyl-CoA carboxylase': 1, '3-Methylcrotonyl-CoA carboxylase deficiency': 28, '3-MCCD': 19, '3- methylcroton acyl coenzyme A carboxylase deficiency': 1, 'cGKI-deficient': 1, 'cGKI-/-': 1, 'TOLD-I:3': 4, 'NA I Metastatic 3': 1, 'MCCs of skin': 1, 'MCCs of the skin': 1, 'Lymph nodal and cutaneous MCCs': 1, 'nodal MCCs': 1, 'cutaneous MCCs': 6, 'MDG I': 1, 'deficiency of 3-methylcrotonyl CoA carboxylase': 1, 'Mcc-cp': 4, 'Mcc': 11, '3-methylcrotonyl-CoA': 1, '3-methylcrotonyl coenzyme A carboxylase (MCC) deficiency': 2, '3-methylcrotonyl-CoA carboxylase A subunit deficiency': 1, 'stage I MCCs': 1, 'Stage I and II MCCs': 1, 'GCC': 2, 'VP-MCC': 1, '3-methylcrotonyl glycinuria': 4, 'I and 3': 1, 'deficiency of 3-methylcrotonyl-CoA carboxylase': 16, '-methylcrotonylglycinuria': 1, 'bMCC': 1, 'gastric MCCs': 1, 'MCC1': 5, 'methylcrotonyl-CoA carboxylase deficiency': 2, '3-Methylcrotonyl-CoA-carboxylase deficiency': 1, 'I.3.2 .': 1, 'H&N MCCs': 2, 'PaMCC': 1, '3-methylcrotonyl-coenzymeAcarboxylasedeficiency': 1, '3-methylcrotonyl-CoA carboxylase (3-MCC) deficiency': 9, 'Stage I 5 II 3 III': 1, 'GTKO': 1, '3-methylcrotonyl coenzyme A carboxylase deficiency': 3, '3-Methylcrotonyl-CoA Carboxylase Deficiency': 6, '3-MCC deficiency': 15, 'I-3-rut': 1, 'Deficiency in the MCC': 1, '3-Methylcrotonyl-coenzyme A carboxylase deficiency': 2, 'primary MCCs': 2, 'PP-I-3': 1, '-I-3': 1, '3MCC deficiency': 3, 'beta-methylcrotonylglycinuria': 9, '3-methylcrotonyl-CoA carboxylase 1 deficiency': 3, 'TT-IPC-I': 1, 'CIN2/3 I/II': 1, 'deficiency in 3-methylcrotonyl-CoA carboxylase': 1, 'Methylcrotonyl-CoA': 1, 'TNM stage I 3': 1, 'methylcrotonyl-CoA carboxylase (MCC) deficiency': 1, 'Methylcrotonyl-CoA carboxylase (MCC) deficiency': 1, '3-Methylcrotonyl-CoA carboxylase (3-MCC) deficiency 4': 1, 'AS 1 CoA': 1, '2, 3 - Puri I and II': 1, 'MCC deficiencies': 1, 'MCC deficient': 2, 'Isolated 3-methylcrotonyl-CoA carboxylase (MCC) deficiency': 2, 'I-3': 6, 'Methylcrotonylglycinuria': 5, 'MCC-deficient': 4, 'TNM stage I 3 II': 1, 'deficiency of 3-methycrotonyl-CoA carboxylase': 1, 'ACTIVE SITE OF DEOXYRIBONUCLEASE I. 3': 1, 'MCc': 5, 'Mcc-CPR': 1, '3-Methylcrontonyl CoA Carboxylase deficiency': 1, 'UV-MCCs': 1, 'virus-associated MCCs': 1, 'Methylcrotonyl-Coa carboxylase deficiency': 1, 'Maple syrup urine disease 3-methylcrotonyl-CoA carboxylase deficiency': 1, '3-methylcrotonyl-CoA-carboxylase deficiency': 2, 'beta-methylcrotonyl-CoA carboxylase deficiency': 2, '3-methylcrotonyl aciduria': 1, 'FIGO stage I 3': 1, 'Deficiency of MCC': 2, 'Stage I 3 II 4 III': 1, 'Mosaoka-Koga stage I 3': 1, 'deficiency of alpha-1,3-mannosyltransferase': 1, 'alpha-1,3-mannosyltransferase': 1, 'Mcc-facp hearts': 1, 'GI-3': 1, 'isolated MCC deficiency': 2, 'Deficiency of 3-methylcrotonyl-CoA carboxylase': 3, 'FIGO stage I 3': 2, 'abnormalities of collagen type 3 alpha 1': 1, 'alpha-1,3-glucosyltransferase deficiency': 1, '3-methylcrotonyl carboxylase deficiency': 2, 'OMT-I': 1, 'A.I.3': 1, 'IRS Group I 3': 1, 'PHOTAC-I-3': 2, 'Beta-methylcrotonyl-CoA carboxylase deficiency': 1, '3-methylcromaryl coenzyme A carboxylase deficiency': 1, 'MCCase deficiency': 1, '3MCC': 3, '3-methylcrotonyl-coenzyme A carboxylase (3-MCC) deficiency': 1, '3-Methylcrotonyl-coenzyme A carboxylase (3-MCC) deficiency': 1, 'maternal 3-MCC deficiency': 1, 'Maternal 3-MCC deficiency': 1, 'inborn errors of 3-methylcrotonyl CoA carboxylase': 1, '3-Methylcrotonyl CoA carboxylase deficiency': 1, 'MCCA': 1, 'METHYLCROTONYL-COA CARBOXYLASE': 1, 'MCC-NIES': 1, 'deficiency of MCC': 3, 'isolated 3-methylcrotonyl-CoA carboxylase (MCC) deficiency': 1, 'RIPA': 2, 'mCC-': 1, '3-Methylcrotonyl-CoA carboxylase': 3, '-V-I.3': 1, 'Alpha-Gal-Syndrom': 1, 'AGS-': 1, 'AGS': 4, '3-MCC-deficient': 1, '3-methylcrotonyl-CoA-carboxylase (3-MCC) deficiency': 1, '3-MCC deficiency metabolic diseases': 1, 'deficiency of MCC activity': 1, '3-methyl-crotonyl-CoA-carboxylase deficiency': 3, 'AG-': 1, 'AG-deficient': 1, 'AG': 1, 'mCCs': 2, '3-Methylcrotonylglycinuria': 8, '3-methyl-crotonyl-CoA carboxylase (3-MCC) deficiency': 1, 'UICC stagea I 3': 1, 'deficiency of 3-methylocrotonyl-CoA carboxylase': 1, '3-MCG': 1, '3-methylcrotonyl-CoA carboxylase (3MCC) deficiency': 1, '3-methylcrotyl CoA carboxylase deficiency': 1, '3-Methylcrotonyl-CoA Carboxylase deficiency': 1, '3-MCCD 3-methylcrotonyl-CoA-carboxylase deficiency': 1, 'GI.3 NoV infections': 1, 'GI.3 NoV Infection': 1, '3-methylcrotonyl-coenzyme: a carboxylase deficiency': 1, 'I-12CMS(3)': 3, 'CuAAC': 2, 'Man9GlcNAc2 alpha-1,3 glucosyltransferase deficiency': 1, 'Isolated 3-methylcrotonyl-CoA carboxylase deficiency': 1, 'excavated tarsus I(3)': 1, 'Stage I 14 II 3 III': 1, '3-Methylcrotonyl-': 1, '3-methylcrotomly-coenzyme A carboxylase deficiency': 1, '3-methylcrotonyl coenzyme A (CoA) carboxylase deficiency': 2, '3 methylcrotonyl coenzyme A dehydrogenase deficiency': 1, '3-Methylcrotonyl Carboxylase deficiency': 1, 'I and 3 as': 1, 'I-12CMS(3': 1, 'maternal 3-methylcrotonyl coenzyme deficiency': 1, 'methylcrotonyl-coenzyme A carboxylase deficiency': 1, '3-MethylcrotonylCoA-carboxylase deficiency': 1, 'CH(3)I': 1, 'Stage I-IIIANSCLC 3': 1, '3-Methyl Crotonyl-CoA Carboxylase Deficiency': 1, 'MCCs of the eyelid': 1, 'MCCs of oral cavity': 1, 'I (3)': 1, '3-Methylcrotonyl-CoA: carboxylase (EC 6.4.1.4': 1, '3-methylcrotonyl-CoA: carboxylase deficiency': 1, '3-Methylcrotonyl-CoA carboxylase (MCC) deficiency': 3, 'NR NR I 3, II': 1, 'GI NS1-3': 1, 'deficiencies of MCC': 1, '3-methylcrotonyl-coa-carboxylase deficiency': 1, 'RS-I-3': 1, 'AAC(3)-I': 2, 'GalTKO': 2, 'MCCs of the': 1, 'deficiency of 3-methylcrotonyl coenzyme A carboxylase': 1, 'biotin-resistant 3-methylcrotonyl-CoA carboxylase (MCC) deficiency': 1, '(biotin-resistant) 3-methylcrotonyl-CoA carboxylase deficiency': 1, 'MACI 1, 3 I': 1, 'UNKP-19-3-I-': 1, 'Isovaleric academia 3-methylcrotonyol-CoA carboxylase deficiency': 1, 'MCG-3:3-methylcrotonyl-CoA carboxylase deficiency': 1, '3-Methyl-crotonylglycine-CoA carboxylase deficiency': 1, '3-MCC deficit': 1, '3-MCC defect': 1, '3-methyl-crotonyl-CoA carboxylase deficiency': 3, 'I ARFs 1 and 3': 1, 'deficiencies of 3-methylcrotonyl-CoA carboxylase and': 1, 'alpha(1,3)-fucosyltransferase gene deficiency': 1, 'alpha(1,3)-fucosyltransferase deficiency': 1, 'H & Y I II III 3': 1, '3-methylcro-tonyl-CoA carboxylase deficiency': 1, '3-Methyl CoA carboxylase (3-MCC) deficiency': 1, '3-methylcrotonyl CoA carboxylase (3-MCC) deficiency': 2, '3-methylcrotonyl-coenzyme A carboxylase (3MCC) deficiency': 1, '3MCC-deficient': 1, '3MCC deficient': 1, 'stage IIIB MCCs': 1, 'DF I,3': 1, 'BMcC': 1, 'ACC-PCC': 1, 'inborn genetic deficiency of MCC': 1, 'deficiency of either MCC': 1, 'MCCC': 1, 'PI3KCI': 1, 'CARBOXYLASE COENZYME ON': 1, 'Lewis alpha(1,3/1,4)-fucosyltransferase gene deficiency': 1, 'DSM-IV Axis I disorders (SCID-I)3': 1, 'VRPKS-I-3': 1, '3-Methyl crotonyl CoA carboxylase (3MCC) deficiency': 1, 'GAG': 1, '1 3-methylcrotonyl-CoA carboxylase deficiency': 1, 'MCCC1 deficiency': 1, 'Isolated 3-Methylcrotonyl-CoA carboxylase deficiency': 1, 'deficiency of 3-methylcrotonyl-CoA carboxylase activity': 1, 'methylcrotonylglycinuria type I': 1, 'FUTs': 1, 'Clinical stage I 47 II 3 III': 1, 'ACC1': 1, '3MCCCase': 1, '3-methylcrotonyl-coenzyme A Carboxylase Deficiency': 1, '3-methylcrotonyl-CoA and propionyl-CoA carboxylase deficiencies': 1, 'beta-methylcrotonyl-coenzyme A carboxylase deficiency': 1, 'genetic deficiency of MCC': 1, '3- methylcrotonyl CoA carboxylase deficiency': 1, '3-methylcrotonyl-CoA carboxylase deficiencies': 1, 'Mcc Kid': 1, 'alpha 1,3-fucosyltransferase deficiency': 1, '3-methylcronyl-CoA carboxylase deficiency': 1, 'ACPCC': 1, '-McC': 1, '3-I': 1, '3-methylcrotonyl-coenzyme A (CoA) carboxylase deficiency': 1, 'biotin-resistant 3-methylcrotonyl CoA carboxylase deficiency': 1, 'Methylcrotonyl-CoA carboxylase deficiency': 1, '3-methylcrotonyl-CoA carboxylase': 2, 'PCD, 3-MCCD': 1, 'TNM stage I 3': 1, 'LEVEL I:3': 1, '3MCC)': 1, 'Mcc-fa': 1, '-I 3': 1, 'GI.3[P3': 1, '3-methylcrotonyl-coenzyme A deficiency': 1, 'I. 1-SULFONYL-3-': 1, 'methylcrotonoyl-CoA carboxylase 1 deficiency': 1, 'McCs': 1, 'deficiency of 3-methylcrotonyl-coenzyme A carboxylase': 1, '3-Methylcrotonyl-CoA carboxylase (3-MCC) deficiency': 1, 'Primary and maternal 3-methylcrotonyl-CoA carboxylase deficiency': 1, '3-Methylcrotonyl CoA deficiency': 1, 'ATII-I Cluster 3 2': 1, 'Alpha-1,3-mannosyltransferase (ALG3) deficiency': 1, 'Alpha-1,3-glucosyltransferase deficiency': 1, '3-methyl crotonyl-CoA carboxylase deficiency': 1, '3-methylcrotonyl-glycinuria': 1, 'Maternal 3-Methylcrotonyl-Glycinuria': 1, '3-methylcrotonyl coenzyme A carboxylase (MCCC) deficiency': 1, '3-cethyl crotonyl-CoA carboxylase deficiency': 1, 'Inherited deficiency of 3-methylcrotonyl-CoA carboxylase': 1, '3-MCCd': 1, 'McC alpha+thalassaemia': 1, 'methylcrotonyl CoA carboxylase': 1, 'methylcrotonyl': 1}
|
MCCs
|
Disease
|
MESH:C535309
|
{'II 3': 6, 'TADDOL': 1, '3 II BC9': 1, '3 II BC3': 1, '3 II BC6': 1, '3 II BC4': 1, '3 II BC5': 1, 'MPB': 1, 'GII.3': 4, 'A-II-3': 4, 'LC-3-II': 1, '3-ALPHA': 2, 'ICCC-3 II': 1, 'EOPC': 1, 'EEPC': 2, 'aac(3)-II': 1, 'HEC': 1, 'Asia II 3': 4, '-alpha 3.7I-thalassaemia': 1, 'PIDs II-2 and II-3': 1, 'PID II-3': 4, 'H/II-3': 1, 'II.3': 3, '3-EPI-ALPHA': 1, 'cN0-3 alpha': 2, 'PP-II-3': 1, 'alpha-actinin-3': 3, 'II-3': 10, '-II-3': 7, 'F8-II:3': 1, 'MCC2': 2, '/II-3': 1, 'A/II-3': 1, '3AC': 1, 'RS-II-3': 1, 'HeartMate (HM) II or 3': 1, 'A.II-3': 1, 'alpha-2,3-sialylated N-glycans': 1, '3-methylcrotonyl-CoA carboxylase 2 deficiency': 2, ', II (0), III (3': 1, 'BC': 1, 'alpha-neurotoxic 3FTx': 1, 'II LC1/3': 1, 'II-A-3': 2, 'NP II:3': 1, 'ALPHA-3': 2, 'venous (II-3, II-5) and arterial (II-9) thrombosis': 1, 'ALPHA-ETHYNYLESTRADIOL-3-METHYLETHER': 1, 'ALPHA-3-THENYLACETOXY': 1, 'FC 780, II-3': 1, 'PID II-3, II-9,': 1, 'PIDs II-2, II-3, II-6, II-9, III': 1, 'DLPC': 1, 'ICHD-II 8.3': 1, 'WS03-II:3': 1, 'II:3': 2, 'AAC(3)-II': 1, '2-ALPHA-HALO-4-EN-3-OXO': 1, 'DO-II-3': 1, 'CH-3 II': 1, 'II 3 III': 1, 'T1-3 or II': 1, 'PIDs II-5, II-3': 1, 'H II-3': 1, 'alpha-3 globulinemia': 1, 'PHARMACOLOGICAL PROPERTIES OF 3-ALPHA-PHENYLPROPYL-5': 1, '3 II 0': 1, 'SL II': 1, 'methylcrotonylglycinuria type II': 1, 'GIIb/II.3': 1, 'II 3 (': 1, 'alpha-actinin-3-': 1, 'ALPHA,12-ALPHA-DIOL-3-ONE': 1, 'FF-II-3': 1, 'CYTOCHROME ALPHA-3': 1, 'F4-II-3': 1, 'II-3,': 1, 'ALPK3tv': 1, 'AIC': 1, 'lactosylceramide alpha-2,3-sialyltransferase) deficiency': 1, 'of ACTN3': 1, 'G3-II': 1, 'tyrosinemia type I,2-hydroxyglutaratemia,3-methylcrotonyl -CoA carboxylase deficiency': 1, 'TBI': 1}
|
II-3
|
Disease
|
MESH:C535310
|
{'HAD': 2009, 'HAD Complera': 1, 'HAD-A': 71, 'HAD-D': 99, 'LC': 4, 'HAD-DI': 3, 'ARTICLE HAD': 17, 'HAD-2': 4, 'HAD-1': 9, 'Short-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 5, 'HAD VOLUNTARILY': 1, 'HAD-depression': 3, 'DLPC': 4, 'HAD-': 31, 'ENA HAD': 1, 'HAD-like syndrome': 1, 'HAD CHANCES': 1, 'HOAD': 10, 'HADH deficiency': 13, '3-Hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, '3-Hydroxyacyl-Coenzyme A Dehydrogenase Deficiency': 1, 'medium- and short-chain L-3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'SCHAD deficiency': 31, 'ALL FACILITIES HAD': 1, 'HAD ADDED THIS': 1, 'HAD AMENDED': 1, 'HISTORY OF HAVING HAD AN STD': 1, 'HAD_A': 1, 'HAD_D': 3, '3-hydroxyacyl-CoA dehydrogenase deficiency': 9, '3-alpha-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'deficiency of short-chain 3-hydroxyacyl-CoA dehydrogenase': 1, 'Deficiency of 3-hydroxyacyl-CoA-dehydrogenase': 1, 'SCHAD deficient': 3, 'L-CHAINS': 1, 'L-3-hydroxyacyl-CoA dehydrogenase (LCHAD) deficiency': 1, 'and short-chain-3-hydroxyacyl-CoA dehydrogenase': 1, 'SCHAD deficiencies': 1, 'HAD ALL': 1, 'beta-HAD': 1, 'HD': 3, 'HAVE HAD': 1, 'HAD ONE': 1, 'THIS ARTICLE HAD': 6, 'Short-chain 3-hydroxyacyl-CoA dehydrogenase (SCHAD) deficiency': 2, 'CREATINE LEVELS HAD': 1, 'TERRAIN HAD': 1, 'HAD-L': 1, 'TDK-HAD': 1, 'TCM-HAD': 1, 'L-3-hydroxyacyl-CoA dehydrogenase bifunctional protein': 1, 'GalLDH': 2, 'HAD depression': 37, 'D-3-hydroxyacyl-CoA dehydrogenase bifunctional protein (': 1, 'HAD D': 4, 'HAD A': 2, 'AMERICANS HAD': 1, 'HAD#14': 1, 'USC-HAD': 1, 'UCI-HAD': 1, 'Medium-chain 3-hydroxyacyl-CoA deficiency': 4, 'Tdh': 1, 'deficiencies of 3-hydroxyacyl-CoA dehydrogenase': 1, 'SCHAD': 26, 'short-chain 3-hydroxyacyl-CoA dehydrogenase': 3, 'JDD.6274THIS ARTICLE HAD': 1, 'HAD-MS': 1, 'CYCLE-INHIBITING GENES THAT HAD': 1, 'HCD': 13, 'SCHAD deficiency hyperinsulinism': 1, 'deficiency of SCHAD': 1, 'SCHAD Deficiency': 1, 'M/SCHAD deficiency': 2, 'HAD Depression': 4, 'HAD)': 1, 'HAD-T': 4, 'short-chain 3-hydroxyacyl coenzyme A dehydrogenase deficiency': 1, 'SCHAD-CHI': 3, 'SCHADKO': 1, 'SCHAD CHI': 1, 'L-3-hydroxyacyl-CoA dehydrogenase deficiency': 2, 'short chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short chain 3-hydroxyacyl-CoA dehydrogenase': 1, 'HAD-Depression': 2, 'HAD-LAD': 1, 'HAD-A.': 4, 'HAD-D.': 7, 'HAD-A&HAD-D': 1, 'HADHSC': 2, 'SCHAD-HI': 3, 'SCHAD-hyperinsulinism': 1, 'Short-chain 3-hydroxyacyl-CoA (SCHAD) deficiency': 1, 'TARGET HAD': 1, 'HAD-S': 6, 'HDH': 3, 'HAS HAD': 1, 'Ehhadh deficiency': 1, 'Ehhadh deficiency of': 1, '3-hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'L-3 hydroxyacyl coenzyme A dehydrogenases (M/SCHAD) deficiency': 1, 'ENTEROSTOMY HAD': 1, 'HADH HH': 1, '2-HAD': 1, 'HAD deficiency': 5, 'Deficiency of enoyl-CoA hydratase: 3-hydroxyacyl-CoA dehydrogenase': 1, 'HAD LISTED ONE SPECIES': 1, 'HAD HAD': 1, 'short-chain L-3-hydroxyacyl-coenzyme A dehydrogenase (SCHAD) deficiency': 1, 'short-chain L-3-hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, '3-Hydroxyacyl-CoA dehydrogenase': 1, 'cHAD': 1, 'HAD-V': 1, 'HAD MEASLES': 2, '3-OH-GA': 1, 'HAD MPS': 2, 'short-chain-3 hydroxyacyl-CoA dehydrogenase deficiency': 1, 'L-CHAIN': 2, 'EHHADH deficiency': 1, 'acyl-CoA dehydrogenase deficiencies': 1, 'Short-chain 3-hydroxyacyl-CoA dehydrogenase': 2, 'HIV-HAD': 1, 'HAD-14': 1, 'H AND L CHAINS OF': 1, 'HAD Stress': 1, 'HAD HISTORIES OF': 1, 'Short-chain hydroxyacyl CoA dehydrogenase deficiency': 1, 'Short-chain L-3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short-chain L-3-hydroxyacyl-coenzyme A (CoA) dehydrogenase deficiency': 1, '3-hydroxyacyl-CoA dehydrogenase deficiencies': 2, '3-hydroxyacyl-CoA dehydrogenase (': 1, 'HAD) deficiency': 2, 'THAT HAD': 1, 'short-chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) deficiency': 1, 'HAD-HF': 1, 'SCHAD) deficiency': 2, 'PATIENT HAD': 2, 'HAD-A/D': 2, 'HAD defect': 1, 'short- and medium-chain 3-hydroxyacyl-CoA dehydrogenase (M/SCHAD) deficiency': 1, '3-Hydroxyacyl-CoA dehydrogenase (HAD) deficiency': 1, '3-hydroxyacyl coenzyme A dehydrogenase deficiency': 1, 'short-chain L-3-hydroxyacyl-CoA (SCHAD) deficiency': 2, 'HAD THE SYNDROME': 3, 'Short-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency': 1, '-chain 3-hydroxyacyl-CoA dehydrogenase': 1, 'ss-HAD': 1, '3-hydroxyacyl-CoA dehydrogenase': 1, 'L-CHAIN DIMERS': 1, 'HAD neurodegeneration': 1, '3-Hydroxyacyl-CoA dehydrogenase deficiency': 2, 'HAD THREE DISTINCT': 1, 'Mitochondrial short-chain L-3-hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'deficiency of short-chain L-3-hydroxyacyl-CoA dehydrogenase': 1, 'HAD-A&D': 1, 'HAD-35': 1, 'Medium/short-chain L-3-hydroxyacyl-CoA dehydrogenase': 1, 'HAD-RMS': 1, 'JDD.5701THIS ARTICLE HAD': 1, 'short-chain hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'Short-chain hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'short-chain L-3-hydroxyacyl-CoA dehydrogenase deficiencies': 2, 'L-3-hydroxyacyl-CoA dehydrogenase': 2, 'chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short-chain L-3-hydroxyacyl-CoA (SCHAD, HADH) deficiency': 1, 'HAD A.': 1, 'HAA HAD': 1, 'HAD IA': 1, 'HPV VACCINATION HAD': 1, 'HAD Covid': 1, 'Medium chain 3-hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'GulLDH': 1, 'HAD SIBLINGS': 1, 'LAD': 2, 'L-HAD': 1, 'Deficient of 3-Hydroxyacyl-ACP dehydratase': 1, 'HADHSC-deficient': 1, 'HADHSC deficiency': 1, 'Depression HAD': 2, 'HAD-1 rats': 1, 'short-chain L-3-hydroxyacyl-CoA dehydrogenase deficiency': 3, 'Short-chain 3-hydroxyacyl-coenzyme A dehydrogenase hyperinsulinism': 1, '3-hydoxyacyl-CoA dehydrogenase deficiency': 1, 'JDD.6031THIS ARTICLE HAD': 1, 'WHERE MEASLES HAD': 1, 'HAD GIVEN': 1, 'HAD_': 1, 'JDD.6377THIS ARTICLE HAD': 1, 'd-BP 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'Peroxisomal D-hydroxyacyl-CoA dehydrogenase deficiency': 2, 'HAVE HAD ANORECTAL DISEASES': 1, 'HIVE': 1, 'TLM-HAD': 1, 'long-chain HAD deficiency': 1, '4-HAD': 2, '3-hydroxyacyl-coenzyme dehydrogenase deficiency': 1, 'JDD.5657THIS ARTICLE HAD': 1, '3-HOAD': 1, 'L-3 hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short- and medium-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'HAD-DLAC': 1, 'C10 Medium- and short-chain-3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'Short-chain 3-hydroxyacyl-CoA dehydrogenase (HADH, SCHAD) deficiency': 1, 'Medium and short-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'medium and short-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'HR-HAD': 1, 'HAD IA': 1, 'IA HAD': 1, 'HAD DA': 1, 'HAD IA': 1, 'HAD AML': 1, 'short chain hydroxyacyl-CoA dehydrogenase deficiency': 1, 'SCHADD': 1, '3-hydroxyacyl-Co A dehydrogenase (HADH; aka SCHAD) deficiency': 1, 'deficiency of HADH': 1, 'LCHAD': 2, 'HAD phosphatases': 1, '-chain-3-hydroxyacyl CoA dehydrogenase': 1, 'TDH': 2, 'HAD ONE CONVULSION': 1, 'AD-HAD-NH': 1, 'deficiency of the hydroxyacyl-CoA dehydrogenase': 1, 'reduction of 3-hydroxyacyl-CoA': 1, 'SCHAD short-chain 3-hydroxyacyl-CoA dehydrogenase': 1, '3-hydroxyacyl-CoA epimerase': 1, 'HAD-like': 1, 'HAD EXCLUDED SIERRA LEONE': 1, 'HAD UPON': 1, 'medium-chain 3-hydroxyacyl coenzyme deficiency': 1, 'AtSDH': 1, 'D-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'HAD virus': 1, 'GIRL HAD': 1, 'SCHAD (': 1, 'short-chain hydroxyacyl-CoA dehydrogenase deficiency': 1, 'HAD PREVIOUSLY': 1, 'HAD Hydrolase': 1, 'HAD & SN': 1, 'EOS': 2, 'EOP': 1, 'AP': 1, 'HADH deficit': 1, 'CHAD': 1, 'hydroxyacyl-Coenzyme A dehydrogenase (HADH) deficiency': 2, 'RSNC': 1, '(L) chain': 1, 'CHALLENGES THAT HAD': 1, 'HAD-B': 1, 'HAD-B1': 3, 'short-chain hydroxyacyl-CoA dehydrogenase (': 1, '3-hydroxyacyl-CoA dehydrogenase (HAD) deficiency': 1, 'HAS IT HAD A PARTICULAR IMPACT': 1, 'HAD%%': 1, 'DIABETICS HAD': 1, 'deficiency of 3-hydroxyacyl CoA dehydrogenase': 1, 'HAD FAILED': 1, 'HAD PREVIOUSLY ATTEMPTED SUICIDE': 1, 'SCAD': 1, 'MCAD': 1, 'HCD deficiency': 1, 'SOMETHING LIKE SCALES HAD FALLEN': 1, 'MSCHAD': 1, 'medium/short-chain L-3-hydroxyacl-CoA dehydrogenase deficiency': 1, 'LONG-CHAIN 3-HYDROXYACYL COENZYME A DEHYDROGENASE DEFICIENCY': 1, 'HAD MILD': 1, 'M/SCHADD': 1, 'medium/short-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, '3-Hydroxyacyl-CoA dehydrogenase (HADH) deficiency': 1, 'Chain 3-hydroxyacyl-CoA Dehydrogenase Deficiency': 1, 'HAD USED STATINS': 1, 'HACD1 deficiency': 1, 'D-BP 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short-chain-L-3-hydroxyacyl-CoA dehydrogenase deficiency': 1, '3-hydroxyacyl-coenzyme a dehydrogenase deficiency': 1, 'HACD': 1, 'HAD THAT': 1, 'Short-chain L3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'short-chain L3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'SCHAD-deficient': 2, 'SCHAD- deficient': 1, 'l-3-hydroxyacyl-coenzyme A dehydrogenase deficiency': 1, 'HAD MEDICATION RECONCILIATION DONE': 1, '-chain L-3 Hydroxyacyl-CoA Dehydrogenase Deficiency': 1, 'LCHAD deficiency': 1, 'Deficiency of SCHAD': 1, '3-hydroxyacyl-CoA dehydratase 1 deficiency': 1, 'SCHAD- versus': 1, 'SCHAD-deficiency': 1, 'PATIENTS HAD': 1, 'short-chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 2, 'HADH-CHH': 1, 'SCHAD 5': 1, 'HAD-17': 1, 'KCR': 1, 'HAD EXHIBITED AN ACUTE INCREASE': 1, 'HAD-CAD': 1, 'L-GalLDH': 1, 'HADs': 1, 'BHAD': 1, 'HAD EXTENDED INTRAPERITONEALLY': 1, 'OS': 1, 'Short chain 3-hydroxyacyl-CoA dehydrogenase deficiency': 1, 'HCDs': 1, 'HAD obstetricale': 1, 'HAD ALREADY': 1, 'HAD ALSO': 1, 'WOMAN HAD': 1, 'short-chain 3-hydroxyacyl-CoA dehydrogenase (SCHAD) deficiency': 1}
|
HAD
|
Disease
|
MESH:C535311
|
{'Costeff syndrome': 59, 'optic atrophy-plus syndrome': 4, 'optic atrophy plus syndrome': 14, 'Atrophy4.Dominant Optic Atrophy plus': 1, 'Iraqi': 54, 'ADOA-plus': 3, 'type III 3-methylglutaconic aciduria': 5, 'Costeff Syndrome': 8, 'Type III 3-methylglutaconic aciduria': 11, 'ADOA plus': 8, 'Iraqi Freedom': 61, 'autosomal dominant optic atrophy plus syndrome': 1, 'ARTOAN': 1, 'Costeff optic atrophy syndrome': 12, 'ADOA-Plus': 1, 'glaucomatous optic atrophy-3': 1, 'Iraqi and Enduring Freedom': 2, 'Optic atrophy plus': 4, '3-methylglutaconic aciduria type III': 11, 'DOA Plus': 1, 'and Iraqi Freedom': 2, 'iraqi': 1, '3DO': 1, 'Costeff Optic Atrophy syndrome': 1, 'Costeff optic-atrophy syndrome': 2, 'type III 3-MGA-uria': 1, 'DOA plus syndrome': 2, 'type III methylglutaconic aciduria': 1, 'PIDs III-2 and III-3': 1, 'Behr-like Costeff syndrome': 1, 'ADOA plus syndrome': 3, 'ADOA Plus': 1, 'SIP': 1, 'NVHO 3': 1, 'CS': 1, 'DOA)-plus disease': 1, 'DOA-plus': 5, 'DOA-plus disease': 1, 'OAB-N-3': 1, 'DOA-plus syndrome': 2, "ADOA 'plus": 1, 'IJ TDS': 1, 'IQD': 4, 'Fitzpatrick skin type III 3': 1, 'Dominant optic atrophy plus (DOA+) syndrome': 1, 'and Iraqi': 3, 'type III 2HGA': 1, 'Optic atrophy plus syndrome': 4, 'type III/3': 1, 'Type III 3-Methylglutaconic Aciduria': 2, 'MGCA3': 2, '3-MGA-uria type III': 1, '3-methylglutaconic aciduria type type III': 1, 'Fitzpatrick skin type III 3': 1, 'dominant optic atrophy plus syndromes': 1, '3-Methylglutaconic Aciduria (Type III)8': 1, 'dominant optic atrophy plus': 1, 'DOAplus': 1, 'Subsyndromal Type III 3': 1, 'type III 3-MGC aciduria': 1, 'Type III 3-MGA': 1, 'optic atrophy plus': 2, 'type III MGA': 2, 'MGA type III': 1, 'autosomal recessive optic atrophy-3': 1, "DOA 'plus": 1, '(III) type 3': 1, '3-MGA type III': 1, '3-Methylglutaconic aciduria type III': 3, 'Costeff optic atrophy': 3, 'Barth syndrome 3-Methylglutaconic aciduria type III': 1, 'type III.c.3': 1, 'Optic atrophy 3': 1, 'mDOPs': 1, 'optic atrophy - plus disorder': 1, 'autosomal-recessive type III 3-methylglutaconic aciduria': 1, '3-methylglutaconic aciduria, type III': 1, 'type III 3MGA': 1, 'optic atrophy-3': 1, "Costeff's syndrome": 1, 'autosomal recessive Costeff syndrome': 1, 'AMOCMP': 1, 'type III-3': 1, 'type III-3/': 1, 'Optic neuropathy 3': 1, 'DOA "plus': 2, 'optic atrophy plus disease': 1, "optic atrophy plus' (Costeff) syndrome": 1, "'optic atrophy plus'": 1, 'Gartland type III 3': 1, 'EDI-OCT type 3 or 4': 1, 'EDI-OCT type 3 or 4 lesions': 1, 'Autosomal Dominant Optic Atrophy plus syndrome': 1, 'Costeff': 1, 'autosomal-dominant optic atrophy plus syndrome': 1, 'DOA plus-Behr syndrome': 1, 'OPA1 plus syndrome': 1, '3-MGA-III': 1, 'optic atrophy type 3': 1, '3-MGCA type III': 1, 'Optic atrophy type 3': 1, 'Costeff and Wolfram syndromes': 1, 'IRQ-MSA': 1, 'Posterior cortical atrophy-plus syndrome': 1, 'ADOA-plus syndrome': 2, 'PCA-Plus': 1, 'Type III methylglutaconic aciduria': 1, 'or Iraqi Freedom': 1, 'hippocampal plus parietotemporal atrophy': 1, 'PCA-plus': 1, 'Iraqi freedom': 1, 'OPA 3 Type III': 1, 'DOA plus': 2, 'Metachromatic leukodystrophyGlutaric aciduria type 1MucopolysaccharidosisType III': 1, 'T3SS': 1, 'type II-1, III-3': 1, '3-methylgutaconic aciduria, type III': 1, 'Type III MGA': 1}
|
Iraqi Freedom
|
Disease
|
MESH:C535312
|
{'3-hydroxyisobutyric aciduria': 21, '3HiB-uria': 3, '3-Hydroxyisobutyric aciduria': 7, '3-hydroxyisobutyric acid dehydrogenase deficiency': 2, '3-Hydroxyisobutyrate dehydrogenase (HIBADH) deficiency': 1, 'HIBADH deficiency': 1, '3-hydroxyisobutyrate dehydrogenase (HIBADH) deficiency': 1, 'HIA': 1, 'HIB': 1, 'deficiency of 3-hydroxyisobutyrate dehydrogenase': 1, 'HIBADH': 2, '3-Hydroxyisobutyrate aciduria': 1, 'ALPHA-HYDROXYISOBUTYRIC': 1, '3-hydroxyisobutyrate dehydrogenase deficiency': 1, '3-Hydroxyisobutyrate-CoA dehydrogenase': 1, 'L-Carnitine 3-Hydroxyisobutyric aciduria': 1, '3-Hydroxyisobutyric acid dehydrogenase deficiency': 1, 'primary 3-hydroxyisobutyric aciduria': 1, 'deficiency of 3-hydroxyisobutyric acid dehydrogenase': 1, 'enzymatic deficiency of HIBADH': 1, 'BHIB': 1, '3-hydroxyisobutyric acidemia': 1, '3-HIB': 2, 'Pachygyria 3-hydroxyisobutyric aciduria': 1, 'Glutaric aciduria type 2 3-hydroxyisobutyric aciduria': 1, 'ALPHA-HYDROXYISOBUTYRATE': 1}
|
3-hydroxyisobutyric aciduria
|
Disease
|
MESH:C535313
|
{'type 3C': 4, 'BARC 3c': 4, 'CCC': 1587, 'Ritscher-Schinzel/3C syndrome': 15, '3C syndrome': 28, 'Ritscher-Schinzel, or 3C (cranio-cerebello-cardiac) syndrome': 1, '3C': 1401, '1A, 1B, and 3C deformities': 1, '3C deformity': 1, 'Marsh-Oberhuber type 3c': 2, 'Marsh-Oberhuber type 3a, 3b, 3c, and 3b-c': 1, 'Marsh-Oberhuber type 3b and 3c': 1, 'Marsh-Oberhuber type 3a, 3b, and 3c': 1, '3c': 205, 'Lenke 3C double major curve': 1, 'type 3c diabetes': 138, 'p3CD-3C': 1, '3CD-3C': 1, 'Ritscher-Schinzel syndrome': 46, 'RTSCS2': 1, 'RTSCS1': 1, 'RTSCS': 2, 'Ritscher-Schinzel syndrome 2': 3, 'Ritscher-Schinzel syndrome 1': 5, '3C-SiC': 20, '3CL': 3, 'CCC-19': 16, '3C.3a': 10, '3C.2a2': 4, '3C.2a1': 5, 'Lenke type 3C, 5C, or 6C': 1, 'Type 3c diabetes': 36, 'type 3c': 20, 'IR-3CS': 1, '3c-3c': 1, 'type 3c diabetics': 2, 'type 3c diabetic PPP': 1, 'type 3c diabetic': 2, 'Fe deficiency': 2, 'Fe-deficiency': 1, '-syn-3c': 1, 'TDP 3C': 1, 'I-CCC': 1, 'Ritscher-Schinzel syndrome or 3C (craniocerebello-cardiac) syndrome': 1, 'Ritscher-Schinzel (3C) syndrome': 3, 'HBC 3c': 1, '1C, 2C, 3C': 1, 'Marsh 3C.': 3, 'Lenke Type 3C, 5C, and 6C': 1, 'Lenke Type 3C': 1, 'Lenke Type 3C': 1, 'Lenke Type 3C, 5C': 1, 'Lenke Type 3C and 6C': 1, '3C, 5C, and 6C': 1, 'Cryofilm type 3C': 2, 'Cav2.3c': 1, '3C.2a': 21, 'mucopolysaccharidosis type 3c': 1, 'Type 3c': 9, 'Type 3c or pancreatogenic diabetes': 1, 'Type 3c diabetics': 1, 'CA-CCC': 1, 'Ritscher-Schinzel-syndrome': 1, '3C-syndrome': 1, 'Gustilo 3B and 3C injuries': 1, 'cyst 1C, 3C': 1, 'cysts 1C and 3C': 1, '23.3c': 1, 'type 3c) diabetes': 1, 'GD type 3c': 2, 'Gaucher disease type 3c': 3, 'CCC 3': 2, '3C@T': 1, 'Lenke type 3C and 6C': 3, 'RSS': 12, 'diabetes type 3c': 9, 'cranio-cerebello-cardiac (3C) syndrome': 4, 'intrahepatic CCC': 6, 'ESSIC) type 3C': 1, 'ESSIC type 3C': 7, 'Type 3c Diabetes': 10, 'Ritscher-Schinzel (RSS) syndrome': 1, 'RSS syndrome': 1, 'stage I CCC': 1, 'Marsh 3C lesion': 2, 'Lenke type 3C': 3, 'Lenke 3C': 2, 'Cranio-cerebello-cardiac (3C) syndrome': 3, '-3c': 16, 'cholangiocellular (CCC': 1, 'CV 3C pro': 1, 'NV 3CLpro': 2, '3C.2a1b': 3, 'Type 3C': 3, '3C.': 30, 'type-3c (pancreatogenic) diabetes': 1, 'type 3c (pancreatogenic) diabetes': 6, 'Marsh 3C': 11, 'gynecologic CCC': 1, 'Gustillo 3B/3C fractures': 1, 'CCC tumors': 15, 'Gustillo 3B or 3C fractures of the tibia': 1, 'S+L- CCC': 1, 'Ritscher-Schinzel Syndrome 1': 1, 'AST-CCC': 2, 'Omicron 3CLpro': 1, 'Marsh 3c': 13, 'FIGO stage 3C': 3, 'Pancreatogenic diabetes (type 3c': 1, '/2c, 3a, 3b, 3c, 4a, 4ab, 4b,': 1, 'type-3c diabetes': 2, 'GBM-CCC-002': 1, 'GBM-CCC-003': 1, 'GBM-CCC-001': 1, 'CCC cholangiocarcinoma': 13, '3c (25) 1c': 1, 'T3c': 1, 'CCC pT3aNx': 1, 'T3cD': 7, 'CCC infections': 4, 'NP-3C': 2, '-3C': 9, 'Marsh Type 3c': 1, 'Papillary 3C': 1, 'Chitra CCC': 1, 'SARS 3CLpro': 1, '3C-SiC.': 9, 'MEX-3C': 2, 'BARC 3a, 3c': 1, 'BARC 3a-3c': 1, 'CCC-': 3, 'MARSH 3c': 1, 'Type 3C bleeding': 1, 'SARS 3C-like': 1, 'SARS 3C-like protease': 6, '3Cs': 2, 'Ritscher-Schinzel Syndrome': 8, '/3C': 2, 'Ritscher-Schinzel': 4, 'SARS 3C-like proteinase': 3, 'CCC 4': 1, 'pancreatogenic, or type 3c, diabetes': 3, 'congenital CCC': 1, '3b 3c 3d 3a 3b': 1, 'type 3C disease': 1, 'atrophy 3c': 5, 'Marsh 2, 3a, 3b, 3c': 1, 'CCC-1': 1, 'CCC clear cell': 1, 'AM CCC': 1, 'multiorgan CCC': 1, 'CCC ETHICAL': 1, 'CM-CCC': 1, 'NCM-CCC': 1, 'BARC type 3c': 3, 'C-X-3C': 1, '3a-3c': 1, 'Ritscher-Schinzel (or cranio-cerebello-cardiac (3C)) syndrome': 2, '3C-L': 1, 'SSTR-RADS-3C lesion': 1, '3B and 3C fractures': 1, '3B and 3C': 1, '3C (cranio-cerebello-cardiac) syndrome': 3, 'cranio-cerebellar-cardiac or 3C syndrome': 1, 'Mucopolysaccharidosis type 3C': 2, '3C and 4': 1, 'FL3A and 3C': 1, 'CCC 5': 1, 'Marsh 3C lesions': 2, 'peritoneal 3C serous': 1, 'pancreatogenic (type 3c) diabetes': 6, 'cT3b and 3c': 1, 'peritoneal 3c serous': 1, 'Ritscher-Schinzel cranio-cerebello-cardiac syndrome': 1, 'Lenke 1B, 1C or 3C curves': 1, 'pancreatic diabetes (type 3c)': 2, 'inflammatory compounds (3b, 3c, 5a, 5c, 7a and 10 b': 1, '3c diabetes': 1, 'diabetes (type 3c)': 1, 'Marsh 3a, 3b, 3c': 2, '3CLpro': 2, 'ICRS 3c': 1, 'RITSCHER': 1, 'RTSC2': 1, 'X-linked Ritscher-Schinzel syndrome 2': 1, 'CS-3C': 1, 'BOPHY 3c': 1, '3C&E': 3, 'ESSIC type 3C.': 2, 'of Interstitial Cystitis (ESSIC) type 3C': 1, 'type 3C fracture': 1, 'Atrioventricular canal and 3C (cranio-cerebello-cardiac) syndrome': 1, '3CS': 13, '-3C-SiC': 1, 'influenza agents 3a, 3c, 4a and 4c': 1, 'SI-3C': 1, 'Marsh-3c': 1, '3C (craniocerebellocardiac) syndrome': 2, 'and 3c': 2, 'FIGURE 6-3C': 1, '3B or 3C': 3, 'stage 3B and 3C': 1, 'ICCC-3c': 1, 'RPHD, type 3B, and 3C': 1, 'Serous-papillary 3C': 1, 'cardiovascular CCC': 2, 'EC/CCC': 1, 'EC and CCC tumor': 1, 'EC and CCC tumors': 2, 'endometrial CCC': 5, 'SC/CCC': 1, 'Gynecologic and renal CCC': 1, 'Lenke 3C and 6C': 3, 'LEL-CCC': 1, '2A/A;3C/C': 1, 'CCC.2017': 1, 'neuromuscular CCC': 2, 'Neuromuscular CCC': 2, 'CVD 3C-SiC.': 1, '3c infection': 1, 'Gaucher 3C': 1, 'Gaucher type 3C disease': 1, 'Autosomal recessive Gaucher type 3C': 1, 'Gaucher type 3C.': 1, 'Gaucher Disease Type 3C': 1, 'Gaucher type 3C': 1, 'type 3C.': 1, 'Gaucher disease 3C': 1, '(X)3C': 1, 'type 3b, 3c': 1, '3c disease': 2, 'Kawamoto cryofilms type 3C': 1, '3C.2a.1': 1, 'LEUKEMIA-3C': 1, 'Leukemia-3c': 2, 'Ritscher-Schinzel cranio-cerebello-cardiac (3C) syndrome': 1, 'CCC cholangio cellular carcinoma': 2, '3C-like pro': 1, '3C-PCC': 1, 'Marsh 3c lesion': 2, 'HCC-CCC': 4, 'type 3C diabetes': 8, '3CLP': 3, 'pancreatogenic or type 3c diabetes': 3, '4C(4pi) + 3C(2pi': 1, 'type 3a, 3b, or 3c': 1, 'Lenke type 3C and 6C curves': 1, 'Lenke types 3C and 6C': 1, 'CCC Cholangio carcinoma': 1, 'SCG-3c': 1, 'Gaucher type 3c': 1, 'GOLD 3C': 1, 'CCC_ST_3': 1, 'SVV 3C': 1, 'QLQ - CCC': 1, '3C.1': 1, '3C.3a-': 1, 'Type 3C disease': 1, 'Marsh 3b or 3c': 2, 'Marsh type 3c': 2, '3C/Ritscher-Schinzel-like syndrome': 1, 'MSN-3c': 1, '3C-ST': 1, 'CCC of the tongue': 1, 'renal CCC': 2, 'Marsh-Oberhuber 3a, 3b, 3c': 1, 'LND +3C': 1, 'BARC 3C': 1, 'Complement 3c': 2, 'Marsh 3C stage disease': 1, 'CH-CCC-': 1, '3C Syndrome': 2, 'Marsh 3b and 3c': 2, 'Type 3c Pancreatogenic Diabetes': 1, '3C&3D': 2, 'FIGURE 3C': 2, 'Ataxia 3c': 1, 'Telo-3C': 1, 'serous, stage 3c or 4': 1, 'Ritscher-Schinzel-like syndrome': 1, 'BARC 3b, 3c and': 1, 'BARC 3b, 3c': 2, 'physical and mental disabilities.3c': 1, 'cHCC-CCC': 1, 'S-3C': 1, 'Norwalk Virus 3C': 1, 'p-type 3C-SiC': 2, 'S-CCC': 1, '3C-6': 1, 'KPL-3C tumours': 1, 'pancreaticogenic (type 3c) diabetes': 1, '3C-E': 3, '3C-P': 1, 'CCC-32': 1, 'CCC infection': 5, 'Gustilo 3C': 1, 'CCC-S': 1, '3C-cre': 1, 'Lenke type 3C curves': 1, 'clade-3C.3a': 1, 'Stage 3C': 1, 'T(3C': 1, 'Alzheimer.3c': 1, 'Retriever-CCC': 2, 'IHCCC': 1, '3C-F': 1, 'CCC-RS': 1, '1a, 2a, 2b, and 3c': 1, 'Paprosky Types 2A-3C': 1, 'Marsh-Oberhuber 3C': 1, 'DeltaME-I-3C.': 1, 'DeltaME-I-3C': 1, 'Marsh-Oberhuber 3c lesion': 1, 'CCC-2': 2, 'Adenocarcinoma 3C': 1, 'pancreatogenic [or type 3c] diabetes': 1, '3C fractures': 2, 'GD3c': 2, 'T3D': 1, '3C or 4': 3, 'LND+3C': 1, 'CCC cholangiocell carcinoma': 1, 'Marsh stage 3c': 2, 'Malignancy CCC': 1, 'Paprosky 2A, 3A, 3C deficiencies': 1, 'extrahepatic CCC': 2, 'CCC CCC': 1, 'interstitial cystitis type 3C': 2, '3C.2': 1, '3C.3': 1, 'FI': 1, 'FIGURE 3C & D': 1, 'Leukemia-3c Arrhythmia': 1, '3Clpro': 1, 'FN RSS': 1, 'NCI-CCC': 3, 'Gastrointestinal CCC': 1, 'Renal CCC': 1, 'congenital or genetic CCC': 1, 'Respiratory CCC': 1, 'lymphoepithelioma-like CCC': 1, 'CCS-3CS': 1, 'BARC type 3b and 3c': 3, 'RS/3C syndrome': 2, 'Death-3c': 1, 'clade 3C.3a influenza viruses': 1, 'PS 3C': 1, 'Type 3c (secondary) diabetes': 1, '-type 3C-SiC.': 1, 'neurological CCC': 1, 'BARC 3b, 3c,': 1, 'PSC-CCC': 1, '3C,3D': 6, 'Marsh 3a, 3b, and 3c': 2, "C'3c": 1, '3c{1,1': 1, '3C.3a1 3C.2a1b.2a.2': 1, '3C.2a 3C.2a1b.1': 1, '3C.2a 3C.2a1': 1, '3C.2a1 3C.2a1b.1b': 1, '3C.3a 3C.2a': 1, 'CCC metastasis': 2, 'CUP-CCC': 1, '3 CCC': 1, 'Lenke 3C or 6C': 1, 'CCC_E': 1, 'CCC_A': 1, 'type 3c (secondary) diabetes': 1, '3A, 3B and 3C fractures': 1, 'Gustilo type 3C': 1, 'MPS-3C': 2, 'Lenke type-3C': 1, ', 3C.': 1, 'WD-HCC': 1, 'HCCs': 1, 'Hep HCCs': 1, 'WD-HCCs': 1, 'HCC-CCC tumors': 1, '38.3C': 1, ', 2a, 3a-3c, 4a, 5a-5c, 6a-6d, 7a-7b, 8a': 1, '-3b, 3c-M-5a, 5b': 1, 'Circular CCC': 1, 'Gaucher disease, type 3c': 1, 'Marsh-Oberhuber 3b and 3c': 1, 'metastasis to bone and liver 3c': 1, 'Ryegrass Mottle Virus Serine-like 3C': 1, '3c,5a': 1, 'type 3c or diabetes': 1, 'FIGS 3c': 1, '3a, 3b and 3c tears': 1, 'CCC viruses': 1, 'Type 3C diabetes': 1, 'Re: 3C (Ritscher-Schinzel) syndrome': 1, 'CCC Metastatic Liver Tumors': 1, ', 3b2, 3c': 1, 'CCC dysfunction': 1, 'Lenke 3C and 6C scoliosis': 1, 'type 3c NODM': 1, 'SORRL-CCC': 3, 'CMV 3C': 1, 'type 1, type 2, type 3c': 1, 'PCS 3CS': 1, 'O-CCC': 2, 'Marsh 3b-3c': 1, 'Stage III CCC': 1, 'DISCO-3C': 1, ', 3c, 4e and': 1, 'cytotoxic compounds 1 and 3c': 1, 'infected with -3b and -3c': 1, '3C.3a cs': 1, ', 3c': 1, 'Paley type 3C FH': 1, '3C.2A': 1, 'APS-3C': 3, 'MERS 3CLpro': 1, 'CCC/C': 1, 'CCC 2': 3, 'MPS 3C': 1, 'CCC cat': 1, 'pancreatogenic type 3c diabetes': 1, 'N-CCC': 2, '3c and': 1, 'Clade 3C.2b': 1, 'Gustilo type 3B and 3C': 1, '3C and D': 1, 'CCC 2 tumours': 1, 'VaIN2/3c': 1, '3C disease': 3, '3C (Ritscher-Schinzel) syndrome': 3, '3C/3D': 1, 'cluster 3c': 1, 'vaginal CCC': 1, 'M-CCC': 1, 'Lenke 1C, 3C': 1, 'and 3C': 2, 'Lenke type 1B, 1C, 3C': 1, 'SARS 3C-': 1, '3C Vascular injury': 1, '-3a-3b-3c': 2, "Lenke's type 3C": 2, 'Lenke 3C/6C': 1, 'BARC 3a, 3b, 3c, and 5': 1, 'Marsh-Oberhuber 3c': 3, 'Interstitial Cystitis type 3C': 1, 'Lenke 3C, 5C': 1, 'stage 3B/3C': 1, ', 3b, 3c': 3, 'type 3c ("pancreatogenic") diabetes': 1, 'EML-3C': 1, 'EML-3C.': 1, '3C.2a influenza': 1, '3C.3b': 3, 'FIGO 3C': 1, 'CCC tumor': 2, 'Gustilo 3c': 1, 'stage 3C disease': 1, 'Marsh 3c lesions': 2, '2C or 3C': 1, '3C-HF': 1, 'PI-CCC': 1, 'C-3C-3CC': 1, 'interstitial cystitis type 3C.': 1, '3A to 3C': 1, 'secondary diabetes (type 3c)': 1, 'CCC-NOS': 1, 'E-CCC': 1, '3c or': 1, 'Marsh-Oberhuber 3b-3c': 1, 'Ritscher-Schinzel or 3C syndrome': 1, 'Vanco-3C-N3': 1, 'CCC.UGA': 1, '3C.2a3': 2, '3C.2a2predominated': 1, 'Fe deficiency anemia': 1, 'Fe and Zn deficiencies': 1, 'Fe and Zn Deficiencies': 1, 'cardiac CCC': 1, 'MDS-2A.3C': 1, 'colon CCC': 1, 'Gred 3C': 1, 'EM-CCC': 1, '3C-PR': 1, 'RCM': 1, "CCC's": 1, 'malignancy CCC': 2, 'respiratory CCC': 2, 'Mullerian-type CCC': 1, 'GH-CCC': 1, 'PAS 3C': 1, 'Polyendocrine syndrome type 3C': 1, 'hepatic CCC': 1, 'SKC 3CS': 1, "'New' 3C syndrome": 1, 'SSTR-RADS-3C': 1, '3CLPro': 1, '37.3C-38C': 1, 'HEV-3c infection': 1, 'HEV-3c': 2, 'clade 3C.3a': 2, 'clade 3C.2a': 1, '3C.2a1a': 1, 'Autoimmune polyglandular syndrome-3C': 1, '2c, 3a, 3b, 3c, 4a, 4b': 1, 'stage 3C, 4': 1, 'intrahepatic CCC (': 1, 'iCCC) mass': 1, 'Lenke 3c, 5c, and 6c curve': 1, 'CCC carcinomas': 1, 'CCC tumour': 1, 'CCC tumours': 1, 'RTSC1': 1, '3B-3C': 1, 'stage 3C cutaneous melanoma': 1, 'PROF 3C': 1, '1-3C': 1, 'type 3c diabetes (': 1, 'FIGO stage I and II CCC': 1, 'IV3C': 1, 'S-3a-3b-3c/ E-M-5a-5b-N': 1, 'FAVD 3C': 1, 'T2b-3c': 1, 'ADC 3C': 1, '3Cpro': 1, 'HCC/CCC': 1, 'CCC virus': 1, 'HRV 3C': 2, 'Onah type 3c': 1, '3c.2a': 1, 'Gaucher disease type 3C': 1, 'Gustilo 3C injury to the': 1, 'Gustilo 3C injury': 1, 'Type 3c pancreatogenous diabetes': 1, '(type 3c) diabetes': 1, 'SARS 3c like protease': 1, '3CLPRO': 2, 'type 3c GD': 1, 'Type 3c GD': 1, 'GD Type 3c': 1, 'R-3c': 1, 'agenesis of CCC': 1, 'CCC 28': 1, '3b or 3c': 1, 'DSM-5-3C': 1, 'SN': 1, 'CLHN-CCC': 1, 'type 3c, type 4': 1, '3C-CCR': 1, 'DSM-IV 7.3c': 1, 'EFFECT OF COMPOUNDS 3c AND 3d': 1, 'DEC 3c': 1, 'MERS-CoV 3C-like': 1, 'SB Comp 3a 3b 3c': 1, 'pCCC': 1, 'RSS/3C syndrome': 1, 'Ritscher-Schinzel syndrome (RSS)/3C (cranio-cerebro-cardiac) syndrome': 1, 'Methyl-3C': 1, '3C.2a.4': 1, '3C.2a.3': 1, 'SL-3C': 1, '3C.2a1b.2a.2': 1, 'CCC pts': 1, '3c injuries': 1, '3C.2a1b.1a': 2, '3C.2a1b.2a2': 1, 'BBB-CCC': 1, 'CCC of soft palate': 1, 'PSMA-RADS 3C lesion': 1, 'HiCUP': 1, 'FIGO stage 3B - 4 3C - 15': 1, 'Ritscher-Schinzel or 3-C syndrome': 1, 'Axenfeld-Reiger, Larsen, and Ritscher-Schinzel syndromes': 1, 'CCC disease': 1, 'Lesion Group 3c': 1, 'Socket type 3C': 1, '3C-LIKE': 1, 'type 3c diabetes damage to the pancreas': 1, 'clear cell (CCC': 2, 'Gustilo 3C fractures': 1, 'Gustillo 3B and 3C': 1, 'MC CCC': 1, 'L1HS_2_3c': 1, 'Ritscher-Schinzel syndromes': 1, 'Figura 3C': 1, '3A-3C': 1, 'Type 3c Gaucher disease': 1, 'type 3c Gaucher disease': 1, "O'Driscoll stage 3c": 1, 'OAE-3C': 1, 'CCC of': 1, 'Bismuth type III and IV CCC': 1, 'Bismuth type III and IV hilar CCC': 1, '-CCC': 3, 'stage 3c': 1, 'FIGO stage 3c and 4': 1, '3C Diamonda': 1, 'RSS-': 1, '3Cs & HIV': 1, 'APS-3c': 2, 'ARCO stage 3c': 1, '3C-': 1, 'serous 3C': 1, 'Gal-3C': 1, 'T3cD.': 1, '3C and 3C-like proteinases': 1, 'Marsh type 3a, 3b, or 3c': 1, 'SCI-3C': 1, '3CLSP': 1, '3c infections': 1, 'HGS END CCC': 1, '3C & D': 1, '2, 3a, 3c': 1, 'ESSIC 2C-3C': 1, '1, 2 and 3c': 1, 'type 3c and 3d': 1, 'TCGA_3C_AALK_': 1, 'TCGA_3C': 1, 'SEMA3C.': 1, 'stage 3C or 4': 1, 'Lenke, type 3C and 6C scoliosis': 1, 'type 3C scoliosis': 1, 'CCC Cholangiocarcinoma': 1, 'ENSG 3C': 1, 'Type 1 and 3c fractures': 1, 'hepatitis E subgenotype 3c infection': 1, 'CNS 3c': 1, 'SSTR-RADS 3C': 1, 'SCC-3C': 1, 'SVA 2B and 3C': 1, 'CCC n.a': 1, 'L3 CCC n.a': 1, 'Marsh 2-3c': 1, 'Ritscher-Schinzel syndrome 4': 1, '/3c': 1, 'CCC angeboten': 1, '-3C.': 2, 'Lenke 1B/3B/1C/3C': 1, 'ESSIC 3C)': 1, 'TOLD-P:3c': 1, '3C-VSDS': 1, '3C, type II': 1, '3C.2a1b.1b': 1, 'CCC-EMN': 1, 'Belladonna 3C': 1, 'BCC CCC': 1, '3a, 3b, and 3c': 1, 'CCC cholangiocarcionoma': 1, 'pancreatogenic (type 3C) diabetes': 1, 'BARC types 3b, 3c and 5': 1, '3C injuries': 1, 'Gustilo type 3c fracture': 1, 'BARC bleeding type 3b/3c/5a/5b': 1, 'rare (non-CCC) tumours': 1, 'or type 3C': 1, '3C (cranio-cerebello-cardiac, Ritscher-Schinzel;': 1, '3Cs&HIV': 1, 'CCC.24': 1, 'hematologic or immunologic CCC': 1, 'metabolic CCC': 1, 'congenital or genetic defect CCC': 1, 'premature and neonatal CCC': 1, 'gastrointestinal CCC': 1, 'renal or urologic CCC': 1, 'neurologic and neuromuscular CCC': 2, 'P-3C-HNTs': 1, '-3C-HNTs': 1, '3C-HNTs': 1, 'Type 3C Diabetes': 1, 'CCC -': 1, 'IC CCC': 1, 'IH CCC': 1, 'Hilar CCC': 1, 'EH CCC': 1, 'Diabetes type 3c': 1, 'type 3c, or pancreaticogenic, diabetes': 1, '3C-HTGTS': 1, '3C.3b illness': 1, 'clade 3C.3b': 1, 'CFD Paley type 3c': 1, 'CFD type 3c': 1, 'PCV3a-3c': 1, 'MS 3c': 1, 'MS 3b or 3c': 1, 'SWP-3C': 1, 'AO Type 34-3C': 1, 'HGSC CCC': 1, '3C,4C': 1, 'Lenke type 1B, 1C, or 3C curves': 1, 'pancreatogenic [type 3c] diabetes': 1, 'FR': 1, 'villous abnormality Marsh grade 3b and 3c': 1, 'tears 3a, 3b and 3c': 1, 'Stage 3c': 1, 'type 3c Diabetes': 1, 'Paley type 3c FH': 1, 'Paley type 3c fibular hemimelia': 1, 'Paley type 3C.': 1, 'Paley type 3C': 1, 'Type 3c (pancreatogenic) Diabetes': 1, 'CCC-003': 1, 'Ritscher-Schinzel/3-C syndrome': 1, '2c DDCI-3c': 1, 'mullerian CCC': 1, 'CCC:33.3': 1, 'EC CCC': 1, 'clear-cell (CCC': 1, 'RS/3C-syndrome': 1, 'Ritscher-Schinzel (RS)/3C (cranio-cerebro-cardiac) syndrome': 1, 'CCC 1': 1, '4C + 3C]': 1, 'Embryo 3C': 1, 'fibular hemimelia Paley type 3c': 1, 'CCC,10': 1, 'SE-CCC': 1, 'Marsh 3a, 3b, and 3c lesion': 1, 'SAR-CoV-3CLpro': 1, 'o-CCC': 1, 'hypovascular CCC': 1, '3C LIKE': 1, 'CCC[tiab': 1, '3C-triad': 1, 'CCC-A': 1, 'stage 3C': 1, '1C-3C': 1, 'clear cell - CCC': 1, 'pT2-3c': 1, 'type 3c diabetes or': 1, 'CDC 3C': 2, 'PDSA 3c': 1, 'Ritscher-Schinzel (cranio-cerebello-cardiac, 3C) syndrome': 1, 'Marsh type 3C': 1, 'flexneri 3c': 1, 'type 3c or pancreatogenic diabetes': 1, '3C-1a': 1, '3C-IVF': 1, 'Hepatitis A Virus 3c Protease': 1, 'Ritscher-Schinzel syndrome-2': 1, 'pT3b-3c': 2, 'Paprosky 3B or 3C.': 1, '3c-': 1, 'CCC.CONCLUSIONSOur': 1, 'TYPE 3c': 1, ', or type 3c': 1, '(Type 3c) diabetes': 1, '(Type 3c) Diabetes': 1, 'stage 3B or 3C': 2, 'E&CCC': 1, 'Erlangen CCC': 1, 'Ritscher-Schinzel-like Syndrome': 1, 'ESSIC 3C': 1, 'Lenke type 3C curve': 1, 'CCC, not otherwise specified': 1, 'FFP 3c': 1, 'PV 3C': 2, 'Pancreatogenic, or type 3c, diabetes': 1, 'BARC) 3a and 3c': 1, 'pancreatogenic; Type 3c': 1, 'pancreatic/type 3c" diabetes': 1, '3C defect': 1, '3C. difficile': 1, 'Marsh-Oberhuber 3a-3c': 1, 'CCC-O': 1, 'CCC-O.': 1, 'Marsh 3a, 3b and 3c': 1, 'stage 3c/4': 1, 'BPIV-3c': 1, 'TMPT*3C.': 1, 'VUS-3c': 1}
|
CCC
|
Disease
|
MESH:C535314
|
{'WANG Le-': 1, 'Le': 460, 'HN-M-3': 3, 'TREX1 dysfunction': 1, 'Le Fort II/III upper mid-facial fractures': 1, 'Les anciens malades du': 3, 'CHM': 4, 'Yakut': 10, 'Le handicap fonctionnel': 1, 'Les Ansereuilles': 1, 'Le Fort I osteotomy': 73, 'Le Fort I Osteotomy': 47, 'Le foie vide': 1, 'LEs': 50, 'Le Fort II or III': 8, 'Le Fort I': 363, 'Le syndrome de resistance': 1, 'Le syndrome': 94, 'Le Fort fracture': 60, 'THREE-DIMENSIONAL': 30, '3-M syndrome': 99, 'Yakut short status syndrome': 1, 'Le Fort II': 73, 'Le leiomyosarcome': 3, 'Le Forte III fractures of the Maxilla': 2, 'Le Forte II fracture of maxilla': 2, 'Le Forte 1 fracture': 2, '3M syndrome': 67, 'Le Grau-du-Roi': 1, 'gloomy': 13, 'TSD': 1, 'three-system disease': 1, 'les': 9, 'Les': 33, 'TSCCA': 2, 'Three-quadrant syndrome': 1, 'Three Gastropyretie': 1, 'three': 146, 'Le Fort': 249, 'Le Fort III': 197, 'Le syndrome des loges du bras': 1, 'le syndrome': 9, 'Vancouver 3M': 1, 'Le Fort 1': 28, 'Les Miserables': 6, 'Le Fort II fractures': 35, 'neurotoxic three-finger toxins': 4, 'SerD.': 1, 'SerD': 1, 'Vaincre le': 3, 'Le syndrome dysmorphique du syndrome': 1, 'Le Fort I fracture': 52, 'Les tumeurs trophoblastiques gestationnelles': 1, 'Le choriocarcinome': 1, 'Les leishmanioses': 5, 'Le regole del contagio': 1, 'le': 43, 'Le(a-b': 8, 'Stein-Le-venthal syndrome': 1, 'PVVIH': 27, "Le syndrome de l'immunodeficience acquise": 1, 'Charcot and Les nevroses': 1, 'HALD': 4, 'M-3 melanoma': 4, 'TSDP': 1, 'three-': 10, 'TY': 2, 'three rust diseases': 1, 'MS les': 1, 'Le mystere des cathedrales': 1, 'Le Fort type II fracture': 4, 'Le Fort type III fracture': 3, 'Le Fort I Advancement Osteotomy': 1, 'Le Fort I advancement osteotomy': 1, 'TTE': 3, '3M"Here': 1, 'Gay/Les': 2, 'Les keratodermies': 1, 'Le Fort fractures': 130, 'Le Fort Fractures': 12, 'Le Fort pattern injuries': 2, 'Le lupus systemique': 2, 'Le lupus erythemateux systemique': 8, 'TCM': 1, 'Les lesions cutanees': 3, 'M type 3 necrotizing fasciitis isolate 950771': 3, 'Le Fort I fractures': 26, 'Les lesions podales sont': 1, 'les lesions': 1, 'Les lesions': 6, 'TTSS': 31, 'Les deficits focaux etaient retrouves chez': 1, 'M(3': 1, 'M(3)': 10, 'Voici le nouveau monde': 1, '3M Syndrome': 9, 'Le Fort I-III': 3, 'le handicap': 1, 'Le handicap': 3, 'TCTs': 1, 'Tam Duc Le': 5, 'Les tumeurs mucineuses': 1, 'TGD': 36, 'Les infections': 14, 'TEAEs': 1, 'Pc': 1, 'Demystifier le syndrome': 1, 'Le rachis': 1, 'M. ulcerans type 1, type 2, type 3': 1, 'PIMS': 1, 'Le Fort type II fractures': 3, 'Le Fort II fracture': 44, "Le virus de l'hepatite A": 2, "le virus de l'hepatite A": 1, 'LG': 1, 'Le(a-': 4, 'TBM': 1, 'Le TD': 1, 'Le fort I': 13, 'Les Lesions Nerveuses': 1, 'Le developpement chez': 1, 'RCNC.Three': 1, 'les tumeurs': 1, 'Les tumeurs basales': 1, 'Les tumeurs': 8, 'Le Fort I, II, and III': 6, '3MS': 52, 'Le Fort Fracture': 3, 'KD3-M': 1, 'KD3-M injuries': 1, 'Le Fort I.': 9, 'Le decollement epiphysaire femoral superieur': 1, 'Les tumeurs du grele': 1, 'Le syndrome de detresse respiratoire aigue': 3, 'Le sac': 1, 'Valentin Le Douce': 1, 'AtFSDs': 1, 'TTSS-deficient': 1, '3 M&M': 1, 'Les ennemis attaquent': 1, 'SEQUENTIAL LIGATION OF THREE': 1, 'pour-la-lutte-contre-les-maladies-transmissibles': 1, 'mandible or maxilla (Le Fort I, II and III) fractures': 1, 'Les virus': 2, 'Le metapneumovirus': 1, 'Les malades mentaux': 1, 'Nodita internata': 1, 'chichagui type three': 1, 'TCA': 1, 'Gloomy': 5, 'Le Fort III distraction': 3, 'Le-Fraumeni syndrome': 1, 'JTN': 3, 'Le Fort I or': 2, '3 M syndrome': 13, "Les fleaux infectieux n'epargnaient personne": 1, 'Les Aliscampes': 1, 'Le syndrome de detresse respiratoire': 2, 'distraction of the Le Fort III': 1, 'Artemis deficiency and 3M syndrome': 1, 'Three M (3M) syndrome': 1, 'Three': 30, 'M (3M) syndrome': 1, 'M(3) tumors': 2, 'Le Saux': 1, 'LFIII': 1, 'Gloomy melancholy': 1, 'three body movement': 1, 'sur le': 1, 'Le Forte 2 fractures': 1, 'Le syndrome des': 3, 'Le Fort II/III mid-face fractures': 1, 'gloominess': 9, 'TDD': 3, 'shizi tuidao -le': 1, 'houzi yabian -le': 1, 'yabian -le houzi': 1, 'Les douleurs faciales': 1, 'CTX-M-3': 7, 'Le Fort 1 osteotomy': 1, 'Le Fort 1 Osteotomy': 3, 'le fort': 1, '3MS impairment': 2, 'THREE': 15, 'gasp': 1, 'Le deuxieme': 7, 'Les formes': 4, 'three linear hypoplasia': 1, 'cytotoxic three-finger toxins': 1, 'Les sacroiliites infectieuses': 2, 'Le Fort III osteotomy': 6, 'Les recidives': 6, 'Les grosses bourses': 1, 'Les grosses bourses aigues': 1, 'TMI': 1, "Le Syndrome congenital d'obstruction": 1, 'le nouveau-ne': 1, "Le syndrome d'obstruction": 1, 'Le nouveau-ne': 5, "Le syndrome congenital d'obstruction": 1, 'Les ponctions vasculaires': 1, 'Le-fort I': 2, 'Les naevi choroidiens sont': 1, 'Les naevi choroidiens': 1, 'Les tumeurs brunes': 4, 'Le Fort II/III fracture': 1, 'Les nouveau-nes': 2, 'Le syndrome de Willebrand acquis': 1, 'le vaccinazioni': 1, 'Le vaccinazioni': 1, '3M&N': 3, '3M': 5, 'Yakuts short stature syndrome': 6, 'Les lesions tumorales': 1, 'three-legged stool': 1, 'Le papillon': 1, 'Le Fort-Wagstaffe tubercle': 1, 'ONLINE THREE': 1, 'TT': 3, 'Les malformations uterines': 1, 'Les tumeurs cerebrales foetales': 1, 'Les tumeurs foetales du systeme nerveux': 1, 'Le Fort I and II fractures': 4, 'TMD': 4, 'Le Fort type fractures': 11, 'Le Forte II fracture': 1, 'Les atteintes arterielles sont': 1, 'Le microcarcinome': 1, 'Le retinoblastome': 1, 'Le syndrome de Twiddler': 1, 'Les Glomerulonephrite chronique': 1, 'Les syndromes coronaires aigus': 1, "Le Fort's III fracture": 1, 'Three-dimensional hypophosphites': 1, 'Le syndrome de detresse respiratoire aigu': 2, 'TLA': 2, 'THree': 1, 'Le Double': 3, 'Le Double type II': 2, 'Le Double type 2': 1, 'Le Double type 1': 1, 'Le Mortine Oasis': 1, 'CNLS': 1, 'contre le Dopage': 1, 'Malme-3M': 7, 'TFP': 2, 'TMP': 1, 'Les resultats globaux': 1, 'Le syndrome respiratoire': 1, 'ALCS': 3, 'Le tricheur': 1, 'Le Fort III fractures': 31, 'M-3-SXN': 1, 'TOLCAS': 1, 'Tolchin-Le Caignec syndrome': 1, 'Gloomy mood pessimism': 1, 'Gloomy mood': 1, 'Les nouveaux': 3, 'Le Fort III type fracture': 2, 'Le Fort III fracture': 31, '3M.': 9, 'Les 16 0-IIa+': 1, 'OVX;Three': 1, 'ELT': 1, 'le-sion': 1, 'Les chirurgiens maxillo-faciaux': 1, 'combined deficiency of all three proteins': 2, 'scaphandre et le papillon': 1, 'Les occlusions intestinales': 1, 'MTC': 1, 'FGC/M types 1, 2 or 3': 1, 'Le Fort II and III middle face fractures': 1, 'Le syndrome inflammatoire multisystemique': 3, 'Le syndrome de Morpheus': 1, 'Le Fort1': 1, 'Maxilla Le Fort II fracture': 1, 'Le Fort pattern fractures': 3, 'Papillon Le Fevre syndrome': 1, 'cutaneous LEs lesions': 1, 'Le Fort type 2 fracture': 2, 'Leucochrysa (Nodita) camposi': 1, 'Nodita camposi': 1, 'Nodita azevedoi': 1, 'Les Tumeurs': 1, 'sick-le-beta0-thalassemia': 1, 'Le-': 4, 'three-dimensional (': 1, 'Le prolapsus': 1, 'Le mononucleose infectieuse TEST': 1, 'La brise et le soleil': 2, 'M-type 1, 3, and 5': 1, 'M-type 3': 6, 'M-type 3 GAS': 1, 'douleur est le maitre symptome': 1, 'Le Fort I, II': 2, 'Le Fort II and III': 6, 'Le piebaldisme': 2, 'Le Piebaldisme': 1, 'genetic defects in type one and three collagen': 1, 'Le syndrome hemorragique': 3, 'AML-M(3)': 1, 'Le dysraphisme': 1, 'gerer le syndrome': 2, 'le fort I': 4, 'SYNTHESIS OF 1-(M-HYDROXYPHENYL)-2-AMINO-1-PROPANOL': 1, 'three-dimensional spine abnormality': 1, 'three-ligament tenodesis': 2, '3-M Syndrome': 7, 'ETLE': 1, "Les Amis de l'ABC": 1, '3-M': 10, 'Three M syndrome': 3, '3-M (Miller, McKusick, and Malvaux) syndrome': 1, 'Le taux annuel de mortalite': 1, 'Na Le': 1, 'TAP': 2, "Les passions de l'ame": 1, 'Le fort': 10, 'Le Fort I and III': 5, 'Les personnes': 1, 'Le type de cryoglobuline': 1, 'capitis Le': 1, 'deficiency of three or more axes': 1, 'PLC': 19, 'Le-Fort II deformity': 1, 'extrapyramidaux ou le syndrome malin des neuroleptiques': 1, 'c-CTX-M-3': 1, 'Le Delire de Negation': 1, 'Les locaux': 1, 'dolichospondylic dysplasia': 3, '3M1': 1, 'Yakut short stature syndrome 3-M syndrome': 1, 'Slender bone dysplasia group 3-M syndrome': 1, 'or three': 2, 'Les papis sont': 1, 'TP': 5, 'Les nouveautes': 1, 'Pour le foetus': 1, 'Les chirurgiens de': 1, 'THREE-DIMENSIONAL EXTERNAL': 1, 'infection with Le': 2, 'Le Havre': 2, 'Le Fort III factures': 1, 'Le- vamisole-induced necrosis syndrome': 1, 'LINES': 1, 'POSITIVE 3 M': 1, 'Le handicap moteur': 1, 'Le Syndrome': 3, '3M syndrome dwarfism': 1, 'NND;three': 1, 'the 3M syndrome': 1, 'Les personnes fragiles': 1, 'Age Stroke Les': 1, 'Le nodule necrotique': 1, 'Le-Fort I': 7, 'chinaIsAs***le': 1, 'Le va': 1, 'Le syndrome post-ponction': 1, 'Les saints des catacombes': 1, 'Le Fort IV': 4, 'Le forte II and III': 1, 'Le-forte II and III': 1, 'Le Fort I Interpositional Defects': 1, 'deficiencies in three': 1, 'Connaitre les Syndromes': 4, '3 M Syndrome': 3, 'short stature syndromes 3M': 1, 'THREE-DIMENSIONAL OSTEOPATHY': 1, 'Les Kalman': 1, 'TFTs': 4, 'TGR': 1, 'Le type 2': 1, 'Les plaies vasculaires sont': 1, 'Les fonds speciaux': 1, 'Le Fort/5': 1, 'Les resultats obtenus': 2, 'LMLP': 1, 'Le lymphome primitif du': 1, 'le Syndrome respiratoire aigu': 1, 'TM': 2, 'Le Fort midface fracture': 1, 'Le Fort injuries': 4, 'Le Fort facial fractures': 3, 'malformation of three': 1, 'Les joueurs de cartes': 1, 'PNUD': 2, 'THP': 1, 'Le Fort 3': 5, 'Millenaire pour le Developpement': 2, 'Les Houches': 2, 'SIMS-E': 1, 'TGRR': 1, 'Le Fort III minus I': 1, 'le Fort fractures I to III': 1, 'THREE POINTS': 1, 'Yakut short stature syndrome': 2, 'THREE-DIMENSIONAL QUANTIFICATION': 1, 'le fort I fracture': 1, 'GLOOMY PROSPECTS OF HOSPITALIZATION': 1, 'lE.': 1, 'OC-3-IV-M': 1, "Le deuxieme l'a": 1, 'Le Fort I, II & III fractures': 1, 'Le Fort I & II': 1, 'Le Fort I or II fractures': 1, '3-MSBN': 1, 'slender-boned nanism': 2, 'M slender boned nanism': 1, 'Troponine le syndrome coronarien aigu': 1, 'Le Le syndrome de Fahr': 1, "Le Cam's": 1, 'Le syndrome inflammatoire': 5, 'Le torticolis': 4, 'LM': 2, 'Pouilly-Le-Fort': 1, 'TPLA': 2, 'Le Fort I, II and': 1, 'TTS': 3, '- Moyamoya - 42 M 17.00 3.00 Dyston': 1, 'Le Fort I, II, and III fractures': 8, 'le paludisme': 3, 'Le paludisme': 3, 'contre le': 4, 'Le Fort I and subcondylar fractures': 2, 'Clone M-3': 2, 'avulsion of the three': 1, 'Le Fort 3 fractures': 3, 'Le Fort 2': 4, 'Les maladies hereditaires': 1, 'Les malformations arterioveineuses': 1, 'CLIN': 1, 'impairment in three': 1, 'AIL': 2, 'Fronds of Le': 1, 'Le rhabdomyosarcome': 2, 'primordial growth disorder 3-M syndrome': 2, 'Le deuxieme outil': 1, 'TSA': 1, 'Le lupus erythemateux': 6, 'Le syndrome casse-noisette': 1, '3Ms': 6, 'Le Leiomyome': 1, 'OBTL': 1, 'Three-wheeled vehicle injuries': 1, 'TGDP': 1, 'le lambeau': 1, 'Le lambeau': 1, 'ischemic LEs': 1, 'Le Doux': 1, 'three-leaf clover': 1, 'tremor': 1, 'Le Fort II/III fractures': 2, 'Le deficit moteur': 1, 'Les meningiomes': 1, 'Le Fort fractures (I, II, and III': 1, 'Le Fort fractures (I,II, III': 1, 'Le Fort II and III fractures': 22, 'Le Blanc-Seing': 1, 'TCC': 2, "Writer's cramp L insula:M-III 51.3 45.3 40.3 Commonly gained hub in patients with lar": 1, 'THDOC': 1, 'THREE-TOED BOX TURTLES': 1, 'TS': 2, 'Les nouveaux cannabinoides': 1, 'Les teignes': 1, 'M-PCT-3': 1, 'le ishmaniasis': 1, 'Le paludisme macedonien': 1, 'ischaemia of three fingers': 1, 'T1-3N1-3M1': 1, 'T1-2N1-3M1': 1, 'Le syndrome de renutrition inappropriee': 1, 'Le molteplici traiettorie nei comportamenti dei fumatori': 1, 'ELFE': 1, 'Les grossesses': 1, 'Nasozygomatic-Le Fort fracture': 1, 'frontal-Le Fort fractures': 1, 'Le Fort 1 fractures': 1, "Les lesions s'etendent": 1, 'Le Cron carver': 2, 'Santeuil and Le Blanc infection': 1, 'Le Blanc infection': 1, 'Le Blanc': 1, 'Le Fort I osteotomies': 12, 'Les Faux-Monnayeurs': 1, 'HIGM type- 3': 1, 'HIGM type 3': 1, 'HIGM type-3': 1, 'Hyperimmunoglobulin M (HIGM) type 3': 1, 'TGP': 4, '-type PLC': 1, 'Le syndrome de penetration': 1, 'Les enfants': 2, 'M type 3': 1, 'Le Foetus in Foetu': 1, 'Le syndrome oedemateux': 1, 'Neer three- and': 1, 'TYO grass carp': 1, 'TYO': 2, 'M-3 tumor': 1, 'Agea Les': 1, 'Le syndrome de': 5, 'Le syndrome post-thrombotique': 1, 'Les malformations anorectales': 1, 'Le Fort III osteotomies': 1, 'Yakut short-stature syndrome': 1, '3-M syndrome disease': 1, 'gloomy face': 2, 'Three-Typed Syndrome': 1, 'three-typed syndrome': 1, 'TTSD': 1, 'Les virus sont': 1, 'TN': 1, 'THREE DIFFERENT NAMES': 1, 'T1-4N1-3M1': 3, 'le Fort III': 2, 'Les complications genitales': 1, 'PeVA3-M.': 1, 'PeVA3-M': 1, 'Le Fort II to': 1, "Le'go": 1, 'Le syndrome de regression': 1, 'Le Fort Type III fracture': 1, 'Le Fort Type I fractures': 2, 'Le Fort Type II fractures': 1, 'decline in three IADLs': 1, 'Wagstaffe-Le Fort': 2, 'Le(a+b': 1, 'MISTRG': 2, 'le sillon du processus caude': 1, 'Le Fort I or III': 1, 'gloomy personality': 1, 'three-pressure disease': 1, 'Hanxiang Le': 1, 'Le pseudomyxome': 1, 'Le Fort II fracture of the maxilla': 2, 'Le Fort II/III fracturesSkull': 1, 'Le metapneumovirus humain': 1, 'Les eczematides': 1, 'Le Fort III fracture of the maxilla': 2, 'fractures of the Le Fort II or III': 1, 'Les tumeurs ovariennes': 2, 'M. falcifera (3)': 1, 'Fc-M-3': 1, 'Le Double type III': 1, 'Le Fort type trauma': 1, 'Evito le cose disgustose': 1, 'lE': 3, 'le syndrome respiratoire aigu': 1, 'Le Fort III Fracture': 1, 'Le Fort III trauma': 1, 'Le deuxieme probleme': 1, 'Le virus': 7, 'Le syndrome de Kallman': 1, '3-M.': 1, 'Le Fort II or III fracture': 2, 'Le syndrome de Ballantyne': 1, 'Bon Les': 1, 'Type 4 Le syndrome': 1, 'Type 3 Le syndrome': 1, 'M.3': 1, 'Le Fort 1 injuries': 1, 'Le Pouce': 1, 'Le Fort type I': 7, 'THREE-DIMENSIONAL LAPAROSCOPY': 1, 'Miller-McKusick-Malvaux (3M) syndrome': 1, 'Le Fort-type fractures3': 1, 'CUL7 mutation - 3 M syndrome': 1, 'Le maitre': 2, 'CREATININE_3M': 1, 'Qinghai Three Thorns': 1, 'Wagstaffe le': 1, 'Type C PLC': 1, 'Le Fort Partial Colpocleisis': 1, 'Le Fort partial colpocleisis': 1, 'Le Fort II or Le Fort III facial fracture': 1, 'Le Fort II or III facial fractures': 4, 'Le kyste hydatique du foie': 1, 'Les mortalites lilloises': 1, 'Le difficile': 1, 'Les pyrethrinoides': 1, 'Le Fort midfacial fractures': 3, 'KPL-3M': 2, 'Le Fort Type 1': 1, 'Le Fort type 1': 1, 'le Fort type 1 fracture': 1, 'Le Fort type 1 fracture': 1, 'IDENTIFICATION OF THREE': 1, 'M(3)R': 1, 'Le Fort I, II, or III': 2, 'Le Fort III midfacial distraction': 2, 'Le Fort III Midfacial Distraction': 1, 'THREE-QUARTERS': 1, 'Les bronchiolites': 1, 'Les relations virus': 1, 'THREE- DIMENSIONAL MOULDING TITANIUM MESH': 1, "Les oubliees de l'histoire": 1, 'Le Forte colpocleisis': 1, 'Le Fort III facial fractures': 1, 'CTX-M 2 (3': 1, 'Le Fort I and II': 7, 'Le Fort III) fractures of the midface': 1, 'THREE-DIMENSIONAL PRESSING': 1, 'LVV occlusion': 1, 'Les Nevroses': 1, 'Le syndrome lymphoproliferatif avec autoimmunite': 1, 'Camey-Le Duc': 2, 'Le-gionellosis': 1, 'Les nouveau-nes sont': 1, 'Les infections nosocomiales': 1, 'Le-Fort II fractures': 1, 'Le fort I, II, III': 3, 'LF-I': 2, 'Le-fort type II fracture': 1, 'Le Fort 1 fracture': 5, 'Les calcifications parietales': 1, 'Le-Fort IV and I-III fracture': 1, 'Le Fort IV Fractures': 1, 'Le Fort IV fractures': 1, 'Le Fort I-III fractures': 1, 'Le Fort IV fracture': 1, 'Le Fort type fracture': 3, 'LFI': 1, 'Les meningiomes chordoides': 2, 'Pararotalia Le Calvez': 1, 'Allende and Le Viet type B': 1, 'Allende and Le Viet type B subsheath injuries': 1, 'Le Viet type D injuries': 1, 'Le Viet type B': 1, 'Le syndrome metabolique': 6, 'Noonan and 3M': 1, 'Le Fort injury': 2, 'Villiers-le-Bacle knee osteoarthtritis': 1, 'Le Fort fracture, type II': 1, 'Les syndromes paraneoplasiques': 1, 'M. lepromatosis 3': 1, 'Les tumeurs intrarachidiennes': 1, 'Bloom, 3M': 2, 'pseudo-le-syndrome': 1, 'Les glomerulopathies': 1, 'M type or type 3 diabetes': 1, 'Le-Roux': 2, '3-M syndrome 2': 1, 'carpometacarpal dislocation of the three': 1, 'Le Gal (1)': 2, 'fractures of Le Fort I, II and III': 1, 'Le syndrome viperin': 1, 'TNSP': 1, 'Le syndrome de resistance a': 1, 'DIFFERENTIATION OF THREE DISTINCT': 1, 'Les syringomes': 1, 'Le Fort II or III facial fracture': 2, 'PNET': 2, 'Les tumeurs neuroectodermiques': 1, 'M-3': 7, "Le medulloblastome chez l'adulte": 1, 'Les tumeurs laterales': 1, 'Le medulloblastome': 1, 'COMPARISON OF THREE': 3, 'SS type three': 1, 'Le Forte': 1, 'Les valvulopathies organiques': 1, 'THREE-DIMENSIONAL THERMOISOPLETH': 1, 'TREX1 deficiency': 3, 'Les nouveaux envahisseurs': 1, 'TM.Le': 1, '3M-growth syndrome': 2, 'le Fort I, II and III': 1, 'AUTOMATED THREE-CHAMBERED SOCIAL': 1, 'Les plaies': 3, 'Muricatum Les': 1, 'TH': 2, 'Ligue Contre le': 1, 'Ligue contre le': 2, 'Le pheochromocytome': 5, 'Le deficit congenital en facteur VII': 2, 'Le deficit en facteur': 1, 'Les valeurs': 3, 'Le deficit en facteur VII': 2, 'three-dimensional deformity': 4, 'le syndrome de sevrage': 1, 'Le syndrome de sevrage': 1, 'Le syndrome de sevrage nicotinique': 1, 'Le nouveau ne': 1, 'Le Bonheur': 1, 'Les T': 1, '3M:4F': 1, 'gloomy disease': 3, 'Le foetus': 2, 'Les nouveaux nes': 1, 'T3-4N2-3M1': 1, 'Les pharmaciens': 1, 'Gloomy feelings': 1, '(le fort I) osteotomy': 1, 'THREE-DIMENSIONAL DOPPLER': 1, 'Le fibrome a': 1, 'Le fort III fractures': 2, 'HPIV3 M': 2, 'preventab le': 1, 'Post Le Fort 1': 1, 'Le Blueberry Muffin Baby': 1, 'Oh Le (a-': 1, 'TL': 1, 'Three branch lesion': 1, 'ATD': 1, '3M syndrome': 1, 'primordial growth disorder 3M syndrome': 1, 'gloomy face syndrome': 3, 'Gloomy face syndrome': 1, 'HB Les': 1, 'Le syndrome inflammatoire biologique': 1, 'Le taux de complications tardives': 1, 'Le syndrome coronaire': 2, 'Le pheochromocytome est une tumeur': 1, 'Le(a-b-)': 11, 'Le-AC': 1, 'mutations. M-3': 1, 'Three-dimensional deformity': 1, 'Le dernier': 1, '& Les Biller': 1, 'Le syndrome infectieux': 2, '3-M dwarfism syndrome': 1, 'O le (a-b': 1, 'cerebral Le': 1, 'autosomal recessive hyper-immunoglobulin M (HIGM) syndrome type 3': 1, 'Hyper-immunoglobulin M syndrome type 3': 1, 'Le syndrome inflammatoire multisystemique de': 1, 'Les tumeurs epitheliales': 2, 'autosomal recessive 3-M syndrome': 1, 'TDB': 1, 'Les Invalides': 2, 'Olivier Le Saux': 1, 'LCS': 1, 'Le taux de mortalite': 1, 'K-3M': 1, 'gloomy feeling': 1, 'Le syndrome restrictif': 1, 'Le Fort I, II, or III fracture': 2, 'Three M Syndrome': 1, 'Three-M syndrome': 1, 'Le Fort II or III injury': 1, 'bise et le soleil': 1, 'TGM': 1, 'Le Fort II/III': 3, 'Le Fort III maxilla fracture': 1, 'Le Fort I, II and III fractures': 3, 'Neurological LEs': 1, 'neurological LEs': 1, 'neurologic LEs': 1, 'Type II 3 M': 1, 'Gloomy scale': 1, 'gloomy scale': 1, 'Gloomy Scale': 1, 'SR': 1, 'Les complications parietales': 1, 'Le-Ll': 1, 'THREE-': 3, 'Le syndrome de necrose retinienne aigue': 2, 'Les retinites': 1, 'Le virus migre': 1, 'le virus migre': 1, 'Le syndrome de Fuchs peut etre': 1, 'Les nouvelles donnees canadiennes': 1, 'Le syndrome de regression embryonnaire': 1, 'gloomy condition': 1, 'Les Bleues': 1, 'Le Fort I fractured': 2, 'Le Fort I and Le Fort II fractures': 1, 'Le Fort I or Le Fort II fractures': 2, 'Le Fort I or Le Fort II fracture': 1, 'Le Fort I and Le Fort II fracture': 1, 'Le Fort I and/or Le Fort II fractures': 1, 'Le Fort I and': 1, 'Le Fort II facial fracture': 1, 'M-9050/3': 1, 'PRDN': 1, 'Les thrombophlebites cerebrales': 1, 'Le Fort fractures of the maxilla': 1, 'Le Fort type of fracture': 1, 'Le Fort III DO': 2, 'Le Fort fracture type 1': 1, 'Les Nouveaux': 1, 'PPLAI-3M': 1, 'Le Fort II distraction': 1, 'CL': 1, 'Les maladies': 1, 'Les keratomycoses': 1, 'Choise-le-Roi': 1, 'Les Halles': 2, '-M-3': 1, 'Wagstaffe-Le Fort fracture': 1, 'three-week disease': 1, 'Papillon le Fevre': 1, 'Le Fort III-type sagittal fractures of the maxilla': 1, '3-M syndrome-1': 1, 'Le Fort III Osteotomy': 6, 'M (3) F (1) Meningitis': 1, 'three-leafed clover': 1, 'Le rehaussement tardif': 1, 'Le Fort I, II and III': 1, 'TASR': 1, '-lE': 1, 'Pipkin type three fracture': 1, 'Le Fort-Type Fractures': 1, 'Le Fort-': 2, 'Le Fort-type fractures': 2, 'Le Puy': 1, 'TNBC.Three': 1, 'M-3 melanoma tumors': 1, 'Le retard de croissance intra-uterin': 2, 'drogues et le crime': 1, 'Enceintes et les': 1, 'TRI': 1, 'THREE DIMENSIONAL': 1, 'Le Fort II and III type fractures': 1, 'Le syndrome dysmorphique': 2, 'FIN7-3 M': 1, 'FIN-ID4-3 M': 1, 'FIN23-3 M': 1, 'Le pontage aorto-coronarien': 1, 'Le syndrome de Koenig': 1, 'Le Fort II and III pattern fractures': 1, 'Le Fort Type I': 2, 'Le Fort Type II or III fracture': 1, 'Le Fort Type I fracture': 1, 'Le Fort Type II or III fractures': 1, 'three-fingered condition': 1, 'CH': 1, 'Le volume globulaire moyen': 1, 'Le syndrome de non dissociation': 1, 'Le frottis': 4, 'THREE-DIMENSIONAL SCHEME': 1, 'Le-Fort III fracture': 1, 'Le-Fort II': 1, 'Le Fort II or III maxilla fractures': 1, 'Le Fort II maxilla fracture': 1, 'La bambina gioca le dadi': 1, 'Le fort fractures': 1, 'Agenesis of three': 1, 'agenesis of three': 3, 'Le Nouveau Souffle': 1, 'melanoma M-3': 1, 'Le Fort III midfacial': 2, 'Le Mer': 1, 'TVSP': 1, 'Le nouveau-ne va': 1, 'Dolichospondylic dysplasia': 1, 'DD': 1, 'TICS': 1, 'Le syndrome de maltraitance': 1, 'tard le syndrome': 1, 'TLTPA-LRC': 1, 'les enfermes contagiades': 1, 'Le deuxieme pontage veineux': 1, 'malformations.le': 1, 'Les malformations uterines sont': 2, 'LBM': 1, 'le cerveau': 1, 'TOMS': 1, 'TPI': 2, 'TGRA': 2, 'Le Fort type III': 4, 'growth retardation disorder 3-M syndrome': 1, 'Le nerf ulnaire': 1, 'fractures of the Le Fort II': 1, 'Melanoma-MALME-3M': 1, 'Les condylomes acumines': 1, 'Le fort type II and III fractures': 1, 'Le terrain migraineux': 1, 'Les ischemies cerebrales': 1, 'Le syndrome des antiphosphilipides': 1, "Les's": 1, 'F-3MS': 1, 'THREE-MONTH-OLD INFANT': 1, 'MTDIC': 1, 'Le Bihan': 3, 'Le-fort fractures': 1, 'Les tumeurs parotidiennes': 1, 'Le Fort I, II, III fracture': 1, 'Le Fort Type III fractures': 1, 'Le caractere': 1, 'Le Fort type II/III': 1, 'Le Virus de Carre': 1, 'Le Louarn Scalp lesions': 1, 'Le syndrome nicotinique': 1, 'le syndrome central': 1, 'Le syndrome central': 1, 'EV': 1, "geriatric three D's": 1, 'le torticolis': 1, 'TTT': 1, 'CONSIDERING THREE': 1, 'Les cliniciens doivent etre avertis': 1, 'T2N2-3M1': 1, 'le analisi': 1, 'Le syndrome musculaire': 1, 'Le syndrome urinaire': 1, 'Le Fort II-III fractures of the maxilla': 1, 'Le taux de scolarisation': 1, 'Le-WP': 1, 'fracture;les': 1, 'THREE-DIMENSIONAL EVALUATION OF BRACKET ROUGHNESS': 1, 'Le-Fort III osteotomy': 1, 'MT': 1, 'ZT': 1, 'Reduire les Deces avec un Oeil sur': 1, 'Le Fort I, II, III': 3, 'Nephrotic and 3M syndromes': 1, 'three-finger ischaemia': 1, 'Les lesions intestinales': 1, 'M type-3': 1, 'yakut': 2, 'Le Fort II, III': 2, 'Le Bouton': 1, 'Le Fort distraction': 1, 'TREX1-deficiency': 1, 'RTL': 2, 'THREE-LIKE': 2, 'Le dermatofibrosarcome': 1, 'Le fort II': 2, 'Three-Decade Syndrome': 1, 'THREE-DIMENSIONAL RADIOTHERAPY': 1, 'M. Gordon infection': 1, 'Le Conte': 1, 'Le constat des cliniciens': 1, 'Noonan and 3M syndromes': 1, 'Les droits': 2, 'Les manifestations cutanees': 1, "Les convertis a l'islam": 1, 'Le Fort type I, II, III': 1, 'Muscovy three-week': 1, 'Les conges obtenus': 1, 'Le Fort II or III fractures': 2, 'Les urgences': 1, 'Le (a-': 2, 'TAS': 1, 'EDTD': 1, 'Le Fort I DO': 1, 'THREE-LEVEL': 1, 'Le Fort 3 and 2 fractures': 1, 'le-fort-1': 1, 'M. Waldenstrom (3': 1, 'Le decollement': 1, 'Le Fort upper facial fractures': 1, 'three-finger syndrome': 1, 'Lillo-Le Louet': 1, 'Le.': 5, 'Le Fort type I osteotomy': 1, 'left': 1, 'Le a in Oh': 1, 'le depistage en sante mentale': 1, 'Le deuxieme episode': 1, 'slg-D.': 1, 'slg-D': 1, 'keratotic papu-les': 1, 'Le (a-b': 3, 'TPNC': 1, 'MXT-M-3,2': 1, 'Les-2194': 1, 'Malme-3M.': 1, 'Le bilan hepatique': 1, 'y León': 1, 'BCs': 1, 'BC': 1, 'Three-': 3, 'CBT-3M': 1, 'tutte le aggressioni': 1, 'HETEROTYPIC THREE-DIMENSIONAL CELL CULTURE': 1, 'THREE-DIMENSIONAL CELL CULTURE': 1, 'the Le Fort II and III': 1, 'M. furfur children/3': 1, 'Le Fort I, II, III,': 1, 'Le syndrome hemolytique et uremique': 1, 'Les signes extra renaux': 1, 'Le syndrome renal': 1, "Le parole dell'incanto": 1, 'Le syndrome de jonction pyeloureterale': 1, 'FO-LEs': 1, 'ATARAO': 1, 'FROM THREE INDIVIDUALS': 1, 'Le Fort type II and III fracture': 1, '3M syndrome-': 1, 'Le.pn': 1, 'Le Fort II level fractures': 1, 'Les tumeurs du syndrome': 1, 'Le indagini virologiche sui campioni biologici raccolti': 1, 'Les Maladies nerveuses': 1, 'Les leucemies': 2, 'Les atteintes costales': 1, 'Le Fort I/II/III fractures': 1, 'PREOPERATIVE THREE-DIMENSIONAL PLANNING': 1, 'TBN': 1, '3 M': 1, 'Les syndromes': 1, 'Le syndrome de Laugier Hunziker': 1, 'le TURP syndrome': 1, 'Le TURP syndrome': 1, 'Le syndrome ganglionnaire': 1, 'le va tapuia': 1, 'Les atresies de l oesophage': 1, 'Le type III': 2, 'Le Fort III type fractures': 1, 'fracture maxilla Le Fort I': 1, 'le syndrome metabolique': 2, 'LEEM': 1, 'Gloomy facial expression': 1, 'Se-Le': 1, 'Le Fort 3 fracture': 1, 'TDDS': 3, 'TSP': 1, 'Le(': 2, 'Le syndrome de Good': 1, 'loss of three': 2, 'TMTP': 1, "Le syndrome d'immunodeficience acquise": 1, 'three-dimensional': 1, 'Hermann-Le': 1, "Le syndrome de l'immunodeficience": 1, 'Le Fort type 3 fracture of the maxilla': 2, 'Le panamensis': 1, 'Le- fort 2 fracture': 1, 'Le fort 2 type fracture': 1, 'fracture of three or': 1, 'of Le': 1, 'Le Double type 3': 1, 'Les heterotopies pancreatiques': 1, 'PP-3M': 2, 'Three Diseases': 1, 'Le Fort I osteotomized': 1, 'Le-ADMM-UC': 1, 'TKKD': 1, 'Le mal napolitain': 1, 'AVVIH': 1, 'AVVIH auraient': 1, '3-M and Yakuts syndromes': 1, 'autosomal-recessive 3-M': 1, 'Yakuts Short Stature syndrome': 1, 'Yakuts short stature syndromes': 1, 'Yakuts syndromes': 1, 'Le Fort Type II fracture': 1, 'Le sigue en': 1, 'Le fort 1, 2 and 3 fractures': 1, 'Le Fort I (LFI)': 1, 'Le syndrome drepanocytaire': 2, 'three-finger ulnar longitudinal deficiency': 1, 'Hom 3 M syndrome': 1, '3-M syndrome type 2': 1, '3-M (Miller McKusick Malvaux) syndrome': 1, 'Le Mythe': 1, 'Le[a': 1, 'Les Autres and Dysmelia': 1, 'Le Fort II+III fracture': 1, 'Le Fort I+II fracture': 1, 'Le Fort I+ II+III fracture': 1, 'le fort type fractures': 1, "Le cardiologue et l'infection": 1, '3-M dwarf syndrome': 1, 'Le linge des': 1, 'Le-Fort-I osteomtomy': 1, 'Le-Fort-I': 1, 'OMTSE': 1, 'and three': 2, 'Three-wheeler injuries': 1, 'Le virus respiratoire syncitial': 1, 'swelling of three or more': 1, 'Le Fort I, II, and III) fractures': 1, 'Helicopsyche (Feropsyche) cipoensis': 1, 'Feropsyche': 1, 'THREE-DIMENSIONAL (3D)': 1, "J'etais envahie par le syndrome de l'imposteur": 1, 'Le syndrome post-streptococcique': 1, 'Le syndrome post-': 1, 'gloomy complexion': 2, 'maschera-le-parole-ai': 1, 'Le Fort I or III fracture': 1, 'mid-face Le Fort fractures': 1, '3-M and gloomy face syndromes': 1, 'CT-L': 1, 'growth-related disorder 3-M syndrome': 1, 'Le Fort maxilla fractures': 1, 'gloomy spirit': 1, 'Three Gorges Dam': 2, 'Le lesioni da pressione': 1, 'Le lineeguida': 1, '3-M Syndrome 2': 1, 'type three fractures': 1, 'Le coronarien': 1, 'Stiff-three limbs syndrome': 1, 'stiff-three limbs syndrome': 1, 'Le Fort III injuries': 2, '-Le Chatelier': 1, 'MOTE#1': 1, '3MS-': 1, 'T-POST': 1, 'Les urgences traumatiques': 1, 'THREE-DIMENSIONAL SOLUTION FOR': 1, 'Le deuxieme facteur': 1, 'Les valeurs phares': 1, 'Le(y+) carcinoma': 1, 'le maitre symptome': 1, 'hypoimmunoglobulinemias M and G1-3': 1, 'high Le Fort I': 1, 'Le Fort fracture I': 1, 'Le-Fort I fractures': 1, 'High Le Fort I': 1, 'Le-Fort II, III': 1, "Le Fort's fractures of": 1, 'Les lesions cerebrales': 1, 'Le Fort type-': 1, 'Le deuxieme groupe': 1, 'Les Enfants': 1, 'TNT': 1, 'three-dimensional (3D) deformity': 1, "Le syndrome d'immunodeficience": 1, 'Les lesions vasculaires': 2, 'le virus': 2, 'Le zanzare trasferiscono la LF': 1, 'Les viols incestueux': 1, 'POPULATIONS OF TWO- AND THREE-TOED SLOTHS': 1, 'Les Degeneres': 1, 'les sirops': 1, 'Les sirops': 1, 'Les Infections': 1, '(Le Fort and zygoma) fractures': 1, 'Le Fort and subcondylar fractures': 1, 'Le Fort I downfracture': 7, 'Les cervicalgies et douleurs du membre superieur': 1, '(Ib) 3-M syndrome': 1, 'Les lesions intestinales obstructives': 1, 'Cotard le delire de negation': 2, 'Le mecanisme du syndrome': 1, 'Les bilans': 1, 'Le syndrome du canal carpien': 3, 'le syndrome du canal carpien': 1, 'Glycemic profi le': 1, 'fractures of Le Fort type II': 1, 'TFESI': 1, 'Le Fort III facial fracture': 1, "Le Mesurier's cheiloplasty": 1, 'Le fort III': 1, 'Les mystiques syriaques': 1, 'Les manuscrits syriaques': 1, 'Le syndrome du soleil levant': 1, 'le meningiome': 1, 'Le meningiome': 1, 'Le Fort type II': 5, '1 and three': 1, 'Le syndrome nephrotique': 1, 'Les droits du': 1, 'TAAT': 1, 'three-limb palsy': 1, 'primordial growth disorder 3M syndrome': 1, 'Le Fort I~III': 1, "(Neer's three- and": 1, 'Cuiry Les Chaudardes 1': 1, 'Le Fort I injuries': 2, 'Le Fort I, II, or III fractures': 2, 'Le Fort II injuries': 1, 'Les tumeurs benignes': 2, 'Malme 3 M': 1, 'Le TT': 1, 'Le virus de l immunodeficience humaine': 1, 'Le Fort-3 fractures': 1, 'Le Fort-1 fractures': 1, 'Le Fort-2 fractures': 1, 'TREX1-related disorder': 1, 'TREX1-related disorders': 1, 'Le Fort II -': 1, 'Le Fort III - 4': 1, 'Barratt Impulsiveness le': 1, 'Le syndrome du': 1, 'le pheochromocytome': 1, 'Le-Fort II and III': 1, 'T3Nx-3M1': 1, 'THREE-YEAR-OLD': 1, '3-M syndrome type I': 1, 'latentcfwmicaf Les': 1, 'TBT': 1, 'Le fort fracture': 1, 'Le Fort-I': 4, 'M-types 1, 3, 5, 6, 14, 18, 19, 24, 27 and 29': 1, 'varus deformity?Three': 1, 'Le fort I Osteotomy': 1, 'Le fort I osteotomy': 2, 'deficiencies in three or more pituitary axes': 1, 'Le Fort III level fractures': 1, 'MTBC lineage 3': 1, 'Le forte fracture of the': 1, 'THREE-DIMENSIONAL COUPLED': 1, 'Le bricoleur': 1, 'Le Fort type II and III': 1, 'Le virus de': 2, 'TE': 1, 'M stage 2/3': 1, 'Les toxicites': 1, 'les toxicites': 1, 'Le(a+b+)': 1, 'M. parainfluenzae type 3 infections': 1, 'deficiencies in three executive functions': 1, 'paroxysmal AF.Three': 1, 'MLP': 1, 'gloomy mood': 4, 'cT1-3N0-3M1': 1, 'le socks and gloves syndrome': 1, 'S.M.3': 1, 'Centre maternel et infantile sur le': 1, 'Le syndrome de lyse tumorale': 1, 'Le Saux and': 1, 'Les caisses maladie uberisees': 1, 'three-degree dysplasia': 1, 'Lilo-Le Louet': 1, 'TD': 1, 'LFC': 1, 'Bourgelat - Les': 1, '1a-1b-S-3a-3b-E-M-5a-5b-N-3': 1, '-le-': 1, 'Les retinopathies pigmentaires': 1, 'Les gangas': 1, 'fasheng-le': 1, 'Fasheng-le': 1, 'autoimmune LEs': 1, 'Le Fort osteotomies': 2, 'dans les Anevrysmes': 1, 'Le VIH de type 1': 1, 'Le suivi': 1, 'three-nostril malformation': 1, 'Le 16': 1, 'Le lupus bulleux': 1, 'Gloominess': 2, 'Les plis falciformes retiniens': 1, 'T2-4N2-3M1': 1, 'Le lambeau fascio-cutane': 1, 'Les tumeurs humaines': 1, 'affidabilita e correlazioni tra le variabili': 1, 'inflazionato le correlazioni': 1, 'humaniser le soin': 1, 'Hb Antibes-Juan-Les-Pins': 1, 'HINDERED BY THREE FACTORS': 1, 'le-': 1, 'Les nouveau-nes infectes': 1, 'Les atteintes articulaires': 1, 'AAM': 1, '3M syndrome type I': 1, 'Le syndrome du choc toxique': 1, 'Les traumatismes abdominaux': 1, 'Le Fort II osteotomy': 1, 'IQLFIIO': 1, 'Le Fort II Osteotomy': 2, 'Les Noisats': 1, "Le syndrome de l'oeil": 1, "Le syndrome de l'oeil sec": 1, 'Se-Le-': 1, 'M, type 3, por 2': 1, 'Le Veen': 1, 'Les dystocies': 1, 'Le scepticisme': 1, "Le Gal's type V": 1, "Retrouver le fil de l'histoire": 1, 'Le vieux marcheur': 1, 'Le-Fort-I-Osteotomy': 1, 'Normocephalic 3-M syndrome': 1, 'three-fold syndrome': 1, 'le Fort I': 2, 'Les tumeurs stromales gastro-intestinales': 1, 'TOAD': 1, 'Le Fort I intrusion': 3, 'de Digne Les Bains': 1, '3-M short stature syndrome': 1, 'spinal three-dimensional deformity': 2, 'capital le fue conmutada por prision': 1, 'Le tophus goutteux': 1, 'Le Fort II and III craniofacial fractures': 1, 'Le Fort I fracture of the maxilla': 2, 'Le deficit': 1, 'Trex1 deficiency': 1, 'anxious or gloomy': 1, 'Le 124': 1, 'le mangia': 1, 'Les Aguerris': 1, 'anxious and gloomy': 1, 'type I 3-M syndrome': 1, "Le Fort's fracture": 1, 'three mildews': 1, 'Le Fort-III': 1, '3M-syndrome': 1, 'Le Fort 2 fracture': 1, 'Le Fort-2 fracture': 1, 'Les nouvelles vertus': 2, 'Le Fort III Fractures': 2, 'Le I, II, and III fractures': 1, "Neer's three-part fracture": 1, 'Les souris': 1, 'Le syndrome thalamique&quot': 1, 'Le syndrome parkinsonien': 1, 'Le Fort 2 or 3 fracture': 2, 'Le Fort (': 1, 'le fort i': 1, 'LC': 2, 'TWJ': 1, 'Le Fort I fracture of': 1, 'Le Fort II/': 1, 'Le Fort II/III facial fractures': 1, 'Three P': 1, 'gloomy mentality': 1, 'three-cord block': 1, 'THREE-D': 1, 'TGP -': 1, '3M:2F': 1, 'PvVIH': 1, 'Les meningites': 1, 'Le syndrome de Haglund ou syndrome du calcaneum': 1, 'Pesaro Class three': 1, "Le torticolis febrile chez l'adulte": 1, 'Le lambeau suscite': 1, 'FAB M 3': 1, 'Le Fort-ll and lll': 1, 'M-8120/3': 1, 'Le Duc': 1, 'Les Houches Accord': 1, 'THREE-DIMENSIONAL SPECKLE': 1, 'Le Fort I and II level fractures of the maxilla': 1, 'Le deuxieme point': 1, 'TG': 2, 'Le Forts fractures': 1, 'Le Forts fracture': 1, 'Three-M syndrome Disorders of': 1, 'Le Fort III (': 1, 'Les nodules thyroidiens': 1, 'three-finger-syndrome': 1, 'DICRO-3-M-i': 1, 'Les kystes mucoides du ligament croise anterieur': 1, 'TBI': 1, 'M/3': 2, 'Le pheochromocytome etait': 1, 'Les Repig 1': 1, 'M_8140_3': 1, 'LF I': 1, 'Le goitre': 2, 'Les dysthyroidies': 1, 'Le Fort I complication': 1, 'deficiency in three pituitary axes': 1, 'Three-part Fractures': 1, 'Les tumeurs stromales': 2, 'three-P association': 1, 'Yakuts syndrome': 1, 'Yakut short stature syndromes': 1, 'Merrer syndrome': 1, 'Le syndrome malin des neuroleptiques': 1, 'Meihui dadong-le Jieyi': 1, 'Jieyi bei Meihui dadong-le': 1, '-man-le shu': 1, 'paraesthesia of first three fingers': 1, 'THREE - DIMENSIONAL': 1, 'Oraux pour Reduire les': 2, 'thr deficiency': 1, 'Le suicide': 1, 'Connaitre les Syndromes Cerebelleux': 2, 'CSC': 1, 'Les nouveaux avis positifs': 1, 'IE': 1, 'Le Fort 1 MA': 1, '3M disease': 1, 'HIV, 3M syndrome': 1, 'type 1 3M syndrome': 1, 'les cheloides': 1, 'Les cheloides': 1, 'Saint-Gerand-le-': 1, 'Le(a': 1, 'Injury of three': 1, 'THREE-CELL': 1, 'PM-3M': 1, 'fracture of three fingers': 1, 'Le fort I (': 1, "Le virus de l'immunodeficience humaine": 1, 'PLG': 1, 'APT': 1, 'Les consequences foetales': 1, 'Le Fort I and III fractures': 3, 'Le deficit en facteur V': 1, 'Le deficit congenital en facteur V': 1, 'PEROXISOMAL DIVISION COMPRISES THREE': 1, 'TME3': 1, 'Le Fort I plus II': 1, 'Le Fort I plus II fracture': 1, 'Le Fort I, II, and III fracture': 1, 'M-QS-3': 1, 'Le syndrome de Casse-Noisette': 1, 'arabe litteraire chez les militaires tunisiens': 1, 'autosomal-recessive growth retardation disorder 3-M syndrome': 1, 'Le noyau cellulaire': 1, 'Le Fort and palatal fractures': 1, 'LBD': 1, 'Le Bon Depart': 1, '3-M dwarfism': 3, 'type 1 3-M syndrome': 1, 'le leucemie-linfomi e mieloma': 1, 'Le Syndrome des Ovaires Micropolykystiques': 1, 'Le syndrome des ovaires micropolykystiques': 1, '-pour-les-hauts-fonctionnaires': 1, 'Le prothorax': 1, 'Le virus respiratoire': 1, 'Le racisme': 1, 'LEVEL THREE': 1, 'Le fibrome porteur': 1, 'Le-Fort III': 1, 'Les maladies thoraciques': 1, 'Le Fort I Downfracture': 1, 'Toussus-le-Noble': 1, 'Le-Fort-': 1, 'Hu hun e ru le': 1, "Le surpoids et l'obesite": 1, 'THREE DISTINCT': 1, 'Le xanthelasma': 1, 'Le maitre symptome': 2, "Le cavernome porte chez l'enfant": 1, 'Les lesions siegeaient majoritairement': 1, 'Le Syndrome respiratoire': 1, 'T4N2-3M1': 2, 'big three diseases': 2, 'MTS': 1, 'ABH-Le': 1, 'TLS': 1, 'Le henne': 1, 'le henne': 1, 'Le Fort I, II, III)': 1, 'Le lymphangiome kystique': 1, 'RSS or 3-M syndrome': 1, "Les principaux symptomes etaient l'eruption": 1, 'Les principaux symptomes': 2, 'Les malformations foetales': 1, 'Oral M 1 1 Injury': 1, 'Le Fort type I fractures': 2, 'Les anomalies urogenitales': 1, 'Vomer Le Fort 1': 1, 'Fize-le-': 1, 'traumatisme.les': 1, 'tendineuse.les': 1, 'Le lambeau musculo-cutane': 1, 'Le Fort II or III midfacial fractures': 1, 'TA': 1, "Les molaires commencent a s'user, on observe l'erosion des cuspides.Le sphenoide inferieur": 1, 'Long Pi Le': 1, 'SD': 1, "Le syndrome de l'homme": 1, 'TEa': 1, '-TWC': 1, 'Le limb body wall complex': 1, 'traduisant le syndrome lesionnel': 1, 'Fernand Leger Les': 1, 'Le Moustier lumps': 1, 'LTTS': 1, 'Le Syndrome Coronarien': 1, 'Les coronaropathies': 1, 'TFA': 1, '-les-': 1, 'CCF': 1, 'BLH': 1, 'le syndrome tumoral': 1, 'Le syndrome tumoral': 1, 'IG': 1, 'Le Fort I setback': 1, 'TCS': 2, 'Le-gionella': 1, 'Le dieci azioni': 1, 'Le Fort II and III osteotomy': 1, 'EAHE': 1, 'frontal sinus and Le Fort fractures': 1, 'Le Fort and frontal sinus fractures': 1, 'Le Fort type osteotomy': 1, 'Le Fort I facial fractures': 1, 'Le guyen': 1, 'Le cubitus varus post traumatique': 1, "che non condividono le mie idee sull'alimentazione sana": 1, 'SOFT, 3M syndrome': 1, 'Le dernier malade': 1, 'Le Fort III/I': 1, 'LF1': 1, 'N1-3M1': 1, 'Le type I': 1, 'Le type II': 1, 'TRT': 1, 'Le Mans': 1, '3-M disease': 1, 'Le Fort I PSI': 1, 'Les pheochromocytomes de localisation bilaterale': 1, 'Le Fort type (I, II, or III)': 1, '3-M syndrome 1': 1, '3M1, 3-M syndrome 1': 1, 'CO': 1, 'Le-Fort I osteotomy': 1, 'Les souches': 1, 'Le nourissona': 1, 'L-A': 1, 'anhedonia': 1, 'Adansonia digitata': 1, 'Depuis le syndrome respiratoire aigu': 1, 'cTNM': 1, 'Tolchin-Le Caignec': 1, 'type I, II, and III Le Fort fractures': 1, 'Type 3 HIGM': 1, 'T1-4N0-3M1': 3, 'ASPF': 1, 'FGD.M.3': 1, 'IDI.M.3': 1, 'ATL': 1, 'Les etapes du processus infectieux': 1, '-3M.': 1, 'les douleurs thoraciques': 1, 'Les douleurs thoraciques': 1, 'VML': 2, 'Le syndrome du condyle occipital': 1, 'Le Gouill': 2, 'Vaincre les maladies lysosomales': 1, 'LIGUE contre le': 1, 'ICD-O-3 M-9690-9698': 1, 'fracture of the first three costae': 1, 'Les Cottes': 1, 'les Cottes': 1, 'Les leucogrammes caracterises': 1, 'Les leucemies eosinophiliques': 1, 'Le Fort types I, II and III': 1, 'M-3-9-': 1, 've-shinantam le-banecha': 1, 'mydriatic;three': 1, 'THREE-DIMENSIONAL NUCLEAR': 1, 'Le Fort-I fractures': 2, 'Le Fort-I osteotomies': 2, 'TMDT': 1, 'M-8333/1,3 neurofibroma': 1, 'Le Fort or NOE fractures': 1, 'Le Fort complex fractures': 1, 'LFFs': 1, 'Le Premier Seminaire': 1, 'Les nouveaux poissons': 1, 'Le crisi sono tipicamente poco frequenti': 1, 'L-I.': 1, 'Le syndrome des anti-synthetases': 1, 'Le syndrome thoracique aigu': 1, 'Les urgences drepanocytaires sont': 1, 'and Le-Fort fractures': 1, 'Le-Fort fractures': 1, 'le virus de': 1, 'Cytotoxic three-finger toxins': 1, 'sLF III': 1, 'Le Fort III osteotomic': 1, 'Le(b)': 1, 'Le dernier bal': 1, 'CAUSES THREE DISTINCT': 1, 'Le sommet': 1, 'Les Dogues black': 1, 'Les Dogues': 1, 'Les Dogues pigments': 1, '3 M syndrome 2': 1, 'Le petit Oranais': 1, 'pvVIH': 1, 'deficiency of three limbs': 1, 'Le (a+b+)': 1, 'Les tumeurs retroperitoneales': 1, 'en violence conjugale chez les lesbiennes': 1, 'les valeurs': 1, 'Le(a -': 1, 'three-dimensional deformities': 1, 'Le retroperitoine': 1, 'Le Fort NOE': 1, 'Le Fort2': 1, 'THREE DIFFERENT CELL': 1, 'Le Fort type 2': 1, 'Le Fort type 2 fractures': 1, 'Le Fort type 3': 1, 'Le Fort type 3 fracture': 1, 'Qi Su Bu Ri Le Du Sen"': 1, 'Le syndrome de penetration etait le maitre symptome': 1, 'dislocation of three costochondral junctions': 1, 'Le syndrome des jambes sans repos': 1, 'HIVSS-M-3': 1, 'Le Damany': 1, 'COMPARISON OF THREE BRANDS': 1, 'Les principaux signes': 1, 'Le syndrome de Ballantyne ou': 1, 'Les mutilations genitales feminines': 1, 'Le syndrome catastrophique': 1, 'TULS': 1, 'Wagstaffe-Le Fort 2': 1, 'Le Forte II': 1, 'TLR': 1, 'Le Fort I type fractures': 2, '-les-Mines': 1, 'CTX-M Type 3 FIC': 1, 'CTX-M Type 3 Y': 1, "Le Fort's fractures": 1, 'three-locker injuries': 1, 'Three-locker injuries': 1, 'three-locker injury': 1, '2F:3M': 1, 'C-M stage 3': 1, 'Les meningiomes intracraniens operes': 1, 'TSMP': 1, 'abnormalities in three nerves': 1, 'Le-fort I fracture': 1, 'Le-fort II fracture': 1, 'Le Roy': 1, 'Le manifestazioni': 1, 'le lesioni cutanee gravi': 1, 'le informazioni sulla salute': 1, 'deficiency of three': 1, 'Location Les': 1, 'Three Gorges': 1, 'spinal three-dimensional malformation': 1, 'THREE-DIMENSIONAL CELL': 1, 'RESRIP': 1, 'Les Autres': 1, 'le tue mosse': 1, 'TLMA 1': 1, 'lES': 1, 'TDPC@S': 1, 'TDPC': 1, '3M syndrome type 1': 1, 'Le Fort II and III midface fractures': 1, 'TPM': 1, 'three- and four-part fractures': 1, '18 - three body syndrome': 1, 'Les Greves deFrecul': 1, 'risultano coerenti con le utilita presenti': 1, 'Le Fort III osteodistraction': 1, 'Le syndrome nephrotique etait': 1, 'Le syndrome nephrotique idiopathique': 1, 'Le Fort Colpocleisis': 1, 'Oraux pour Reduire les Deces avec un Oeil sur': 1, 'Le Reunion': 1, 'Le Fort I osteotomy complication': 1, 'Les tumeurs de vessie': 1, '18- three body syndrome': 1, '21- three body syndrome': 1, 'Le cortex': 1, 'growth disorder 3-M syndrome': 1, 'THREE-STEP PROCESS': 1, 'MEOE-3M.': 1, 'Resume- Les toxicites': 1, 'CTX-M-1,3,10': 1, 'TPP': 1, 'Les delais de conception': 1, 'Les ictus amnesiques': 1, 'Les malformations veineuses': 2, 'Pierre Le Damany': 1, 'ACUPA-M': 1, 'Les quatre chiens': 1, 'PPPM/3M.': 1, '3-M syndrome type 3': 1, 'Les tumeurs mucineuses de': 1, 'Les bronchectasies': 1, 'TRP': 1, 'cT(3)N(2)M(': 1, 'THREE-TOED SLOTHS': 1, 'Les donnees': 1, 'Le noyau est ovale': 1, 'PLV': 1, 'Le deficit en 11ss hydroxylase': 1, 'T1N1-3M1': 1, 'three-in-one syndrome': 1, "Le syndrome d'apnees obstructives du sommeil": 2, 'SCQ1-3M.': 1, 'Le Leiomyosarcome': 1, "Les Hatton's absence": 1, 'Le-Fort II fracture': 1, 'Les coronariens': 1, 'Les valvulopathies': 1, 'Les valvulopathies cardiaques': 1, 'Le Fort I and II)': 1, 'Les militaires senegalais': 1, 'Le Fort I/II fractures': 1, 'Le Fort I/ II fractures': 1, 'FBF': 1, 'TN2-3M.': 1, 'OF THREE-DIMENSIONAL': 1, 'APPLICATIONS OF THREE-DIMENSIONAL': 1, 'Les rois aussi': 1, 'Les tumeurs du mesenchyme et': 1, 'Les tumeurs non epitheliales malignes': 1, 'Le carcinome embryonnaire': 1, 'Les tumeurs germinales': 1, 'Digne-Les-': 1, 'Le Fort III/': 1, 'TR': 2, 'congenital growth disorders 3M': 1, 'TLOP': 1, 'CIN2 or three': 1, 'Les tumeurs benignes du': 1, 'gloomy dampness': 1, 'Le Fort-I fracture': 1, 'TC': 1, 'Etude sur le vieillissement arteriel': 1, 'syndrome tumoral et le': 1, 'Vaincre Les Maladies Lysosomales': 1, 'Le ossa umane': 1, 'Le Fort Iota': 1, 'Le Fort 15': 1, 'Les spondylites': 1, 'COCHE': 1, 'Le syndrome des ongles jaune': 1, 'CCDC8 3 M syndrome': 1, 'Obsessions et les': 1, 'et reduire le handicap moteur': 1, 'rught maxilla Les': 1, 'congenital growth disorder 3-M syndrome': 1, 'Les valeurs allaient': 1, 'gloomy thoughts': 1, 'ROUTINE THREE-DIMENSIONAL MAGNETIC': 1, 'Le syndrome de brides amniotiques': 1, 'Yakut khomusists': 1, 'TB': 2, 'les tumeurs stromales': 1, 'IRCT.Le': 1, 'Les meningites tuberculeuses': 1, 'Le Fort/naso-orbitoethmoidal': 1, 'Le Fort/NOE complex fractures': 1, 'Le Fort / NOE fractures': 1, 'Le fort-': 1, 'Les nouveaux defis': 1, 'Le Fraumeni syndrome': 1, 'deficiency in three axes': 1, 'Le fort 1': 1, 'Le Fort,': 1, 'Le Fort" type 2 fracture': 1, 'Le syndrome pseudogrippal': 1, 'Valentin le desosse': 1, 'Les adenocarcinomes': 1, 'Le fort I.': 1, 'Spencer and Le': 1, 'Le pseudo-syndrome': 1, 'COMPARISON OF THREE-DIMENSIONAL': 1, 'III (three-enzyme deficiency': 1, 'TDC-3M.': 1, 'Reduire les Deces avec un Oeil sur la': 1, 'Marine Le Pen': 1, 'Le Fort I type fracture': 1, 'Le Fort-fractures': 1, 'Le Fort II type fracture': 1, 'Deauville three': 1, 'Le probabilita e le utilita': 1, 'three-ligament-injured': 1, 'le syndrome occlusif': 1, 'STDANS': 1, 'Le Fort fracture type II': 1, 'Le Fort fracture type III': 1, 'Le Fort fractures I, II, and III': 1, 'Le Fort fracture type I': 1, 'Han-Dan-Gan-Le': 1, 'Les associations syndrome myelodysplasique': 1, 'Les syndromes coronariens': 1, 'Code red three': 1, 'Le periple du cancereux': 1, 'Le Fort I and III external distraction': 1, 'Le carcinome de type 2 se': 1, 'Yakut yellow': 1, 'linear growth 3-M syndrome': 1, 'Les Amoureux': 1, 'les amoureux': 1, 'TSM': 1, 'TNA': 1, 'Le temperament cyclothymique': 1, 'Gloomy Mood': 2, 'Le Fort facial fractures of': 1, 'Le Fort-I/': 1, 'Le dernier enfant': 1, 'ICD-O-M-9425/3': 1, 'Neer three part fracture': 1, 'Les anciens': 1, 'TGS': 1, 'les virus': 1, 'swelling of three or more joints': 1, 'Le Fort (level II or III) injury': 1, 'Malme 3M': 1, 'SCC': 1, 'big three': 1, 'Les formes cervicales': 1, 'SERD': 1, 'PC-3-M': 1, 'inherited human genetic disorder 3M syndrome': 1, 'human genetic disorder 3M syndrome': 1, 'Le Merrer and Nogues': 1, '3M growth syndrome': 1, 'AD 3M syndrome': 1, 'OP': 1, '3-M primordial dwarfism': 1, 'demodecie generalisee chez le chien': 1, 'Le taux moyen': 1, 'le Paludisme': 1, 'Le Fort and zygoma': 1, 'Le Grand Derangement': 1, 'Le Fort-Wagstaffe fracture': 1, 'deficiency of all three collagen XVIII isoforms': 1}
|
Le
|
Disease
|
MESH:C535317
|
{'47, XYY': 83, '47,XYY': 247, 'XYY anomaly': 2, 'XYY syndrome': 252, '48,XYY, +21': 1, 'XYY': 250, "Jacob's disease": 35, "Jacob's syndrome": 20, 'pyy': 1, "Jacob's Syndrome": 3, '47 XYY syndrome': 7, 'Klinefelter and 47 XYY syndromes': 1, "Creutzfeld-Jacob's": 5, '47,XYY syndrome': 82, '47 XYY': 11, 'YY-syndrome': 4, '47, XYY syndrome': 44, '47 XYY chromosomopathy': 1, 'XYY Chromosome': 2, '47,XYY syndromes': 5, 'XYY, XYY syndrome': 2, 'XYY Syndrome': 12, 'YY disomy': 4, "Jacob's autism": 1, "Creutzfeld's-Jacob disease": 2, 'CH-YY infection': 1, "Jacob's Disease": 6, '47,XYY abnormality': 3, '46,XY/47,XYY syndrome': 1, 'XYY syndromes': 7, "O. Jacob's disease": 1, 'trisomy X, XYY': 1, 'XYY-syndrome': 8, "Jacob's syndromen": 1, 'XYY,': 1, 'XYY and XXYY syndromes': 3, 'XYY-': 1, 'XYY/XXYY syndrome': 2, 'XXYY and XYY syndromes': 2, '47,XYY Syndrome': 7, '47,XYY chromosomal disorder': 1, ', XYY': 1, "Jacob's ulcus rodens": 1, 'YY syndrome': 15, '48,XXXY and 47,XYY syndromes': 1, 'CJD': 3, 'Jacob syndrome 47, XYY': 1, 'disomy YY': 2, "Jacob's ulcer": 2, "Jacob's edematous necrosis": 1, '48,XYY,+': 1, 'XYY chromosome complement': 2, '48,XYY': 3, 'YY aneuploidy': 1, 'XYY and XXY syndromes': 2, 'CH-YY': 1, 'and YY disomy': 1, '47, XYY super-male syndrome': 1, '47; XYY syndrome': 1, 'XYY condition': 4, 'Classic XYY syndrome': 1, "Crutzfeld-Jacob's disease": 1, 'JD': 3, 'Polysomy Y or XYY': 1, 'XYY-Syndrom': 1, 'Trisomy XYY': 1, '48, XYY': 2, 'T-XYY': 1, 'trisomy XYY': 1, 'DS-XYY': 1, 'XYY+ASD': 1, 'XYY-ASD': 1, ', and YY disomy': 1, 'Jacob s disease': 1, 'XYY syndorm': 1, "Creutzfield-Jacob's disease": 3, 'XYY and trisomy X syndromes': 1, 'XYY and Trisomy X syndromes': 1, "Creutzfeld-Jacob's encephalitis": 1, 'double Y (47,XYY) syndrome': 1, "Langenbeck's and Jacob's disease": 1, 'XYY abnormality': 3, '47, XYY-45': 1, 'Trisomy 47 XYY': 1, 'Double Y,[47,XYY': 1, '47,XYY/47,XY, +mar and supermale syndrome': 1, 'YY and XY': 1, "Creutzfield-Jacob's": 2, '24,YY disomy': 1, 'XYY and XO syndromes': 1, 'Chromosome 47,XYY syndrome': 1, 'XXY and XYY syndromes': 1, '47,XYY chromosome anomaly': 1, '46,XYY': 2, 'YY': 9, "Jacob-Creutzfeld's disease": 1, 'XO-XY-XYY': 1, 'and YY disomies': 1, 'XYY abortus': 1, '47, XYY aneuploidies': 1, '47, XYY aneuploidy': 2, 'XYY syn': 1, '47,XYY condition': 1, "Jacob's": 2, 'I. XYY syndrome': 1, 'YY disomy and': 1, "Kreutsfield- Jacob's disease": 1, "Creutzfeld-Jacob's disease": 3, 'HvCJD': 1, '47,XYY and Klinefelter syndromes': 1, '[47,XYY]': 1, 'XXY-XYY MOSAIC': 1, 'XYY genetic anomaly': 1, 'XXY, and XYY anomalies': 1, 'Triple X and 47, XYY syndromes': 1, "Klinefelter's syndrome 47,XYY": 1, '49,XYY': 1, 'XYY chromosome anomaly': 1, "Creuzfeld-Jacob's disease": 1, "Jacob-Creuzfeld's disease": 1, 'Y: XYY syndrome': 1, "Creutzfelt-Jacob's disease": 1, 'XYY abnormalities': 1, '47,XYY chromosomal syndrome': 1, "Creutzfeld Jacobs's disease": 1, '47/XYY': 1, "Jacobs's disease": 1, 'XYY and Klinefelter syndrome': 1, 'XYY chromosomal conditions': 1, 'chromosome 47, XYY syndrome': 1, 'Chromosome 47, XYY syndrome': 1, 'aneuploidy 47,XYY': 1, 'Klinefelter and XYY syndrome': 1, "Creutzfeld-Jacob's Disease": 1, "Creutzfeld Jacob's disease New Variant": 1, "Creutzfeld Jacob's": 1, '69,XYY': 1, "Creutzeld-Jacob's diseases": 1, 'H-YY': 1, '8 XYY Syndrome': 1, 'Jacobs (47,XYY) syndromes': 1, "Jacobs's syndrome": 1, '45,X and XYY syndrome': 1, 'XYY trisomy': 2, 'XYY male': 2, '47, XYY trisomy': 1, '47,XYY Jacob syndrome': 1, 'XYY trisomies': 1, '47,XXY and 47,XYY syndromes': 2, 'Klinefelter and XYY syndromes': 3, 'XYY or XXXY syndromes': 1, 'Klinefelter syndrome 47 [XYY] Jacobs syndrome': 1, 'XYY symptoms': 1, 'Nonmosaic 47, XYY syndrome': 1, '47, XYY syndromes': 1, "Lortat-Jacob's disease": 2, 'PYY deficiency': 1, 'XYY hypogonadism': 1, 'XYY-associated abnormalities': 1, 'XYY CONDITION': 1, 'Male XYY syndrome': 1, 'XYY chromosome syndrome': 2, "Lortat-Jacob's mucosynechiant disease": 1, 'Klinefelter, XYY, and XXYY syndromes': 1, 'XXY, XYY, and XXYY syndromes': 1, 'Klinefelter/XXY, XYY, and XXYY syndromes': 1, 'XO, XXY and XYY syndromes': 1, "Jacob's type 2 and 3 fractures": 1, 'XXY and XYY Syndromes': 1, 'Jacobs syndrome 47, XYY syndrome': 1, 'YY disease': 1, 'PYY-deficiency': 1, '47,XYY aneuploidies': 1, 'IAC-P IAC AGT GGC GGT//GAC ACT GTT GAC CT YY': 1, '47, XYY Syndrome': 2, '47-XYY syndrome': 1, 'MM/YY': 1, "St Jacob's perinates": 1, 'XY, YY disomy': 1, 'XYY chromosomal complement': 1, '47(XYY) syndrome': 1, 'b- 47,XYY Syndrome': 1, 'XXY and XYY': 1, 'Klinefelter (XXY) and Double Y (XYY) syndrome': 1, '46, XYY': 1, 'Klinefelter syndrome 47,XYY': 1}
|
XYY syndrome
|
Disease
|
MESH:C535318
|
{'SESRL': 2, 'LSOA': 206, 'ESL': 2, 'SE': 335, 'SEs': 349, 'X trisomy': 22, 'X trisomy syndrome': 1, 'trisomy X': 164, 'Triplo-X': 2, 'SMIP': 2, 'super-infections': 147, 'XXX': 110, 'triple-X syndrome': 31, 'CSL': 11, 'S-T': 1, 'super infection': 35, 'hepatic SE': 1, 'SEC': 8, 'super': 68, 'SSO': 20, 'SR': 71, 'super-infection': 328, 'SMP': 9, 'SUPER-SOUND': 1, '47,XXX': 216, 'SA': 1, 'Trisomy X': 95, 'MO': 1, 'triple X': 34, '47,XXX syndrome-A': 1, '47,XXX syndrome': 20, '45,X/47,XXX': 1, '47,XXX[5': 1, 'Atmosphare super gut': 1, '69,XXX': 14, 'Triple X Syndrome': 12, 'Triple X.': 1, 'Triple X syndrome': 99, '47, XXX': 84, 'Triple X': 30, 'Klinefelter and Triple X syndromes': 1, 'Super-infection': 27, 'Super-female syndrome': 1, 'SUPER': 96, 'SDM*add': 1, 'A SSC': 1, 'EDSR': 2, 'SITAR': 7, 'systemic super-infection': 1, 'CMV super-infection': 1, 'Triple-X syndrome': 11, 'Trisomy X syndrome': 20, 'SEG': 1, 'MSOA': 37, 'HIV super infection': 5, 'MSOAs': 12, 'srCryoCLEM': 1, 'PERFORMING SUPER-RESOLUTION': 1, 'SB-RC': 1, 'Super-paramagnetic': 1, 'super typhoon disaster': 1, 'WIDEFIELD FUNCTIONAL SUPER-RESOLUTION TECHNIQUES': 1, 'SUPER-RESOLUTION IMAGING OF CHROMATIN': 1, 'SUPER-RESOLUTION FLUORESCENCE': 1, 'PATTERNED SUPER-RESOLUTION TECHNIQUES': 1, 'super-male syndrome': 1, 'X chromosome trisomy': 5, 'bacterial super': 1, 'SSEs': 17, 'SHD': 7, 'SNC': 2, 'SRM': 25, '47 XXX': 6, 'gastric triple': 1, 'SDM': 5, 'influenza virus super-infections': 1, 'Th17 SE': 1, 'inflammatory SEs': 3, 'triple X syndrome': 124, 'XXX syndrome': 23, 'acquired super-infection': 1, 'LSOAs': 43, 'SG': 4, 'Triplo-': 1, 'thyroid B super anomaly': 1, 'XL9-SE': 1, 'Super-stereotypy II': 1, 'pulmonary super-infections': 3, 'pulmonary super-infection': 4, 'SISR': 6, 'ssBACE': 4, 'SOS': 5, 'SRC': 3, 'nSS': 1, 'super-long near-infrared persistent': 1, 'XXX trisomies': 1, 'SUPER-HEALTH': 5, 'CI super-eruption': 1, 'XXX or XYY trisomies': 2, 'super typhoon': 4, 'SPS': 1, 'sLAD': 1, 'SCLC-A': 1, 'super-': 6, 'SHF': 3, 'SUPER #5': 1, 'SUPER #3': 1, '47(XXX) syndrome': 1, '47 (XXX) syndrome': 1, 'SUPER H2': 1, 'SUPER-1': 5, 'SCEM': 3, 'SM': 3, 'SDSS': 2, 'FAWSL': 2, 'Oncogenic SEs': 1, 'PBSR': 2, 'NASICON': 6, '49,XXX': 1, 'Turner syndrome with Triple X': 1, 'tuberculous super-infection': 1, 'SPFT': 1, 'super-flu': 3, 'CSR-GAN': 1, 'SCC': 4, 'triple X.': 3, 'SAVE': 2, 'triple X syndromes': 4, 'SUPR': 7, 'Triplo-X syndrome': 1, 'DN SEs': 1, 'XYY and XXX trisomies': 1, 'hunter virus super-infection': 1, 'Trisomy X.': 5, 'ssAID': 1, 'AlissAID': 1, 'trisomy X.': 35, 'SAP': 9, 'super nevus syndrome': 1, 'SRUS': 1, 'SR-DLR': 1, 'SL': 21, 'SRSE': 4, 'super-RSE': 1, 'TXS': 7, 'Triple X or Triple X syndrome': 1, '47, XXX and 47, XYY syndromes': 1, 'super infections': 8, 'super-fast myosin': 1, 'SP': 1, 'super-refractory': 1, 'VSR': 1, 'XXX-2019-11': 1, 'ENTROPY-BASED SUPER-RESOLUTION IMAGING': 1, 'SRRF': 2, 'ESI': 1, 'SUPER-RESOLUTION RADIAL FLUCTUATION': 1, 'MSSR': 1, 'MEAN-SHIFT SUPER-RESOLUTION': 1, 'nSR': 1, 'SS': 13, 'SR-UMI': 1, 'SON': 1, 'SOFI': 7, 'skin super infection': 1, 'CRC-SE': 2, 'SRs': 11, 'SLL': 1, 'skin super-infections': 2, '47, XXX syndrome.6': 1, 'trisomy X syndrome': 16, '47, XXX syndrome': 6, 'triple X.5': 1, 'SR-GSDIM': 1, 'SY': 10, 'super-vision': 3, 'Triple X syndromen': 1, 'Trisomy-X': 3, 'trisomy-X.': 1, 'trisomy-X': 3, 'SD': 4, 'super cyclone Aila': 1, 'triplo-X': 4, 'SCD': 1, 'SUPER-AGED': 1, 'SSE': 6, 'SMO': 8, 'MFS': 6, 'Super-Helper Syndrome': 1, 'DARC- XXX': 1, 'SCLIM': 4, 'SGE-REIC': 1, 'ST': 8, '2014_XXX': 1, 'super-infection with Hepatitis A Virus': 1, 'super-shedder infections': 1, 'X-trisomy': 6, 'KSS': 2, 'SEPB': 1, 'SDOM': 2, 'MSR': 1, 'super refractory': 2, 'VSEs': 1, 'ENZYMATIC ANTIOXIDANTS SUPER OXIDE DISMUTASE': 1, 'SUPER-': 9, 'SUPER-UC': 3, 'LSOA.G': 1, 'MSOA.G': 1, 'trisomy 11, 19 and X.': 1, 'SB': 3, 'SRX': 13, 'triple-X': 8, 'SSS': 2, 'SC': 4, 'HOTS': 1, 'hepatitis A super-infection': 1, 'HAV super-infection': 2, 'periprosthetic super-infection': 1, 'SCP': 4, 'Citrobacter rodentium super-infection': 1, 'super-morbid obesity': 2, 'SRFM': 4, 'Super infections': 1, 'SUPER-ENHANCER': 3, 'THERAPEUTIC VALUE OF TARGETING SUPER-ENHANCERS': 1, 'SILICIC ACID-SUPER-CEL': 1, 'SE dysfunction': 1, 'GSR': 4, 'trisomies of chromosomes X': 1, 'SPM': 3, 'SU': 2, 'TXS syndrome': 2, 'Trisomy X Syndrome': 1, 'leukemia SEs': 1, 'Natal Super': 1, 'SRI': 2, 'SEMet': 1, 'orbital super-infection': 2, 'SLD': 2, 'cardiac SE': 1, 'cardiac SEs': 4, 'SCDS': 1, 'SCDSs': 1, 'SARC': 3, 'corneal super-infections': 1, 'Psychotic Illnesses":SUPER': 2, 'LGSR': 1, 'X-linked female-limited': 2, 'X linked, female-limited epilepsy': 1, 'XXX syndromes': 1, 'purple-pericarp super-sweetcorn': 1, 'super-sweetcorn': 1, '-pericarp super-sweetcorn': 1, 'struvite RSS': 1, 'sIFN-I': 1, 'SREB': 1, 'super gonorrhoea': 1, 'PSRM': 1, 'SBM': 2, 'Super-infections': 5, '47,XXX and 47,XYY': 2, 'SUPER- A*STEROID': 1, 'SUPER-A*STEROID': 1, 'triple-X syndromes': 3, 'SUPER FAMILY PROTEIN': 1, 'SUPER FAMILY MEMBER': 1, 'flexor digitorum super-ficialis': 1, 'Triple X syndromeDuplication': 1, 'MES SE': 1, 'X-linked Female Lethal': 1, 'SSI': 1, 'STED SRFM': 1, 'triple X and XYY syndromes': 3, 'MCSR': 1, 'SHS': 3, 'SAMO': 1, 'SUPER TWIG': 1, 'SUPER-RESOLUTION IMAGING TECHNIQUES': 1, 'aneuploid XXX-syndrome': 1, 'SPIOs': 3, 'super imposed infections': 1, 'STML': 3, 'SE abnormalities': 1, 'SE abnormality': 1, 'super-female syndrome': 1, '47, triple X syndrome': 1, 'TCONS_XXX': 1, '47,XXX chromosomal complement': 1, 'Triple X (XXX) syndrome': 2, 'Triple X (XXX) Syndrome': 1, 'SSIOAC': 1, 'SUPER PLADO': 1, 'SUPER HEMO': 1, 'SUPER-RESOLUTION': 6, 'asthma SR': 1, 'SUPER-STABLE MINERALIZATION': 1, 'influenza super-infection': 6, 'X and 12 trisomies': 1, 'SAH': 1, 'TSC': 1, 'SSL': 3, 'SLC': 2, 'RSS': 2, 'SiGMoiD': 1, 'SLED': 2, 'MDSR': 1, 'ARDN': 1, 'SCC formation': 1, 'SCCs': 2, 'SLPPs': 1, 'GSL': 1, 'SUPER-OVULATED MICE': 1, 'XXX, 45,X': 1, 'trisomies X and': 1, 'XXX_AAD': 1, 'SR-SIM': 1, '-DIMENSIONAL SUPER-RESOLUTION STRUCTURED ILLUMINATION MICROSCOPY': 1, 'SCNT': 1, 'MEANS-STED': 1, 'trisomy of chromosome X': 1, 'X chromosomal trisomy': 1, 'SAF': 1, 'SCH': 1, 'OPTIMISING SRRF': 1, 'XXXXY, XYY and XXX syndromes': 1, 'SAQP': 1, 'S-MB': 1, 'Classic triple X syndrome': 1, 'bacterial super-': 1, 'MRSA super-infection': 4, 'SUPER GUM': 1, 'influenza (super)infection': 1, 'Klinefelter, Turner, triple-X, and XYY syndromes': 1, 'Triple-X': 2, 'celiac super': 1, "Klinefelter's and triple-X syndromes": 1, '-Super': 1, 'Polysomy X or Triple X': 1, 'OMIP-XXX': 1, 'SRHiC': 1, 'E/SE': 1, 'LD 47,XXX': 1, 'SUPER TRACTOR PROTOTYPE': 1, 'triplo and tetra X': 1, 'SHLs': 1, 'WSL': 2, 'triple X, XYY,': 1, 'triple X, XYY': 2, 'sCSD': 2, 'SUPER-FOCUS': 5, 'super-acid-resistant Crenarchaeota': 2, 'EMD-XXX': 1, 'SUS': 1, 'TX': 1, 'XXX aneuploidy': 1, 'sBLUP': 1, 'Triple-X Syndrome': 1, 'Triple XXX syndrome': 1, 'SF': 4, 'Super-Fontan': 1, 'SLs': 1, 'SUPER-ENHANCERS': 5, 'X/Y trisomies': 1, 'X/Y trisomy': 1, '47,XXX and 47,XYY syndromes': 3, 'DRS': 1, 'Super-refractory status': 1, 'XXX and XYY trisomies': 1, 'super-super-obesity': 1, 'SO': 1, 'EPN-SE': 1, 'ependymoma SE': 1, 'Down, Klinefelter, Turner, triple X, and XYY syndromes': 2, 'MISS': 1, 'COMPEITS': 2, 'MMSR': 1, 'pyogenic super-infection': 1, 'Super-refractory': 1, 'SUPER-CONSERVED': 1, 'HCC-SE': 1, 'Trisomy X 45,X': 1, 'super-pubic pain': 1, 'triple X chromosome syndrome': 1, 'SUPER NUMERIC': 1, 'CHIDO': 1, 'Super-Infection': 12, 'super acute spread of virus': 1, 'inherited super-anemic': 1, '47,XXX aneuploidy': 1, 'CRF-11 super-infection': 1, 'B super-infection': 1, 'SWC': 1, 'SUPER-RESOLUTION IMAGING': 1, 'liver SEs': 1, 'super complex I + III2': 1, 'SUPER-NUMERARY': 1, 'super-sleep syndrome': 1, 'WITH SUPER-FILTROL': 1, 'Swyer or XXX syndromes': 1, 'Turner (XO) and XXX syndromes': 1, 'Trisomy X 47, XXX': 1, 'trisomy/polysomy X': 1, 'SASEs': 1, 'ASG': 1, 'HoTS': 1, 'triple X and XYY syndrome': 1, 'SUPER RESOLUTION': 1, 'X-chromosome trisomies': 1, 'HS': 1, 'NK SEs': 1, 'super-infected': 2, '47,XXX tumor': 1, 'IGH SE': 1, 'XXX aneuploidies': 1, 'AS': 1, 'triplo-4': 1, '45,X 47,XXX 47,XXY 47,XYY': 1, 'SUPER-MIMI': 2, 'DLSRM': 1, 'Klinefelter, 47,XXX and 47,XYY syndrome': 1, 'Triple X and Double Y syndrome': 1, 'SUPER SIGNAL': 1, 'SMLM': 4, 'SGAR': 1, 'SUPER-UC-Cx': 1, 'triple-X-syndrome': 1, 'double trisomy 48, XXX, +18': 1, '47, XXX, +21 anomalies': 1, 'Aperts 69 XXX': 1, 'cutaneous super-infection': 2, 'XXX Syndrome': 1, 'SEBSR': 1, 'SPC': 3, 'super-elongation disease': 3, 'monosomy X, XXX, XXY (Klinefelter), XYY (Jacob) syndromes': 1, 'SUPER LIZER PX Type 2': 1, 'S-E.': 1, 'triple- and poly-X-syndrome': 1, 'Klinefelter-, triple- and poly-X-syndromes': 1, '- or super-infection': 1, 'SMCD': 1, 'TRISOMY X': 1, 'SUPER-BENEFICIAL BACTERIA': 1, 'super-luminous supernovae': 1, 'HS-SR': 1, 'SDIs': 1, 'necrotic cutaneous super infections': 1, 'SS-PVE': 1, 'IS': 1, 'trisomy for chromosome X': 1, 'SLVT': 1, 'TRISOMY OF THE X-CHROMOSOME': 1, 'SO-CALLED TRIPLE X-SYNDROME': 1, 'SUPER FEMALE SYNDROME': 1, 'RGSSH': 1, 'X Trisomy': 1, 'XXX, XXXXX and XYY syndromes': 1, '47 XXX syndrome': 1, 'SJ-DTMOS': 1, 'Trisomy 48,XXX': 1, '48,XXX,+18': 1, 'double trisomy 48,XXX,+18': 2, '47(XXX)': 1, 'SGB': 1, 'Triplo-X.': 1, 'triplo': 2, 'Triplo': 2, 'SUPER-RESOLUTION STIMULATED RAMA SCATTERING MICROSCOPY WITH A-POD': 1, 'triplo- X.': 1, 'SOH': 1, '-SR': 1, 'HIV super-infected': 1, 'aneuploidies of 47, XXX': 1, 'Triple-X syndrome 1': 1, 'trisomy 3 and X': 1, 'pG-SUPER': 1, 'super-acute abdominal syndrome': 1, 'super-Tourette syndrome': 1, 'lung super-infections': 1, 'super elongation disease': 1, 'MSF': 1, 'mitochondrial super-oxide': 3, 'Super Typhoon': 2, 'triplo-X syndrome': 1, 'X-linked CGG-triple repeat disorder': 1, 'NSB-G.': 1, 'SUPER-2': 2, 'LSD': 1, 'Ventilated super': 1, 'SUPER-SPREADING EVENT IN': 1, 'Trisomies 3 and X': 1, 'Trisomies 3, 5 and X': 1, 'trisomies 3, 5 and X': 1, 'AASEs': 1, 'ISF': 1, 'SASSs': 1, 'BSE': 2, 'triple X, Y polysomy': 1, 'SHR': 1, 'INSIGHTS FROM SUPER-RESOLUTION IMAGING': 1, 'Klinefelter or triple-X syndromes': 1, 'SFM': 2, 'super-refractory SE': 2, 'AVAILABLE SUPER-RESOLUTION MICROSCOPY TECHNIQUES': 1, 'xxx diseases': 1, 'trisomy of X chromosome': 2, 'SUPER CARE': 1, 'SDPG': 3, 'SUPER-ARTICULAR': 1, 'SUPER ENHANCER-ASSOCIATED COMPLEXES': 1, 'super mealworm': 1, 'STF': 5, 'DHB': 1, 'SHP': 1, 'super-enhancer-associated diseases': 1, 'HyD': 1, '47/XXX': 1, 'XXX 2019': 1, 'SLIC': 1, 'Turner (45,X) and 47,XXX syndrome': 1, 'triple-X anomaly': 1, '47, XXX aneuploidy': 1, 'female polysomy X': 1, 'SVL': 1, 'Triple X syn': 1, 'Mexican super dwarf': 1, 'SPSE': 1, 'PSD-': 1, 'NSD': 1, 'PSD': 1, 'chronic super-infection': 1, 'SJ-MOSEFT': 1, 'XZH': 1, 'CS-PD': 1, 'GSC SE': 1, 'SAs': 1, 'Super': 2, 'Trisomy X (47,XXX) syndrome': 1, 'XXX chromosome syndrome': 1, "5'SE": 1, 'SUPER SISTERS': 1, 'SUPER-THERAPISTS': 1, 'SRLS': 2, 'STC': 3, 'SUPER-SAMPLING': 1, 'SHM': 3, 'trisomy of X': 1, 'MaSuRCA': 1, 'Hepatitis A super infection': 1, '47,XXX condition': 1, 'sPL': 1, '47, XXX chromosome abnormalities': 1, 'triple X condition': 1, 'Super-eruption': 1, 'SCCCs': 2, 'Enterobacter asburiae super-infection': 1, 'HSI SR': 1, 'SUPER-M': 1, 'Super-Infections': 3, 'SIE': 2, 'super complex I + III': 1, 'trisomy - trisomy X': 2, 'SASS': 1, 'AESB': 1, 'ocular super glue injuries': 1, 'SUPER ELONGATION COMPLEX': 1, 'Triple X-': 1, 'SAg': 1, 'cytotoxic super-infection': 1, 'RANK ORDERING OF SUPER- ENHANCERS': 1, '69 XXX': 1, 'trisomy of the X': 2, '[47,XXX': 1, 'SUPER LEARNING': 1, 'stTDI': 1, 'STS': 2, 'SLE': 1, 'SGE': 1, 'cutaneous super-infections': 1, 'Tiller Gold or Whip Super poisoning': 1, 'triplo-10-2': 1, 'triplo-10': 1, 'OSC': 1, "Mehaffey's SSO": 1, 'OF SUPER-RESOLUTION': 1, 'SUPER-RESOLUTION MICROSCOPY': 1, 'TSDM': 1, '46, XXX': 2, 'SAR': 1, 'chromosome X trisomy': 1, 'Trisomy in X': 1, 'foamy virus super-infection': 1, 'Klinefelter, Turner or Triple X syndromes': 1, 'Trisomy 47,XXX': 1, 'S-ENHs': 1, '47,XXX Syndrome': 1, 'super-dwarf wheat': 1, '-XXX': 2, 'ZSSR': 1, "Klinefelter's (XXY) and Triple X (XXX) syndromes": 1, 'IS FUNCTIONAL SUPER-RESOLUTION': 1, 'SOLs': 1, 'CASES OF SUPER-RADICAL MASTECTOMY': 1, 'infertility XXX syndrome': 1, 'HBS-DDS': 1, 'CRSR': 1, 'XXX 21': 1, 'STW': 1, 'DSH': 1, 'XXX disorders': 1, 'XXX disease': 1, 'XXX infection': 1, 'XXX infected': 1, 'XXX deficiency': 1, 'SSPF': 1, 'SSC': 1, 'molar super-eruption': 2, 'influenza super': 2, 'influenza virus super-infection': 1, 'super-enhancer': 1, 'LISICON': 1, 'Parkinson XXX': 1, 'SUPER AMOLED': 1, 'M54.XXX - Dorsalgia': 1, 'Turner and XXX syndrome': 1, 'Trisomy X phenotype': 1, 'triple X or XYY syndromes': 1, 'SPI': 2, 'SPIs': 1, 'SND': 1, 'term Ebola aftereffects': 1, 'post Ebola': 1, 'Ebola': 1, 'xxx': 2, 'Klinefelter or triple X syndrome': 1, 'Klinefelter and triple X syndrome': 1, 'SJBs': 1, 'C-SHBSL': 1, 'SHBSL': 1, 'HIV super-infection': 2, '45,X, 47,XXX, 47,XXY, XYY syndrome': 1, 'triple X, XXY, and XYY syndrome': 1, 'SRULM': 1, 'MISL': 1, 'TW-Sh-PTFE-TENG': 1, 'triplo-X syndromes': 1, 'X trisomies': 3, 'NS': 1, 'Super-K': 2, 'SUPERs': 1, 'XXX 21-trisomy': 1, 'super-foul': 1, 'SMA': 4, 'Syp-SEP': 1, 'AFR': 1, ', XXX': 4, 'tetra X female syndrome': 1, 'bacteriele (super)infectie.26': 1, 'HIGH-THROUGHPUT SUPER-RESOLUTION IMAGING': 1, 'BOTTLENECK OF HIGH-THROUGHPUT SUPER': 1, 'SUs': 1, 'SYM': 2, 'lncRNA-SE': 1, 'Turner, triple X': 1, 'SOC': 2, 'CORRELATIVE SUPER-RESOLUTION FLUORESCENCE MICROSCOPY': 1, 'XYY, XXX': 1, 'Triple X syndrome trisomy X': 1, 'Super digits': 1, 'super digit type IC2': 1, "Wood's super digit type IC2": 1, 'super digits': 1, 'trisomy 46,X': 1, 'XYY, XXX, and XXYY syndromes': 1, '(46,XX/69,XXX) syndrome': 1, 'SUPER BASMATI': 1, 'XO, XXX, XXY': 1, 'Triple-X-syndrome': 1, 'SHCs': 1, 'SH': 1, 'SSSM': 1, 'SIACI': 1, 'bacteria super-infections': 1, 'super-leukemia': 1, 'SRCNN': 1, 'triple X-syndrome': 2, '48,XXX': 2, 'SUPER-RESOLUTION FROM PSEUDO-K-SPACE': 1, 'SNORFS': 1, 'SUP': 1, 'Triple-X (47,XXX) syndrome': 1, 'SPHHs': 1, 'Trisomy for chromosome X': 1, 'OLID-SDOM': 1, 'SUPeR': 1, "Klinefelter's (XXY) and XXX syndromes": 1, 'sptPALM': 1, 'WS': 1, 'ERSEs': 1, 'Super female syndrome': 1, 'EDSU': 1, 'SQ': 1, 'SRLM': 1, 'S. pneumoniae super-infection': 1, 'HNS': 1, 'ISR': 2, 'DEEP MR IMAGE SUPER': 1, 'MR IMAGE SUPER-RESOLUTION': 1, 'OSHMD': 2, 'SEMD': 1, 'SRCT': 1, 'skin super-infection': 1, 'LVIFM]XXX[LVIFM]XX[LVIFM]X': 1, 'LVIFM]XXX[LVIFM]XXX[LVIFM]X': 1, 'LVIFM]X[LVIFM]XXX[LVIFM]XX': 1, 'LVIFM]X[LVIFM]XXX[LVIFM]XXX': 1, 'LVIFM]XX[LVIFM]XXX[LVIFM]X': 1, 'LVIFM]X[LVIFM]XX[LVIFM]XXX': 1, 'fetal triple X.': 1, 'SPD': 1, 'Triple X, XYY': 1, 'super-infection with hepatitis A virus': 1, 'LOSO': 1, 'pneumococcus super-infection': 1, 'double trisomy 48,XXX': 1, 'hepatitis super-infections': 1, 'polysomy 47,XXX': 1, 'super-cyclone': 4, 'triplos estereis': 1, 'Bacterial (super)infectionb': 1, 'super-infection exclusion': 1, 'MDCSC': 1, 'super dwarf wheat': 2, 'SSP': 1, 'SMB': 1, 'skin super infections': 1, 'monosomy X, triple X, XXY, and XYY syndromes': 1, 'HDV super-infection': 1, 'Klinefelter and triple X syndromes': 1, 'LP-SR': 1, 'pSL': 1, 'KSN': 1, 'Trisomy of chromosome X': 1, 'Super-morbid obesity': 1, 'Super-morbid obese': 1, 'olfactory super-infection': 1, 'SUPER RESOLUTION FLUORESCENCE': 1, 'IGSF1 deficiency syndrome': 1, 'Immunoglobulin super family member 1 (IGSF1) deficiency syndrome': 1, 'IGSF1 deficiency': 1, 'SENT': 1, 'RTSES': 1, 'SKD': 1, 'super-immunodeficient': 1, 'ISAM': 1, 'SHC': 2, 'Forty-seven, XXX syndrome': 1, 'TCWSM': 1, 'brain super-infection': 1, 'triple X (XXX) syndrome': 1, 'triplo X syndrome': 1, '47, XXX anomaly': 1, 'Super flu': 1, 'RECONSTRUCTION OF SUPER-RESOLUTION': 1, 'SK': 1, 'ssAVS': 1, 'mitochondrial super-complex': 1, 'bronchial super-infection': 1, 'Trisomy X or triple X syndrome': 1, 'SRH': 1, 'SS4': 1, 'SS3': 1, 'SSs': 1, 'XX-XXX mosaicis': 1, 'Trisomy X Triple X syndrome': 2, 'CSD': 1, 'GSR-': 1, 'STFM': 2, 'SARA': 1, 'Super - infection': 1, 'super - infection': 1, 'super bug': 1, 'SUPER -2': 1, 'pneumonia super-infection': 1, 'APRESS': 1, 'SEP-DOR': 1, '48, XXX': 2, 'IE-SE': 1, 'super-eruptions': 1, 'SE complex': 1, 'spacer super-infection': 1, '-SuPer': 1, 'SUPER PORCELAIN': 1, 'SMIS': 3, 'SCL': 1, 'MSSS': 1, 'SKELETAL SUPER SCAN': 1, 'SUPER PORE EX': 1, 'PASS-ON': 1, 'SUPER INTERNET': 1, 'SHPFs': 1, 'SMA aneurysm': 1, 'nESRGAN': 1, 'MSP': 1, 'Super-infections with influenza viruses': 1, 'USPIO': 1, 'RiskSLIM': 1, 'Diplo Y, Klinefelter and Triple X syndromes': 1, 'microbial super-infection': 1, 'SUPER-ACIDs': 1, 'HCV super-infection': 1, 'Klinefelter, XXX': 1, 'trisomy 47, XXX': 1, 'MODEL-CHECKING SUPER-OPERATOR-VALUED': 1, 'class II SE': 1, '-SJBT': 1, 'SJBT': 1, 'immunoglobulin super family member 1 (IGSF1) deficiency': 1, 'ostium lesion of the SMA': 1, 'SEE': 2, 'Klinefelter, and Triple X syndrome': 1, 'trisomy 18/21/XXX syndrome': 1, 'SCC.Blockade': 1, 'S-R': 1, 'SHUA': 1, 'TR-super': 1, 'Bacterial super-': 1, 'trisomy X syndromes': 2, 'SRS': 1, 'super typhoons': 1, 'STY': 1, 'SUPER NUMERIC NODULES': 1, 'SUPER-DONORS PHENOMENA': 1, 'Triple X 21': 1, 'carcinogenic SEs': 1, 'super-infected with': 1, 'UVB super-hypersensitivity': 1, 'Super-refractory SE': 1, 'gastrointestinal, and skin super-infections': 1, 'XXY or XXX syndromes': 1, 'Trisomy X 1': 1, 'SE-TG': 1, 'STA': 1, 'Turner and triple-X syndrome': 1, 'trisomy X 47, XXX': 1, 'LSBM': 1, "Turner's and triple-X syndrome": 1, 'super-gonorrhoea': 1, 'SUPER-PROTEINS': 1, '47, XXX and 47, XYY syndrome': 1, 'SUPER_ACT_MATH': 1, 'SCT': 1, 'S. pneumoniae super- infection': 1, 'SAE': 1, 'AMDE-SR': 1, 'MADE-SR': 1, 'SUSHI': 1, 'hepatitis A virus (HAV) super-infection': 1, 'endothelial SE': 1, 'cardiac tissue SE': 1, 'super basmati': 1, 'SJ': 1, '47, XXX-syndrome': 1, 'XXX gonosomic anomaly': 1, 'SUPER MASSCOLLOIDER': 1, 'XXX infertility syndrome': 1, 'influenza A virus super-infection': 1, 'alpine super-': 1, '18 and XXX': 1, 'ACNS': 1, 'TRIPLE-X': 1, 'colorectal super-': 1, '48,XXX, +21 trisomy': 1, 'Super moulds': 1, 'super-eruption': 1, 'ROLES OF SUPER-': 1, 'SUPER-ENHANCER INHIBITION': 1, 'NSM': 1, 'Triple X and XYY aneuploidies': 1, '69, XXX': 4, 'SOL': 2, 'v-SEP': 1, 'GAS/L': 1, 'triplo X': 1, 'candidal super infection': 1, 'SMSS': 1, 'SUPER MARIO': 1, 'VDSR': 1, 'NRM-SR': 1, 'SSA': 1, 'Super infection': 2, 'SMA lesions': 1, 'SMV': 1, 'Medulloblastoma SEs': 1, 'Tuberculous super-infection': 1, 'SAIDs': 1, 'staphylococcus super infection': 1, 'SUPER ANANAS': 1, 'Super-AIDS': 1, 'Trisomy/Triple X': 1, 'MFSR': 1, 'ST-': 1, 'SOV': 1, 'Turner sydnrome Trisomy of chromosome X': 1, 'NS SS': 1, 'Super-spreader-Phanotyp': 1, '46,XXX': 1, 'Klinefelter- or triple-X syndrome': 1, 'SQUID': 1, 'STCM': 1, 'HMCA': 1, 'SUPER-RESPONDER': 1, 'triple X Syndrome': 1, 'SQMs': 1, 'Super-bugs': 1}
|
SEs
|
Disease
|
MESH:C535319
|
{'penta': 6, 'pentasomy X/tetrasomy X syndrome': 1, 'PARMS': 7, 'pentasomy 15': 1, 'XXXXX': 7, 'PEF': 9, 'PPS': 1, 'PAT': 1, 'penta-acyltrehaloses': 1, 'C-penta': 1, 'chromosome X pentasomy': 2, 'Pentas lanceolata': 2, 'ATEG_XXXXX.1': 1, 'PENTA wastage': 1, 'Penta-Helix': 1, 'Penta-helix': 1, 'pentasomy X.5': 1, 'PG': 3, 'pentasomy 8': 7, 'pentasomy': 16, 'Penta-negative tumours': 1, '49,XXXXX': 8, 'pentasomy X': 17, '49, XXXXX': 4, 'pentasomy x': 2, 'Pentasomy X': 12, 'penta-X syndrome': 5, 'pentasomy X.': 7, 'Penta X': 1, 'Tetra-penta-deca-hexagonal-graphene': 1, 'tetra-penta-deca-hexagonal-graphene': 1, 'PENTA': 8, 'PENTA-ETHYL': 1, 'ISOLATION OF 1,2,3,5,6-PENTA-O-ACETYL-ALPHA-D-GALACTOFURANOSE': 1, 'penta stomiosis': 1, 'pentasomy 49': 1, 'Pentasomy': 2, 'penta-refractory disease': 1, 'Y pentasomy': 1, 'pentasomy conditions': 2, 'pentasomy disorders': 1, 'BCC) and penta-negative carcinomas': 1, 'pentasomies': 2, '49,XXXXX syndrome': 4, 'tetra and pentasomy': 1, 'BMIPP abnormalities': 2, 'BMIPP abnormality': 1, 'PNRs': 1, 'DIETHYLENE TRIAMINE PENTA-ACETIC': 1, 'USE OF DIETHYLENE TRIAMINE PENTA': 1, 'Penta': 3, '49,XXXXX syndromes': 1, 'Pentasomie X.': 1, 'X pentasomy': 3, 'pentasomy of chromosome 8': 1, 'sexual pentasomy': 1, 'pentasomy 21': 5, ', XXXX-49, XXXXX': 1, 'pentasomy X syndrome': 2, 'PHF': 1, 'penta-Hb': 1, 'PeCDF': 1, 'Penta-Pigment Agnathan': 1, 'pentasomy 13': 1, 'LGE': 1, 'penta 3': 1, '49, XXXXX syndrome': 4, 'tetra/pentasomy SCA': 1, 'trisomy and tetra/pentasomy conditions': 1, 'tetra/pentasomy conditions': 1, 'pentasomy of chromosome': 1, 'penta X syndrome 1, 2, 3, 5, 6': 1, 'penta X syndrome 5': 1, 'Penta X syndrome': 2, 'penta X syndrome': 3, 'DETAPAC': 1, 'PENTA 5': 1, 'hepatotoxic penta-peptide': 1, 'PENTA-N-SULPHOMETHYL-POLYMYXIN B': 1, 'X-pentasomy': 1, 'X (49, XXXXX) pentasomy': 1, 'syndrome 49, XXXXX': 1, 'Penta-X syndrome': 1, 'PNFs': 1, 'ML PENTA': 1, 'penta lagta': 1, 'Pentasomy 21': 2, 'penta X (49,XXXXX) syndrome': 1, 'pentasomy X syndromes': 1, 'RRMM': 1, 'Penta-Cardiac Anomalies': 1, 'penta-cardiac anomalies': 1, 'pentasomy 1': 1, 'gonosomal pentasomy 49': 1, '(penta negative) tumors': 1, 'penta X condition': 1, 'Pentasomy X syndrome': 1, 'PV': 1, ', XXXXX': 1, 'VV': 1}
|
pentasomy X
|
Disease
|
MESH:C535321
|
{'PAN-A/1': 1, "CONSERVATION OF 5'-NUCLEOTIDASE": 1, "ecto-5'-nucleotidase deficiency": 2, "5'-nucleotidase deficiency": 5, "deficiency of 5'-nucleotidase": 2, "SEPARATION OF 5'-NUCLEOTIDASE FROM INTERFERING ENZYMES": 1, "Purine ecto-5'-nucleotidase deficiency": 1, "hypoxia-5'-Nucleotidase 1A": 1, 'NT': 3, "ecto-5'nucleotidase deficiency": 1, 'cN-1A': 1, "pyrimidine 5'nucleotidase": 1, 'pyrimidine 5 nucleotidase (': 1, 'PAN': 4, "Inherited pyrimidine 5'-nucleotidase type I (P5'N-1) deficiency": 1, 'ADENOSINE-5-NUCLEOTIDASE': 1, '-NUCLEOTIDASE': 3, 'P5N-I': 2, "pyrimidine 5' nucleotidase I": 1, "5'NT deficiency": 2, 'nucleotidase deficiency': 1, '5-NUCLEOTIDASE': 3, "5'-nucleotidase (5'-N) deficiency": 1, "deficiency of lymphocyte 5'-N": 1, 'eN': 3, 'eN.': 1, "pyrimidine 5'-nucleotidase": 3, "Ecto 5'-nucleotidase deficiency": 1, "P5'N": 1, "AUTOANTIBODIES TO CYTOSOLIC 5'-NUCLEOTIDASE": 1, "Ecto-5'-nucleotidase deficiency": 1, 'SERUM 5-NUCLEOTIDASE': 2, "Deficiency of 5'nucleotidase": 1, 'BACTERIAL NUCLEOTIDASES': 1, 'CAN': 1, 'Acquired nucleotidase deficiency': 1, 'eN deficiency': 1, "ectosolic 5'-nucleotidase (eN) deficiency": 1, "CYTOCHEMICAL LOCALIZATION OF 5'-NUCLEOTIDASE": 1, 'CANs': 2, "5'-NUC": 1, 'cN-1A seropositive': 1, "Lymphocyte 5'-nucleotidase deficiency": 2, "purine 5'-nucleotidase deficiency": 1, 'nucleotidase deficiencies': 1, 'cN-II AL': 1, "pyrmidine 5'-nucleotidase deficiency": 1, "SERUM 5'-NUCLEOTIDASE": 1, 'NDA': 1, "Inherited pyrimidine 5'-nucleotidase type-1 (P5'N-1) deficiency": 1, "Lymphocyte ecto-5'-nucleotidase deficiency": 1, "5' nucleotidase deficiency": 1, "pyrimidine 5'-nucleotidase (P5N, EC 3.1.3.5) deficiency": 1, 'P5N': 1, 'of P5N': 1, 's-NTDs': 1}
|
5'-nucleotidase deficiency
|
Disease
|
MESH:C535322
|
{'5-oxoprolinase deficiency': 31, '5-Oxoprolinase deficiency': 7, 'defect in 5-oxoprolinase': 1, 'Deficiency of 5-oxoprolinase': 2, 'D. 5-Oxoprolinase deficiency': 1, 'Inherited 5-oxoprolinase (OPLAH) deficiency': 1, 'deficiency of either 5-oxoprolinase': 1, '5-oxoprolinase deficiencies': 1, 'oxoprolinase deficiency': 1, '5-OPase deficiency': 1, 'OPLAHD': 1}
|
5-oxoprolinase deficiency
|
Disease
|
MESH:C535323
|
{'5q- abnormality': 5, 'del(5q) syndrome': 18, '5q- syndrome': 311, '5q- Syndrome': 11, 'del (5q': 20, 'del(5q) chromosomal abnormalities': 5, 'del(5q)': 130, '5q-syndrome': 156, 'del(5q': 175, '5q': 155, 'Del 5q': 1, 'del 5q': 10, 'MAR': 248, 'the 5q-syndrome': 1, '5Q-T': 16, 'HN': 2, '5q-': 14, 'NUCLEATING': 1, 'NRBC': 3, '5q- anomaly': 8, 'del(5q) chromosomal abnormality': 8, '-5q': 1, '(5q': 22, '5q abnormalities': 8, 'del(5q) abnormality': 6, '5q syndrome': 54, '5q deletion syndrome': 12, '5q minus syndrome': 7, 'type B of 5q- syndrome': 1, '5q-anomaly': 3, '/MAR': 5, 'del (5q) abnormalities': 2, 'del (5q) abnormality': 2, 'nucleate': 5, 'Chromosome 5q deletion syndrome': 3, 'del (5q) chromosome abnormality': 1, 'deletion 5q and 7 abnormalities': 1, 'deletion 5q': 2, 'NE': 1, 'non-5q': 1, '5q-SMA': 5, 'NUCLEATED': 9, 'MAR Syndrome': 1, 'del(5q-)': 1, '5Q': 4, '5Q syndrome': 5, 'Del(5q) syndrome': 1, 'Del-5q syndrome': 1, '5q)': 4, '5q-Syndrome': 8, 'del (5q)': 11, '5q- chromosome anomaly': 1, '5q- abnormalities': 2, 'MDS 5q deletion syndrome': 1, 'HOUSEHOLD NUCLEATION': 1, 'VCN': 1, 'isolated 5q-syndrome': 1, 'Del (5q) syndrome': 1, 'del (5q) syndrome': 4, 'nucleation': 2, 'or 5q': 1, 'SARTI-MAR': 1, 'deletion 5q abnormalities': 1, 'NRBCs': 4, 'Nucleate': 1, 'MAR-Trientine': 1, '5q and-7 abnormalities': 1, 'minus 5q syndrome': 1, 'Minus 5q syndrome': 1, 'Chromosome 5q- syndrome': 1, 'del(5q) abnormalities': 4, 'del[5q': 2, 'del (5q) chromosome abnormalities': 1, 'MAR syndrome': 3, 'del5q': 2, 'del5q abnormality': 1, 'del(5q) disease': 3, 'NUCLEATION': 8, '-MAR': 8, 'beta-NAs': 1, '5q deletion chromosomal abnormality': 1, 'Del(5q': 9, '5q Syndrome': 1, 'macrocytic refractory anaemias': 1, 'pNDM-MAR': 5, 'ACIDS OF NUCLEATED': 1, 'chromosome 5q-deletion syndrome': 1, 'genetic disorder 5q-syndrome': 1, 'nRBC': 1, '5q anomaly': 1, 'chromosome 5q deletion syndrome': 5, '(5q)': 2, '5q SMA': 1, 'Diamond-Blackfan anaemia and 5q- syndrome': 1, 'del(5q) 6': 1, '5q-) syndrome': 1, 'MAR-SUPIALS': 1, 'HEN': 3, 'HON': 2, 'non-5q motor neuron diseases': 1, '5q- syndromes': 3, 'NUCLEATES': 1, 'Del(5q)': 1, 'chromosome 5q- syndrome': 2, 'Del(5q) abnormalities': 1, 'deletion 5q chromosomal abnormality': 1, 'MSN': 1, 'refractory macrocytic anaemia': 1, 'NUCLEATION BULGES': 1, 'del 5q syndrome': 1, 'deletion 5q syndrome;SEER': 1, 'del(5q)(5q-syndrome': 1, 'NS': 3, '5q- syndrome ribosomopathy': 1, '5q abnormality': 3, '5q(-) syndrome': 2, "'5q-syndrome'": 1, '5q_ syndrome': 1, '5q deletion': 4, 'anemia of 5q- syndrome': 1, '5q-linked SMA': 1, 'Primary 5q-syndrome': 1, 'primary 5q-syndrome': 1, '5q - syndrome': 1, 'DETECTING NUCLEATED': 1, 'NUCLEATE': 1, 'del [5q': 1, 'deletion 5q abnormality': 2, 'del(5q) and -': 1, 'Dyskeratosis congenital and 5q- syndrome': 1, '5q chromosome abnormality': 1, 'nRBCs': 1, 'ND': 3, 'ATMOSPHERIC NUCLEATION': 1, 'Chromosome 5q-syndrome': 1, 'TN': 1, 'del(5q) chromosome abnormality': 2, 'CHROMOSOME 5Q': 1, 'IN': 2, 'del[5q]': 1, '5Q - Syndrome': 1, 'nucleator deficiency': 1, '5q--syndrome': 4, 'del (5q-) syndrome': 1, 'del (5q-)) syndrome': 1, 'deletion (del)5q': 1, 'MAR-': 2, 'HD-MAR': 1, 'chromosome 5q-syndrome': 1, '5q - anomaly': 1, 'del (5q) chromosomal abnormalities': 1, '5Q- T': 1, '5q chromosomal abnormality': 1, 'chromosome 5q abnormalities': 2, '-Nif-MAR': 1, 'AA-MAR': 1, 'interstitial 5q syndrome': 1, 'nucleate macrogametophyte': 1, '5Q-R': 1, 'Nathan DG 5q-syndrome': 1, '5q- minus': 1, 'DEL MAR': 1, '5q-deficiency': 1, 'del(5q) (5q-syndrome': 1, 'MAR-THO': 1, 'del)5q': 1, 'del)5q chromosomal abnormality': 1, '5q- syndrome:5q- syndrome': 1, 'MAR-ABi': 1, '5q monosomy syndrome': 1, 'acquired minus 5q syndrome': 1, 'ME/MAR': 1, 'Diamond-Blackfan and 5q-syndrome': 1, 'del(5q) 4': 1, 'myeloid disorders associated with the 5q- syndrome': 1, 'MAR/': 1, 'dup(5q) syndrome': 1, 'del-5q': 1, 'del (5q) chromosomal abnormality': 1, 'Distal 5q deletion syndrome': 1, 'deletion 5q syndrome': 1, 'deletion of chromosome 5q': 1, 'Non-5q': 1, 'DELETION OF 5Q': 1, '-nucleate Polygonum type': 1}
|
5q- syndrome
|
Disease
|
MESH:C535325
|
{'PTS': 1602, 'PTP': 1, 'PTPS deficiency': 73, '6-pyruvoyl-tetrahydropterin synthase': 5, 'PTPS': 41, 'PTS-2': 1, '6-pyruvoyltetrahydropterin synthase deficiency': 17, '6PTSD': 1, '6-pyruvoyl-tetrahydropterin synthase deficiency': 39, '6-pyruvoyl-tetrahydrobiopterin synthase deficiency': 1, 'Tetrahydrobiopterin deficiency PTS': 1, 'PTS symptoms': 72, 'PTPSD': 14, 'Pyruvoyl-tetra-hydropterin synthase deficiency': 1, 'PTPS) deficiency': 12, 'PTHD': 1, 'PTHD deficiency': 1, 'PTS-A': 1, 'PTS-S': 1, 'Auto-PTS': 1, 'PWS-PTS': 1, 'PTSS': 1, 'PTS symptom': 21, 'PTPS deficient': 8, '6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency': 15, 'PTPS deficiencies': 4, '6PTPS) deficiency': 2, '6-pyruvoyl tetrahydropterin synthase (': 1, 'PTPS defect': 2, 'PTPS-deficiency': 2, '6-pyruvoyl tetrahydrobiopterin synthase deficiency': 1, 'L.PTS': 1, 'PTS D': 3, '6-pyruvoyl tetrahydropterin synthase deficiency': 12, 'deficiency of the 6 pyruvoyl tetrahydropterin synthase': 1, 'of the 6 pyruvoyl tetrahydropterin synthase': 1, 'PTPS)': 1, 'PTPS defects': 2, '6-pyruvoyl tetrahydropterin synthase': 1, '6-pyruvoyl tetrahydropterin synthase (PTPS) deficiency': 8, 'PTS deficiency': 9, 'PTS deficient': 2, '6-pyruvoyl-tetrahydropterin synthase (': 3, 'PTPS-deficient': 20, 'PTPS-I': 1, '6-Pyruvoyl-tetrahydropterin': 1, '6-pyruvoyl-tetra hydropterin synthase deficiency': 1, 'PTS Symptoms': 3, 'PTS+': 3, '6-pyruvyltetrahydrotrexate synthase (PTPS) deficiency': 1, 'HA PTS': 1, '6-pyruvoyl-tetrahydropterin synthase [PTPS] deficiency': 2, 'PTS disorder': 3, 'PTPSd': 2, '6-Pyruvoyl-tetrahydropterin synthase deficiency': 3, 'pyruvoyl-tetrahydropterin synthase deficiency': 2, 'PTS injury': 1, 'PTS-FC': 1, '6-pyruvoyltetrahydropterin synthetase deficiency': 2, 'PTS-': 2, 'TETRAHYDROPTERINS': 1, '6-Pyruvoyltetrahydropterin Synthase Deficiency': 1, 'deficiency of 6-pyruvoyltetrahydropterin synthase': 2, 'Pyruvoyl-tetrahydropterin synthase deficiency': 1, 'AO-PTS': 1, 'TSCYC-PTS': 1, 'DBP PTS': 1, 'PTPS-III': 1, 'PTPS-I/III': 1, 'PTPS-VI': 1, 'PTPS-IV': 1, 'post-thrombotic (PTS) syndrome': 1, 'Pyruvoyltetrahydropterin synthase deficiency': 1, '6-Pyruvoyl- Tetrahydrobiopterin Synthase Deficiency': 1, 'PRD': 1, 'UKM-PTS': 1, 'PTS)': 1, 'PEP-PTS': 1, 'N. PTS': 2, '-PTS': 2, 'PTPS dysfunction': 1, '6-pyruvoyl-tetrahydropterin synthase deficiency PTS AR': 1, 'post thrombotic syndrome PTS': 1, 'Deficiency of 6-pyruvoyltetrahydropterin synthase': 1, 'ARR PTS': 1, 'PTPS deficiency 6': 1, 'PTPS-II': 1, '6-pyruvoyltetrahydropterin synthase (PTPS) deficiency': 2, 'PTS.96': 1, 'EUS-PTS': 1, 'PTS.It': 1, 'PTPS) Deficiency': 2, '6-Pyruvoyl-tetrahydropterin synthase (': 3, 'benign PTS': 1, 'DVT PTS': 1, 'PTPS deficiency 1': 1, '6-PTPS': 1, 'HPABH4A': 4, '6-pyruvoyl tetrahydropterin synthase (6-PTS) deficiency': 2, 'deficiency of 6-pyruvoyl tetrahydropterin synthase': 2, 'PTS-a-III': 1, 'PTS.No': 1, 'Endosafe-PTS': 1, 'bleeding PTS': 1, 'pyruvoyl tetrahydro-pterin synthase deficiency': 1, 'PTS disorders': 1, 'PTS Symptom': 2, 'PTS]': 1, 'PTS 32': 1, 'PTS 21': 1, 'PTS-ZN': 1, '6-pyruvoyl-tetrahydropterin synthase deficiency97': 1, '6-Pyruvoyl-tetrahydropterin synthase': 2, 'PTS hyperarousal symptom': 1, 'type 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency': 1, '6-pyruvoyl-tetrahydropterin sysnthase deficiency': 1, 'PTS/D': 1, 'PTS*score': 1, '6-pyruvoyl tetrahydropteridine synthase deficiency': 1, 'post-thrombotic [PTS] syndrome': 1, 'cis-PTS': 1, 'DS-PTS': 1, 'PTS II': 2, 'PTS III': 2, 'PTS I': 1, '(6-)pyruvoyl-tetrahydropterin synthase deficiency': 1, 'PTS tumors': 1, 'PTS-symptoms': 1, '6-Pyruvoyl-tetrahydropterin synthase (PTPS) deficiency': 1, 'INDEL_PTS': 1, '6-Pyruvoyltetrahydropterin Synthase (PTPS) deficiency': 1, 'posttraumatic symptoms PTS': 1, 'PTS.ti': 1, 'PTS bacteria': 1, 'PTS) symptoms': 2, 'PT': 1, 'HPA-BH4 deficiency': 1, 'BH4 deficiency PTS': 1, 'J-OE-PTS-': 1, '6-pyruvoyl-tetrahydrobiopterin synthase (PTPS) deficiency': 1, 'non-BH4-deficient hyperphenylalaninemia': 1, 'Non-BH4-deficient hyperphenylalaninemia': 1, 'FPTPSD': 1, 'false PTPSD': 1, 'pyruvoyltetrahydropterin synthetase deficiencies': 1, '6-pyruvoyl-tetrahydropterin': 1, 'Fe (PTS)': 1, 'PTS.Dopant': 1, 'PTSD': 1, 'BH4-deficient hyperphenylalaninemia': 1, 'PTS&C': 1, 'deficiency of PTPS': 1, 'PTPS Deficiency': 2, 'PTPS-deficient HPA': 1, 'CAPS-CA': 1, 'PTS avoidance': 1, 'BH4 deficiency PTS': 1, 'PTPS-NeP': 1, 'PTS syndrome': 1, 'PTS [postthrombolic syndrome] I': 1, 'lower extremity PTS': 1, 'LE-PTS': 1, 'UE-PTS': 1, '6-Pyruvoyl-Tetrahydropterin Synthase (PTS) Deficiency': 1, 'PTS-Glc-EIIA': 1, 'PTS-deficient': 1, 'PTS-deficiency': 1}
|
PTS
|
Disease
|
MESH:C535326
|
{'limb injury': 508, 'Limb injury': 45, 'heart-hand syndromes': 22, 'Holt-Oram syndrome': 857, 'limb injuries': 671, 'HOS': 843, 'atrio-ventricular block': 1187, 'Ventriculo': 46, 'Ventriculo Direito ainda': 1, 'Ventriculo Direito': 11, 'ventriculo direito': 51, 'swollen hands syndrome': 2, 'atrio-ventricular node': 11, 'hand dysfunction': 362, 'Atrio-ventricula (AV) block': 1, 'HOS osteosarcoma': 17, 'Holt-Oram Syndrome': 112, 'hand impairment': 300, 'atrio-ventricular valve dysplasia': 2, 'atrio-oesophageal fistulae': 9, 'AE': 22, 'VE': 70, 'limb salvage Injury': 1, 'limb salvage injury': 1, 'limb salvage injuries': 1, 'Ventriculo-Atrial': 2, 'abnormal atrio-ventricular conduction': 2, 'ventriculo esquerdo': 40, 'ventriculo': 35, 'atrio-oesophageal fistulas': 8, 'ventriculo-coronary anomalies': 1, 'impaired hand dexterity': 35, 'heart-hand" syndrome': 1, 'abnormalities of the hands': 14, 'ventriculo-coronary fistula': 1, 'atrio-ventricular discordance': 21, 'hand syndrome': 12, 'hand syndromes': 10, 'hand impairments': 144, 'Impairments of One Hand': 1, 'HOS tumor': 9, 'FEVE': 58, 'atrio ventricular block': 17, 'atrio-ventricular sequence disorders': 1, 'Hand Impairment': 10, 'Ventriculo-atrial defect': 2, 'ventriculo-atrial defects': 1, 'Ventriculo-atrial defects': 1, 'ventriculo-atrial defect': 5, 'OS HOS': 2, 'in atrio-ventricular': 1, 'cardiac, eye, and limb abnormalities': 1, 'Dominant hand dysfunction': 1, 'AV block': 178, 'atrio-ventricular (AV) block': 125, 'Mobitz type I AV': 1, 'nondominant hand impaired': 2, 'Atrio-ventricular regurgitations': 1, 'atrio-ventricular regurgitations': 2, 'Vertebral-Cardiac-Renal-Limb syndrome': 1, 'atriodigital dysplasia': 6, 'isolated limb injury': 26, 'Hand impairments': 4, 'atrio-ventricular gradient': 1, 'Atrio-ventricular block': 65, 'atrio-ventricular': 166, 'atrio-oesophageal fistula': 92, 'cardiac, urinary, orofacial, and limb malformations': 1, 'systemic atrio-ventricular valve': 1, 'Hand motor impairment': 7, 'Chedoke McMaster Hand Impairment': 3, 'HW': 1, 'cardiac and upper limb defects': 1, "che anche l'atrio inizia": 1, 'injury to a limb': 1, 'atrio-ventricular (AV) blocks': 8, 'Atrio-ventricular defect': 1, 'hand dexterity impairment': 12, 'AV blocks': 21, 'AV node conduction abnormalities': 1, 'atrio-ventricular (AV) conduction disturbances': 3, 'Atrio-ventricular Block': 7, 'atrio-ventricular conduction disturbances': 29, 'hind limb injury': 25, 'atrio-ventricular and': 6, 'Holt-Oram': 92, 'atrio-ventricular canal': 50, 'Limb injuries': 50, 'Ventriculo-atrial dissociation': 3, 'Wildervanck': 8, 'cervico-oculo-acoustic dysplasia': 3, 'atrio-ventricular conduction abnormality': 4, 'AVB': 64, 'VAD': 1, 'ventriculo-arterial discordance': 6, 'atrio-ventricular blocks': 123, 'cardiac and limb abnormalities': 9, 'linear insertion of the atrio ventricular valves': 1, 'Holt syndrome': 1, 'impairment of hand movements': 2, 'Atrio-': 1, 'limbs injuries': 16, 'Cervico-Oculo-Acoustic (COA) syndrome': 1, 'cervico-oculo-acoustic syndrome': 19, 'hand abnormalities': 128, 'congenital atrio-ventricular block': 9, 'HOS tumors': 10, 'vertebral, anal, cardiac, trachea-esophageal, renal, and limb defects': 2, '2 AVB': 1, 'atrio-ventricular dyssynchrony': 13, 'cardiac and limb defects': 22, 'cardiac, limb, and neurodevelopmental anomalies': 1, 'Atrio-oesophageal fistula': 26, 'atrio-ventricular conduction disorders': 15, 'HOS-': 7, 'VA dissociation': 5, 'VA': 34, 'ventriculo-atrial (VA) dissociation': 1, 'atrio-ventricular or sino-atrial block': 2, 'atrio-ventricular conduction system disease': 1, 'atrio': 26, 'atrio-ventricular as': 1, 'ventriculo-atrial fistula': 3, 'ventriculo-atrial malalignment defects': 2, 'VD': 75, 'Ventriculo Direito pode': 1, 'atrio-ventricular disorders': 1, 'atrio-ventricular canal defect': 25, 'injuries to the limbs': 10, 'hand/finger abnormalities': 2, 'dysfunction of hand movements': 3, 'AV': 23, 'hand abnormality': 24, 'Holt-Oram syndrome with malformations of the urinary system': 1, 'atrio-His block': 2, 'impairment of the hand': 15, 'contralateral limb injury': 10, 'AH interval': 1, 'cardiac, vertebral, limb and genital anomalies': 1, 'hand impaired': 3, 'Mobitz type II AV block': 1, 'atrio ventricular node': 2, 'atrio ventricular (AV) node': 1, 'Hand impairment': 22, 'atrio-ventricular valve': 29, 'Holt-Oram-syndrome': 3, 'Holt-Oram-Syndrome': 2, 'CHSH': 10, 'Hand dysfunction': 37, 'vertebral, anal, cardiac, tracheo-esophageal, renal, and limb defects': 2, 'hand motor impairment': 80, 'Atrio-Ventricular blocks': 1, 'meningo-encephalo-ventriculo-myelitis': 1, 'hand motor impairments': 23, 'heart-hand syndrome': 61, 'joint, limb, and cardiac defects': 1, 'Wildervanck syndrome': 51, 'atrio-His': 9, 'ventriculo-atrial block': 19, 'AV conduction disorders': 2, 'AV conduction abnormalities': 4, 'atrio-ventricular conduction impairment': 2, 'AV conduction disturbances': 4, 'AVS': 3, 'atrio-ventricular septum': 4, 'impaired hand movement': 10, 'AV discordance': 1, 'hand movement impairment': 5, 'limb ischaemic injury': 1, 'ischaemic limb injury': 9, 'injury of ischaemic limbs': 1, 'Cardiomelic or heart-hand syndromes': 1, 'hand dexterity impairments': 3, 'Hand Dexterity Impairment': 1, 'impairment of hand dexterity': 7, 'impairment to hand performance': 1, 'heart-hand': 4, 'abnormal hands': 13, 'Holt Oram syndrome': 32, 'clumsy hand syndrome': 9, 'Ventriculo-right atrial communication': 1, 'hand motor dysfunction': 25, 'Hand abnormalities': 26, 'ventriculo-atrial dissociation': 4, 'A-V block': 22, 'atrio-ventricular (A-V) block': 23, 'disorders of atrio-ventricular conduction': 8, 'Holt Oram': 4, 'Heart-hand syndrome': 25, 'atrio-OF': 1, 'atrio-ventricular (AV) valves': 1, 'AV valve': 3, 'AV valves': 3, 'atrio-ventricular (AV) valve': 2, 'hand dysfunctions': 22, 'AH': 9, 'atrio-ventricular connection': 3, 'ventriculos arteriales': 1, 'Stocker-Holt dystrophy': 2, 'cardiac and limb ischemia': 17, 'ventriculo-coronary communications': 3, 'Wildervanck Syndrome': 5, 'hand-heart syndrome': 7, 'Holt Oram syndr': 2, 'anon-limb fracture injury': 1, 'VENTRICULO': 9, 'VENTRICULO-CISTERNAL': 1, 'injuries to the limbs and': 2, 'ICFEp': 1, 'de ejecao do ventriculo esquerdo': 3, 'injuries of the limbs': 11, 'cardiac, renal and limb malformations': 3, 'impairment hand motoricity': 1, 'cardiac, limb, ocular and nervous system deficits': 1, 'Wildervanck and Duane syndrome': 1, 'Holt-Oram and ulnar-mammary syndromes': 2, 'AV-blocks': 5, 'AV-block': 21, 'atrio-ventricular canals': 4, 'AVM': 2, 'OsteoSarcoma HOS': 1, 'on impaired hand': 1, 'hand-impaired': 7, 'ventriculo-atrial (VA) tachycardia': 1, 'VA tachycardia': 1, 'Long VA tachycardia': 1, 'atrio-ventricular mechanical dyssynchrony': 1, 'Sino-atrial and atrio-ventricular blocks': 1, 'atrio-ventricular conduction': 12, 'Ventriculo-cardiac shunts': 1, 'useless hand syndrome': 5, 'UHS': 3, 'Useless hand syndrome': 2, 'DH dysfunction': 1, 'Atrio-ventricular (AV) block': 2, 'III AV block': 1, 'Impairment of hand movements': 1, 'atrio direito': 24, 'VENTRICULO DIREITO': 1, 'AD': 9, 'atrio esquerdo': 21, 'Helping Hand 1': 1, 'ABA Insensitive 5 HOS1': 1, 'VC': 2, 'impaired hand-grip': 1, 'hand-grip strength impairment': 1, 'Limited limb injuries': 1, 'Limb-oto-cardiac syndrome': 1, 'intraventricular and atrio-ventricular conduction disorders': 1, 'atrio ventricular valves': 1, 'Hand-Finger Syndrome': 1, 'HFS': 1, 'Hand-Fuss-Syndrom': 7, 'Atrio-ventricular canal': 1, 'ventriculo-subarachnoid hydrocephalus': 1, 'ventriculo-atrial shunts': 2, 'labyrinthine aplasia Wildervanck syndrome': 1, 'atrio-ventricular conduction abnormalities': 20, 'ventriculo-arterial defect': 1, 'ventriculo-arterial septal defect': 2, 'atrio-ventricular node reentry': 1, 'atrio-His conduction': 1, 'Limb Injury': 12, 'Ventriculo-atrial': 2, 'HOLT-Oram Syndrome': 1, 'esophageal, cardiac, renal, limb, spinal, anorectal or other malformations': 1, 'vertebral, anal, cardiac, tracheo-esophageal, renal and limb defects': 1, 'Holt JE': 1, 'atrioventricular and ventriculo-arterial discordance': 7, 'AVSP': 1, 'atrio-ventricular accessory': 3, 'impaired hand': 18, 'Hand motor impairments': 2, 'HHSs': 1, 'heart-hand syndrome type I': 3, 'heart-hand malformation': 1, 'Heart-hand" syndromes': 1, 'Heart-hand': 1, 'ventriculo-meningitis': 5, 'limbs and self-injury': 1, 'IVAD': 1, 'EPVD': 2, 'abnormalities of hands': 2, 'sino-atrial and atrio-ventricular blocks': 2, 'FEVE foi calculada': 2, 'VAC': 18, 'FEVE - Fracao': 1, 'CAVD': 2, 'canicolar syndromes of the hand': 1, 'inherited heart-hand syndromes': 1, 'AOF': 8, 'dysfunction of hand': 2, 'Atrio-oesophageal fistulas': 3, 'Heart-Hand syndrome': 2, 'cardiac and upper limb abnormalities': 3, 'arterial limb injuries': 5, 'atrio-ventricular junction': 10, 'cardiac and distal limb anomalies': 1, 'Oram syndromeKlinefelter syndromeLarsen syndromeApert': 1, 'atrio-ventricular asynchrony': 6, 'isolated limb injuries': 26, 'DAE': 2, 'Ventriculo direito hipertrofico e': 1, 'Ventriculo esquerdo acentuadamente': 1, 'CONGENITAL PARTIAL ATRIO-VENTRICULAR BLOCK': 1, 'Holt-Oram/syndrome': 1, 'long VA tachycardia': 1, 'atrio-ventricular delay': 22, 'VD)': 1, 'atrio-ventricular (I-III) conduction disturbances': 2, 'HOST-CHS': 2, 'atrio-ventricular valvular incompetence': 1, 'In situs solitus atrio-ventricular discordance': 1, 'contralateral limb injuries': 2, 'Long V-A tachycardias': 1, 'long ventriculo-atrial (V-A) interval tachycardia': 1, 'V-A tachycardia': 1, 'ventriculo-coronary fistulae': 1, 'torso or limb injuries': 1, 'atrio-ventricular valve defects': 1, 'AVD': 7, 'atrio-oesophageal perforation': 1, 'A-V': 5, 'ventriculo-atrial (VA) conduction block': 1, 'atrio-His (AH) block': 1, 'HOS OS': 1, 'Limb Injuries': 15, 'VSD': 5, 'ventriculo septal defect': 2, 'atrio-ventricular conduction defects': 16, 'injuries to limbs': 2, 'fore limb injury': 1, 'swollen hand syndrome': 3, 'Hands abnormalities': 2, 'Arterial abnormalities of the hand': 1, 'atrio-ventricular blockade': 17, 'atrio-ventricular-block': 8, 'HHS IV': 4, 'Heart-hand syndrome IV': 1, 'HHS': 8, 'Heart-hand syndromes': 10, 'HHS III': 3, 'HHS I': 2, 'HHS II': 3, 'ventriculo-encephalitis': 12, 'IAVC': 1, 'atrio-ventricular block type II or III': 1, 'Ventriculo-ventricular fusion': 1, 'Roberts, Holt-Oram': 1, 'limb and cardiac anomalies': 2, 'VIF': 2, 'A-V regurgitation': 2, 'atrio-ventricular (A-V) regurgitation': 1, 'impairments of the hand': 4, 'cardiac, gastrointestinal, limb, and skeletal abnormalities': 1, 'ischaemic hind limb injury': 2, 'atrio-ventricular conduction syndrome': 1, 'neuropathies proximal to the hand': 1, 'impairment of the hand movement dexterity': 1, 'limb-injury': 2, 'Atrio-Ventricular Block': 18, 'atrio-ventricular nodal block': 7, 'Injury to a Limb': 2, 'ventriculo dada': 1, 'autosomal dominant heart-hand syndrome': 5, 'limb and torso injuries': 2, 'injuries of the limb': 1, 'atrio-ventricular (AV) conduction defects': 2, 'AEF': 6, 'or atrio-ventricular block': 1, 'HVI': 1, 'ventriculo-': 5, 'abnormality in the hand,': 1, 'hand/thumb dysfunction': 5, 'dominant limb injury': 5, 'atrio-ventricular grooves': 1, 'atrio-ventricular paced rhythm': 1, 'hand-motor impairment': 2, 'Holt': 6, 'AV conduction anomalies': 1, 'atrio-ventricular (AV) valve dysplasia': 1, 'atrio-ventricular valves': 7, 'impaired hand movements': 5, 'impairment of dexterous hand movements': 1, 'impairment in hand movements': 1, 'Ventriculo Esquerdo': 3, 'V-A dissociation': 1, 'ventriculo direito na doenca': 1, 'atrio-ventricular nodal conduction abnormalities': 1, 'RNRVAS': 2, 'neuromotor hand impairments': 2, 'ventriculo-pulmonary fistula': 2, 'VSVD': 4, 'hind limb injuries': 3, '-limb injury': 7, 'dysfunction of the hands': 4, 'impairments in hand strength': 1, 'Impaired Hand Strength': 1, 'Impaired hand dexterity': 2, 'Bell-CHSH': 1, '-CHSH': 1, 'HLT': 1, 'ventriculo izquierdo': 18, 'VI': 14, 'impairment by hand': 2, 'atrio-ventricular conduction disturbance': 5, 'of atrio-ventricular': 1, 'VG': 1, 'Holt-Oram syndrome ASD': 4, 'Noonan or Holt-Oram syndromes': 2, 'Defects of the atrio-ventricular canal': 1, 'Mobitz I AV block': 1, 'bilateral limb injuries': 2, 'atrio-': 10, 'CMV ventriculo-encephalitis': 1, 'dysfunctional of hand which': 1, 'cardiac, respiratory, gastrointestinal, genital, urinary, musculoskeletal, and limb defects': 1, 'vertebral, anorectal, cardiac, tracheo-oesophageal, renal and limb defects': 2, '-one hand syndrome': 1, 'limb and cardiac abnormalities': 4, 'hand-reduction abnormalities': 1, 'atrio-ventricular asynchronism': 1, 'atrio-inferiocaval injury': 1, 'cardiac and limb structural deformities': 1, 'Hands/ft abnormalities': 1, 'atrio-ventricular reentry': 2, 'ventriculo-atrial Gerbode defect': 1, 'Noonan and Holt-Oram syndromes': 2, 'ventriculo-septal defect': 9, 'FEVI': 26, 'sistolica del ventriculo derecho': 1, 'Ischaemic limb injury': 2, 'atrio-esophaegeal fistula': 1, 'motor-impaired hand': 1, 'motor-impaired hands': 1, 'motor impairment of the hand': 4, 'Atrio-ventricular blocks': 7, 'Atrio-Ventricular (AV) Block': 1, 'atrio-ventricular node block': 3, 'abnormalities of the hand area': 1, 'sino-atrial and atrio-ventricular block': 2, 'Congenital atrio-ventricular block': 5, 'abnormal atrio-ventricular junction': 1, 'AVJ atrio-ventricular junction': 1, 'IMVD': 1, 'Dilatacion aguda del VD': 1, 'miocardio del ventriculo derecho': 1, 'atrio-visceral heterotaxic syndrome': 2, 'Atrio-ventricular junctional': 3, 'atrio-ventricular junctional': 3, 'heart and hands': 1, "Wildervanck's syndrome": 14, 'retrograde VA': 1, 'ventriculo-megaly': 2, 'distal (hand) impairment': 1, 'Cardiac and hind limb ischemia': 1, 'ventriculo-small bowel fistula': 1, 'hand and limb dysfunction': 1, 'ARHD': 4, 'access-related hand dysfunction': 3, 'Impairs Hand': 1, 'windblown hand syndrome': 1, 'Atrio-Ventricular canal defect': 1, 'hand motor dysfunctions': 9, 'Hind limb injury': 2, 'abnormality of the hand': 5, 'Disfuncion diastolica del ventriculo izquierdo': 1, 'cardiac, limb anomalies': 1, 'Wenckebach VA block': 1, 'VA conduction block': 1, 'AV nodal block': 4, 'PSVD': 1, 'cervico-oculo-acoustic (Wildervanck) syndrome': 3, 'Cervico-oculo-acoustic (COA) or Wildervanck syndrome': 1, 'Wildervanck-syndrome': 1, 'atrio-espphageal fistula': 1, 'MNNG HOS transforming gene (MET) abnormalities': 1, 'ischemic cardiac and limb disease': 1, 'ventriculo-atrial gradient': 1, 'AV delay': 7, 'Ventriculo-atrial gradient': 1, 'Atrio-Ventricular block': 3, 'HPA': 1, 'vascular abnormalities of the hand': 3, 'atrio oesophageal fistula': 1, 'one hand syndrome': 1, 'syndrome isolated to the hand': 1, 'Atrio-ventricular conduction disturbances': 5, 'Extravasation Injuries of the Limbs': 1, 'ventriculo-subgaleal fistula': 1, 'AV nor VV asynchrony': 1, 'injury to the limbs': 3, 'limb and joint injury': 1, 'paroxystic atrio-ventricular blocks': 1, 'Ventriculo arterial alignment abnormalities': 2, 'craniofacial, cardiac, urogenital, and limb defects': 1, 'Wildervanck, Duane, and Goldenhar syndromes': 1, 'Ventriculo-atrial shunts': 2, 'Clumsy hand syndrome': 1, 'common atrio-ventricular valve': 4, 'Ventriculo derecho': 1, 'unilateral hand dysfunction': 4, 'One-hand dysfunction': 1, 'type 1 AV block': 1, 'DAVD': 1, 'Displasia Arritmogenica do Ventriculo Direito': 1, 'atrio-pulmonary connection': 2, 'HOS Osteosarcoma': 1, 'limb or torso injuries': 2, 'heart-hand syndrome)': 1, 'Mobitz type II atrio-ventricular block': 2, 'VCC': 2, 'Disorders of atrio-ventricular conduction': 1, 'dysplasia of the atrio-ventricular valves': 1, 'Atrio-ventricular valve dysplasia': 1, 'atrio-ventricular conduction disease': 5, 'Atrio-VSD': 1, 'Atrio-ventricular canal defect': 4, 'atrio-ventricular synchrony': 2, 'atrio-ventricular contraction': 2, 'HOS.CD4.CCR5': 1, 'impaired hand manipulation': 1, 'abnormalities in the hands': 1, 'Atrio-ventricular (A-V) block': 2, 'sulcus ventriculo-pilmonalis': 1, 'Sulcus ventriculo-pulmonalis cordis': 1, 'hand-grip impairment': 1, 'exploded hand syndrome': 2, 'Radiological abnormalities in the hand': 1, 'Atrio-ventricular': 3, 'traffic-related limb injuries': 1, 'abnormal movements of hands and fingers': 1, 'impairment of the strong hand': 1, 'injury of limbs': 1, 'AV) and ventriculo-arterial discordance': 1, 'congenital atrio-ventricular (AV) block': 1, 'Heart-hand Syndrome': 2, 'unilateral limb injury': 4, 'congenital cardiac and limb deformities': 2, 'heart-hand disorder': 1, 'Holt-Oram syndrome gene defect': 1, 'Holt-Oram syndrome disease': 1, 'heart-hand syndrome type III': 2, 'motor abnormality of the hand': 2, 'HOS limb defects': 2, 'Holt-Oram syndrome of congenital upper limb (hand) and heart defects': 1, 'limb and cardiac defects': 2, 'Hand motor dysfunctions and': 1, 'vertebral, anorectal, cardiac, tracheoesophageal, renal and limb defects': 2, 'VACTERL': 8, 'VACTERL association': 2, 'Cervico-oculo-facial dysmorphia': 1, 'sinus and atrio-ventricular nodal diseases': 1, 'ventriculo system dilatation': 1, 'DDVE': 7, 'IMVE': 3, 'Holt-oram syndrome': 6, 'Holt-oram syndromes': 1, 'Holt-oram': 1, 'junctional impairment of atrio-ventricular conduction': 1, 'Hand-motor dysfunction': 2, 'VA block': 8, 'unilateral limb injuries': 3, 'VENTRICULO-ARTERIAL (VA) COUPLING': 1, 'Ventriculo megaly': 2, 'atrial and atrio-ventricular conduction disorders': 1, 'Crouzon, and Wildervanck syndromes': 1, 'Ventriculo-atrial block': 1, 'abnormalities in hand and heart development': 1, 'Limb and cardiac anomalies': 1, 'atrio-pericardial fistula': 2, 'atrio ventricular (AV) block': 1, 'sino-atrial or atrio-ventricular conduction disturbances': 1, 'limb, cardiac or renal malformations': 1, 'cardiac and limb malformation': 1, 'AV Block': 1, 'abnormalities of the hand': 8, 'AHA types 1-3, and 5C.': 1, 'arterial limb injury': 1, 'ventriculo-atrial fistulas': 1, 'de atrios': 1, 'ventriculos direito': 1, 'Rush Holt': 1, 'Ventriculo-ureteric shunt': 1, 'ventriculo-ureteric shunt': 1, 'EPMVE': 1, 'abnormality of the hands': 2, 'atrio-eophagial fistula': 1, 'Atrio': 16, 'Cervico-oculo-acoustic dysplasia': 3, 'limb artery injury': 2, 'atrio-oesphageal fistula': 1, 'ventriculos rigidos': 1, 'ventriculos': 14, 'Injuries to limb': 1, 'impaired hand-grip strength': 1, 'Holt Oram Syndrome': 9, 'Holt- Oram syndrome': 4, 'holt oram syndrome': 1, 'Hand syndromes': 2, 'unilateral hand movement dysfunction': 1, 'injuries of limbs': 5, 'deficiencies isolated to the hand': 1, 'CAVB': 2, 'DDVE estava': 1, 'cardiac-limb syndrome': 3, 'ATRIO-ESOPHAGEAL': 1, 'Heart-Hand Syndrome': 8, 'Injuries to the limb': 1, 'Holm-Oram syndrome': 1, 'atrio-ventricular and ventriculo-arterial discordance': 6, 'hand ischemic syndrome': 1, 'atrio-ventricular Wenckebach phenomenon': 1, 'Atrio- and intra- ventricular block': 1, 'limb, craniofacial, and cardiac defects': 1, 'left ventriculo-atrial regurgitation': 1, 'Heart Hand syndrome': 1, 'atrio-ventricle': 1, 'MNNG-HOS tumours': 2, 'MNNG-HOS tumour': 1, 'upper limb--cardiovascular (Holt-Oram) syndrome': 1, 'DSVD': 1, 'ventriculo derecho': 4, 'urogenital, cardiac, renal, tracheoesophageal, limb, and spinal anomalies': 1, 'target limb injury': 1, 'heart hand syndrome': 2, 'holt Oram syndrome': 1, 'atrio-digital dysplasia': 3, 'Abnormal Incurving of Hand': 1, 'atrio-fascicular tachycardia': 1, 'cardiac but not limb malformations': 1, 'atrio-ventricular and intraventricularconduction disturbances': 1, 'Impaired Hand Dexterity': 1, 'hand dexterity dysfunction': 3, 'atrio-venticular block': 2, 'Atrio-ventricular delay': 2, 'sinus and atrio-ventricular disease': 1, 'impaired hand thermoregulation': 1, 'Ventriculo-Atrial Shunt1': 1, 'Ventriculo-atriostomy': 2, 'Hind limb artery injury': 1, 'abnormal hand cascade': 1, 'impaired hand prehension': 1, 'Cervico-Oculo-Acoustic syndrome': 1, 'Atrio-ventricular block III': 1, 'cardiac or limb ischemia': 2, 'cardiac-renal-limb anomalies': 1, 'CRL': 1, 'atrio-ventricular regurgitation': 4, 'VCRL syndrome': 1, 'Atrio-ventricular (AV) conduction disturbances': 1, 'Atrio-His block': 1, 'HOS osteosarcomas': 3, 'AVC': 14, 'cardiac and peripheral limb ischemia': 3, 'VVI': 1, 'cardiac and limb anomalies': 12, 'Ventriculo direito': 7, 'atrio-oesophageal complications': 1, 'impaired hand attempted': 1, 'heart/hand syndrome': 3, 'ventriculo-arterial regurgitation': 1, 'AE foi': 1, 'disfuncao progressivas do atrio esquerdo': 1, 'Holt-Oram (hand-heart) syndrome': 1, 'hand impairment and discomfort': 1, 'Hand motor dysfunction': 1, 'Ventriculo-ventricular dissociation': 2, 'craniofacial, limb and cardiac defects': 1, 'impaired dexterity of hands': 1, 'Heart--Hand syndrome IV': 1, 'heart--hand syndrome IV': 1, 'MCMH 1.0': 1, 'oculo-oto-radial and cervico-oculo-acoustic syndrome': 1, 'impairment of the hand and': 1, 'ventriculo atriales': 1, 'AVN': 13, 'craniofacial, cardiac, limb, thymus, ear and neural tube malformations': 1, 'ventriculos laterales': 1, 'AH block': 2, 'impaired hand-': 1, 'atrio-ventriculary block': 1, 'holt-oram syndrome': 5, 'HO cardiac disorders': 1, 'HO': 1, 'cardiac and limb involvement': 1, "Wildervanck's cervico-oculo-acusticus (COA) syndrome": 1, 'atrio-ventricular canal defects': 8, 'atrio-ventricular bundle': 2, 'atrio-ventricular output': 1, 'Vertebral-Anorectal-Cardiac-Tracheo-Esophageal-Renal-Limb': 1, 'IVAE': 1, 'hand-footgenital syndrome': 1, 'dysfunction in the hand': 2, 'ventriculo-atrial conduction block': 1, 'atrio-sinus block': 2, 'Holt- Oram': 1, 'Oram': 1, 'atrio-oesophageal fistulation': 2, "Wildervanck's oto-oculo-cervical syndrome": 1, 'Ventriculo direito com dilatacao': 1, 'aneurisma do atrio direito': 1, 'ventriculo direito foi notada ser': 1, 'atrio ventricular canal': 2, 'abnormal hand flexion': 1, 'Hand Motor Impairment': 1, 'atrio-ventricular annuli': 1, 'atrio-ventricular (AV)-block': 3, 'atrio ventricular': 9, 'cardiac, renal, and limb defects': 1, 'ventriculo-atrial malalignment': 1, 'ventriculo-atrial malalignments': 1, 'AV block I or II': 1, 'AV block II': 1, 'AV block II or III': 1, 'Ventriculo-atrial malalignment defect': 1, 'Ventriculo-megaly': 4, 'AVC defect': 2, 'anomalies of ventriculo-arterial connection': 1, 'REV': 1, 'atrio-ventricular and intraventricular conduction disorders': 2, 'CHSH-Bell': 1, 'ventriculo-right atrial fistula': 1, 'atrio-ventricular blocksSotalol': 1, 'atrio-ventricular conduction delay': 5, ', renal, radial, cardiac and limb abnormalities': 1, 'gastrointestinal, cardiac, pulmonary, and limb abnormalities': 1, 'Atrio-ventricular valve anomalies': 1, 'atrio-ventricular defects': 2, 'Holt-Oran syndrome': 4, 'hemiparetic hand impairments': 1, 'de expulsion del ventriculo izquierdo': 1, 'cardiomiopatia arritmogenica do ventriculo direito': 1, 'ventriculo direito Tumores': 1, 'atrio-ventricular deformations': 1, 'dysfunction of the hand': 20, 'ventriculo-atrial [VA] block': 1, 'atrio-ventricular (AV) conduction disorder': 1, 'hand/finger dysfunctions': 1, 'cardiac, CNS, lungs, kidneys and limb defects': 1, 'atrio-venous fistula': 4, 'VM': 1, 'Ventriculo-meningitis': 1, 'Ventriculo-Meningitis': 1, 'Hand Syndrome': 2, 'injury to limb': 1, 'atrio-ventricular (AV) nodal block': 1, 'abnormal hand and finger movements': 1, 'VA shunts': 2, ') atrio-ventricular valve': 1, 'heart and hands abnormalities': 1, 'cardiac, limb, and skeletal anomalies': 1, "'heart-hand' syndrome": 1, 'heart-hand abnormality': 1, 'atrio-cochlear disturbances': 1, 'and atrio-ventricular disease': 1, 'impairments of hand preshaping': 2, 'Ventriculos': 1, 'AVJA': 1, 'painPeripheral limb injury': 1, 'left limb injuries': 3, 'cardiac, vertebral, esophageal, or limb anomaly': 1, '-hand dysfunction': 1, '(atrio-ventricular)': 1, 'and heart, hand in': 1, 'atrio-ventricular (AV) dyssynchrony': 2, 'AV dyssynchrony': 5, 'AVDs': 1, 'cervico-oculo-acoustic nerve syndrome': 1, 'heart, kidney, hand, and dermatoglyphic anomalies': 1, 'atrio-ventricular blockade II-III': 1, 'disturbances of atrio-ventricular conductivity': 1, 'compartmental syndrome of the hand': 2, 'ATRIO-VENTRICULAR BLOCK': 2, 'atrio-fasciculo-ventricular': 1, 'FEVI reducida': 2, 'FEVI fue': 1, 'AVJ': 5, 'nonatherosclerotic dysplasia of the AVN artery': 1, 'AVJ hypoplasia': 2, 'atrio-ventricular valvular regurgitation': 6, 'Atrio-ventricular discordance': 1, 'Atrio-ventricular conduction abnormalities': 3, 'hands abnormalities': 4, 'Cervico-oculo-acousticus syndrome': 1, 'cardiac, gastrointestinal, and limb anomalies': 3, 'Ventriculo-atrial shunt infection': 2, 'ventriculo-atrial shunt infection': 1, 'VASI': 1, 'impairment on hand movements': 1, 'Ventriculo izquierdo': 2, 'dysfunction of hand grip': 1, 'hand or UE symptom': 1, 'FE VI': 1, 'IC-FEr': 1, 'CAVV': 1, 'AV (atrio ventricular) canal defect': 1, 'Ventriculo septal defect': 1, 'VENTRICULO-ARTERIAL JUNCTIONS': 1, 'cardiac and hind limb ischemia': 2, '"heart-hand" syndrome': 4, 'AV valve degeneration': 1, 'hand/heart birth defects': 2, 'Ventriculo-septal defect': 3, 'VAJ dilation': 2, 'hand grip dysfunction': 1, 'congenital AVB': 1, 'HOS syndrome': 3, 'Holt-Oram atrio-digital syndrome': 1, 'impaired hand motor performance': 1, 'Congenital atrio-ventricular blocks': 1, 'VENTRICULO-AURICULOSTOMY': 1, 'atrio-ventricular-canal': 1, 'UNI limb injuries': 1, 'atrio-caval junction stenosis': 1, 'hand and finger abnormalities': 1, 'AV disfunction': 1, 'atrio-ventricular (AV) node injury': 1, 'Down and Holt-Oram syndromes': 2, 'atrio-ventricular valve obstruction': 2, 'abnormality in his hand': 1, 'cardiac, craniofacial, and limb malformations': 1, 'hand-motor dysfunction': 5, 'Isolated limb injury': 2, 'Left Ventriculo-Atrial Coupling': 1, 'AVN block': 3, 'Vertebral, anorectal, cardiac, tracheo-oesophageal, renal and limb defects': 1, 'anorectal, cardiac, tracheo-oesophageal, renal and limb malformations': 1, 'atrio-ventricular nodal': 2, 'vertebral, anorectal, cardiac, tracheooesophageal, renal and limb defects': 1, 'atrio-fascicular': 2, 'injuries for limbs': 1, 'atriodigital dysmelia': 1, 'Familial heart-hand syndrome': 1, 'hand-related adverse': 1, 'limbs injury': 4, 'atrio-esophageal': 3, 'Gerbode-type ventriculo-atrial defect': 1, 'atrio-ventricular block Ectopy': 1, 'coronary Atrio Ventricular (AV) fistula': 1, 'cardiac, craniofacial, limb, neural tube': 1, 'heart and hand syndrome': 3, 'hand area': 1, 'Wenckebach atrio-ventricular (AV) block': 1, '-degree AV block': 1, 'disturbances of the atrio-ventricular conduction': 1, 'hands dysfunction': 3, 'VENTRICULO-CARDIAC': 2, 'AV conduction delay': 4, 'Atrio-ventricular conduction disease': 1, 'Atrio-ventricular (AV) conduction disease': 1, 'Verbal, Anorectal, Cardiac, Esophageal, Renal & Limb': 1, 'VACTERL syndrome': 1, 'Vertebral, Anorectal, Cardiac, Tracheoesophageal, Genitourinary, and Limb': 1, 'Vertebral, Anorectal, Cardiac, Tracheoesophageal, Genitourinary, and Limb"': 1, 'Ventriculo esquerdo': 6, "Congenital muscular dystrophy 'Heart-hand' syndrome": 1, 'Disorders of atrio-ventricular conductivity': 1, 'heart-hand syndrome (HHS) IV': 1, 'Hand on the heart': 1, 'atrio-visceral situs solitus': 1, 'atrio-ventricular first-degree block': 1, 'atrio-ventricular constriction': 1, 'Vascular abnormalities of the hand': 1, 'atrio-ventricular-block III': 1, 'atrio venticular block': 2, 'cardiac, orofacial, limb and renal anomalies': 1, 'Chedoke-McMaster Assessment Hand Impairment': 1, 'AV nodal conduction abnormalities': 2, 'Host-Oram syndrome': 1, 'Injuries to limbs': 2, 'ICFElr': 1, 'cerebral, cardiac, and limb abnormalities': 1, 'atriodigital dysplasia syndrome': 2, 'heart-hand disorders': 3, 'heart -hand syndromes': 1, 'dysfunction of the dominant hand': 1, 'canal atrio ventriculaire': 1, 'Atrio-Ventricular (AV) block': 2, 'FEVD': 3, 'FEVE reduzida': 2, 'RHS': 1, 'red hand syndrome': 3, 'VD/VI': 1, 'limb-lengthening injury': 1, 'cardiac, eye, limb, and digital defects': 1, 'HOS Radial': 1, 'HOS -L-TB': 1, 'HOS -L': 1, 'HOS -': 1, 'HOS ND': 1, 'HOS -TB anomaly': 1, 'HOS -TBs': 1, 'malformations of HOS': 1, 'HOS -R-': 1, 'HOS TB': 1, 'HOS -TB': 1, 'cardiac and limb deformities': 1, 'Townes-Brocks and Holt-Oram syndromes': 1, 'Holt-Oram,': 1, 'HVE': 1, 'HOS-SS': 3, 'hemorrhage of the atrio': 1, 'hand impairment and': 2, 'Sudeck syndrome of the hand': 1, 'urogenital, limb, anal and cardiac malformations': 3, 'VPLS': 1, 'VPLS obstruction': 1, 'atrio-esofageal fistula': 1, 'atrio-ventricular (A-V) blocks': 2, 'atrio-ventricular (AV)': 2, 'Wenkebach AV block': 1, 'AV nodal conduction disturbance': 1, 'cardiac and limb malformations': 4, 'craniofacial, cardiac, limb': 1, 'Heart Hand Syndrome': 1, 'Heart hand syndromes': 2, 'heart-hand syndrome type 3': 1, 'ischemic cardiac and limb disorders': 1, 'Atrio-ventricular and semilunar valve malformations': 1, 'atrio-ventricular valve defect': 2, 'ventriculo-atrial (VA) interval tachycardia': 1, 'long VA interval': 1, 'atrio-ventricular regurgitant lesions': 1, 'HOS deformities': 1, 'MNNG HOS': 5, 'atrios': 3, 'hand skeletomuscular impairments': 1, 'Liebenberg and Holt- Oram syndromes': 1, 'injuries of the face and limbs': 1, 'oculo-cervico-cardiac syndrome': 1, 'Cervico-oculo-acoustic (Wildervanck) syndrome': 1, 'COAS': 1, 'intra-atrio-ventricular defect': 1, 'atrio-ventricular conduction blockade': 3, 'ventriculo-atrial (VA) block': 1, 'Holt-Oram Syndrome ASD': 2, 'atrio-ventricular groove': 1, 'canaux atrio-ventriculaires': 1, "Jaccoud's syndrome of the hands": 1, 'cardiac limb syndrome': 1, 'osteosarcoma HOS': 3, 'atrio/ventricular rhythm': 1, 'cardiac/limb/skin ischemia': 2, 'impairments of hand representation': 1, 'hind-limb injury': 3, 'hand-foot-heart heat': 1, 'HHCU abnormalities': 1, 'canal atrio-ventriculaire': 2, 'CAV': 1, 'atrio-His narrow QRS tachycardia': 1, 'impairment of A-V conduction': 1, '), and limb injuries': 1, 'and limb injury': 1, 'vertebral, anorectal, cardiac, tracheoesophageal, renal and limb': 1, 'VACTERL complex': 1, 'Hunan hand syndrome': 2, 'Ventriculo-Atrial Interval': 1, 'sino-atrial or atrio-ventricular conduction abnormalities': 1, 'atrio-ventricular (AV) block III': 1, 'AV block III': 2, 'abnormal hand positioning': 6, 'AV-conduction disturbances': 2, 'impaired performance in hand movements': 1, 'Ventriculo-Atrial Defect': 1, 'MNNG/HOS': 2, 'familial heart-hand syndrome': 2, 'atrio-ventricular cushion': 1, 'impairment of the hands': 4, 'Impairment of the hands': 2, 'atrio-ventricular delays': 1, 'atrio-ventricular (': 2, 'Wildervanck (cervico-oculo-acoustic) syndrome': 4, 'atrio-ventricularis communis': 1, 'limb artery injuries': 2, 'Arterial limb injuries': 1, '-limb injuries': 4, 'thermosensory impairment of the hands': 1, 'ATRIO-VENTICULAR BLOCK': 2, 'vertebral, anal, cardiac, tracheal, esophageal, renal, and limb (VACTERL) malformations': 1, 'Abnormal hand positioning': 1, "Holt's Diseases": 1, 'Atrio-Ventricular Canal (AVC) defects': 1, 'Gerbode ventriculo-atrial defect': 2, 'Heart-hand" syndrome type I': 1, '"Heart-hand" syndrome': 1, 'Ventriculo-aortic junction': 3, 'abnormalities of hand': 1, 'cardiac and limb ischaemias': 1, 'ventriculo-coronary communication': 1, 'combined limb injury': 1, 'Combined limb injuries': 1, 'Vertebral, Cardiac, Renal and Limb Defect Syndrome': 1, 'atrio-ventricular bloc': 1, 'Injuries to the limbs': 1, 'cardiac, limb and other anomalies': 1, 'atrio-ventricular cushions': 1, 'VA conduction': 1, 'Ventriculo-Atrial Conduction': 1, 'left-handed heart obstructive disease': 1, 'ventriculo-atrial delay': 1, 'atrio-ventricular fistula': 4, 'ventriculo-atrial atresia': 1, 'cardiac, gastrointestinal, urological and limbs/skeletal defects': 1, 'Ventriculo Derecho': 1, 'intraventricular or atrio-ventricular conductive disorders': 1, 'heart-hand pathology': 1, 'ventriculo-venous communication': 1, 'atrio-VSD': 2, 'atrioventricular (AV) and ventriculo-arterial (VA) discordance': 1, 'atrio-caval block': 1, '-VD': 1, 'atrio-ventricular canal malformation': 2, 'dominant hand dysfunction': 3, 'ventriculo direito secundaria': 1, 'VD.Com': 1, 'skeletal, limb and cardiac malformations': 1, 'bulbo-atrio-ventricular ledge': 1, 'Hand Dysfunction': 7, 'impaired hand strength': 3, 'atrio-ventricular ring': 2, "hands' abnormality": 1, 'Heart hand': 1, 'cardiac and limb-girdle muscle involvement': 1, 'cardiac, vertebral, tracheo-esophageal, renal and limb defects': 2, 'AHA type 0 and 1': 1, 'A-H': 1, 'atrio-His bundle': 2, 'atrio-His bundle dissociation': 1, 'atrio-ventricular conduction disorder': 5, 'ventriculo-aortic dehiscence': 2, 'vertebral, anal, cardiac, trachea-esophageal, radius or renal, limb) syndrome-like malformations': 1, 'Ventriculo unico': 1, 'ventriculo esquerdo com dilatacao grave': 1, 'LAEF': 1, 'left atrio-oesophageal fistula': 2, 'vertebral, anorectal, cardiac, tracheoesophageal, genitourinary, and limb malformations': 2, 'atrio-ventricular (AV) conduction disturbance': 2, 'limb and junctional injuries': 1, 'Holt-Oram and Noonan syndromes': 1, 'Holt-Oram, ulnar-mammary and DiGeorge syndromes': 1, 'atrioventricular (AV) disease': 1, 'atrio-ventricular (AV) disease': 1, 'vertebral, anal, cardiac, tracheal, renal, limb malformations': 1, 'malformations of the face, hands, heart, or urogenital region': 1, 'ventriculo-ependymitis': 1, 'mangled limb injury': 2, 'mangled limb injuries': 2, ', cardiac, tracheo-esophageal, renal and limb anomalies': 1, 'cardiac, tracheo-esophageal, renal and limb anomalies': 1, 'Cleft hand 1': 1, 'cardiac and upper-limb defects': 1, 'heart-hand symptom': 1, 'HOS swelling': 1, 'clumsy hand-dysarthia syndrome': 1, 'atrio ventricular malformation': 1, 'cardiac or lower limb ischemia': 1, 'vascular abnormalities in the hand': 1, 'Ventriculo-atrial (VA) dissociation': 1, 'dysarthric-clumsy hand syndrome': 1, 'Hand on the Heart': 1, 'Holt Oran syndrome': 1, 'Holt-Oram disease': 2, 'Holt-Oram syndromic disease': 1, 'AVCD': 4, 'craniofacial, ear, thymic, cardiac, and limb anomalies': 1, "hands' impairment": 1, 'Ventriculo-arterial anomalies': 2, 'congenital atrio-ventricular blocks': 3, 'big hand syndrome': 3, 'Hand grip impairment': 1, 'hand abnormalities 1, 4,': 1, 'heart-hand syndrome type 1': 1, 'cardiac, tracheoesophageal, renal, and limbs deformities': 1, 'infra-Hissian AV block': 1, 'cardiac, craniofacial, skeletal, and limb defects': 1, 'cavidade do VD': 1, 'Be Heart-Hand Syndrome': 1, 'atrio-ventricular block1': 1, 'Holt-Oram syndrome conduction disease': 1, 'Holt-Oram syndrome associated abnormalities': 1, 'Oram syndromeChromosomal': 1, 'Ventriculo-atrial conduction': 1, 'white hand syndrome': 2, 'remodelacion inversa del VI': 1, 'atrio-ventricular canal abnormalities': 1, 'limb/skeletal injuries': 1, 'motor dysfunction of fingers or hand': 1, 'ventriculo-gallbladder shunts': 2, 'Ventriculo-gallbladder shunts': 1, 'vertebral, anorectal, cardiac, tracheo-esophageal, renal and limb malformations': 1, 'limb extremity injury': 1, 'Hold-Oram syndrome': 1, 'Abnormalities of the hand': 1, 'autosomal dominant human "heart-hand" disorders': 1, 'Ventriculo V': 1, 'Arritmogenica de Ventriculo Direito': 1, 'Ventriculo T': 1, 'Ventriculo-Atrial Shunt': 1, 'spinal/paraspinal AVM': 1, 'atrio-ventricular malformations': 1, 'circumferential limb injury': 1, 'atrio-ventricular (A-V) canal': 3, 'A-V canal': 1, 'VPL shunts': 1, 'atrio-ventricular response': 1, 'ventriculos cardiacos': 1, 'atrio-ventricular defect': 5, 'nodular sclerosis of atrio-ventricular valves': 1, 'injury of the limb': 3, 'HOS defects': 3, 'Ventriculo-aerocele': 1, 'atrio-ventricular tachyarrhythmia': 1, 'Limb-injury': 1, 'clumsy-hand syndrome': 3, 'atrio-His (': 1, 'abnormal hand positions': 1, 'Wenckebach-type AV block': 1, 'Wenckebach type AV block': 1, 'Mobitz type 1 Atrio-ventricular block': 1, 'ventriculo-atrial derivation (VAD) disfunction': 1, 'VAD dysfunction': 1, 'hand region abnormalities': 1, 'Hand Abnormality': 1, 'WS': 3, 'Atrio-ventricular regurgitation': 1, 'Holt-Oram syndromes': 5, 'neuronal, cardiac, and limb defects': 1, 'de Lange, Holt-Oram and Jacobsen syndromes': 1, 'A-V Block': 2, 'atrio-ventricular and ventriculo-atrial dissociation': 1, 'malformations in the hands, face, or heart': 1, 'impairment in hand dexterity': 1, 'ventriculo-septal defect type I': 1, 'HE': 1, 'HL': 4, 'atrio ventricular (AV)-canal': 1, 'proximal limb injuries': 3, 'Hand-Heart syndrome': 1, 'Limbs injuries': 2, 'Red Hand Syndrome': 1, 'Impairments of the hand': 1, 'impairment of hand dexterity and': 2, 'Hand syndrome': 1, 'valva atrio-ventricularis dextra': 1, 'VENTRICULO-CARDIAC DRAINAGE': 1, 'Ventriculo-caval': 1, 'impaired precision of the hand movements': 2, 'hand or finger abnormalities': 2, 'atrio-ventricular disruption': 3, 'atrio-ventricular block-1': 1, 'vertebral, anal, cardiac, renal, or limb defect': 1, 'injuries of the limb or': 1, 'abnormalities in hands': 1, 'combined limbs injury': 1, 'atrio--ventricular block': 1, 'Holt-Oram (': 1, "Holt-Oram's syndrome": 1, 'A-V conduction disturbance': 1, 'Ventriculo-subgaleal shunts': 1, 'heart-hand syndrome I': 1, 'abnormalities of the hands, arms, and the heart': 1, 'limb disease and injury': 1, 'abnormalities of the heart, face, skull, hands or': 1, 'A-V conduction disturbances': 2, 'Atrio-Ventricular (A-V) conduction disturbances': 1, 'impairment of hand strength and dexterity': 2, 'cardiac, esophageal or limb deformities': 1, 'TrAE': 1, 'congenital hand/heart syndromes': 1, 'cardiac or limb defects': 2, 'abnormality in the hand area of the': 1, 'ventriculo esquerdo medida': 1, 'PDVE': 1, 'heart and hand disorders': 1, 'Atriodigital dysplasia syndrome': 1, 'Impairment of hand dexterity': 1, 'motor hand impairment': 2, 'wildervanck syndrome': 1, 'left ventriculo-atrial fistula': 1, 'abnormal hand': 2, '-hand syndrome': 1, 'limb injuries and loss': 1, 'Ventriculo-bulbar block': 1, 'preaxial hand abnormalities': 1, 'VSVE': 2, 'Heart-Hand syndrome II': 1, 'Heart-hand syndrome II': 1, 'A-V conduction defect': 1, 'del VD': 1, 'dilatacion del ventriculo izquierdo fueron menos': 1, 'Ventriculo-Atrial-Atrio-': 1, 'VA prolongation': 2, 'atrio-ventricular conduction disabilities': 1, 'atrio-ventrcular block': 1, 'Atrio-ventricular dyssynchrony': 2, 'hand heart syndrome': 1, 'abnormal hand grip strength': 1, 'Atrio-ventricular conduction defects': 2, 'vertebral, cardiac and limb defects': 1, 'spinal, renal, limb or cardiac defects': 1, 'hand-impairment': 1, 'Impaired Hand': 3, 'Ventriculo-atrial regurgitation': 1, 'cardiac, renal, intestinal, and limb defects': 1, 'ventriculo-subcutaneous fistula': 1, 'VAC impairment': 1, 'Injuries of the limbs': 2, 'Ventriculo-atrial shunt nephritis': 1, 'atrios e': 1, '-related hand dysfunction': 2, 'SIV es convexo hacia VD': 1, 'Disfuncion sistolica del VD': 1, 'concavo hacia VI': 1, 'VD/VI > 1 dilatacion severa de VD': 1, 'atrio-ventricular or': 1, 'A-V blocks': 2, 'Mobitz type 1 A-V block': 1, 'Mobitz type 1 and 2 A-V block': 1, 'Mobitz type 1 atrio-ventricular block': 1, 'ventriculos congenitamente': 1, 'VU': 3, 'Hand dexterity dysfunction': 1, 'Left atrio-oesophageal fistula': 1, 'cardiac, vertebral, or limb anomalies': 1, 'atrio-ventricular node injury': 1, 'Holt-Oram and DiGeorge syndromes': 2, 'Holt-Oram (heart-hand) syndrome': 1, 'craniofacial, limb, and cardiac defects': 1, 'ventriculo-atrial': 1, 'Swollen hand syndrome': 2, 'atrio-ventricular disturbances': 1, 'Vertebral, Anorectal, Cardiac, Tracheoesophageal, Renal and Limb': 1, 'TECHNIC OF VENTRICULO-ATRIAL': 1, 'injuries to limb': 1, 'Ventriculo esquerdo em': 1, 'AV nodal disease': 2, 'AV conduction disorder': 1, 'AV conduction disease': 3, 'AV disease': 1, 'HOS OMIM142900': 1, 'atrio-His anomalous': 1, 'Holt-Horam Syndrome': 1, 'Holt-Oram syndrome;Type II Mellitus diabetes': 1, 'anal, vertebral, cardiac, tracheal, esophageal, renal (urological) and limb malformations': 1, 'vertebral, cardiac, renal and limb defects': 4, 'Ventriculo-Atrial Block': 1, 'Atrio-ventricular node reentry': 1, 'AVNRT': 1, 'Big hand syndrome': 1, 'cardiac, skeletal, and limb defects': 1, 'Ureter Ventriculo': 1, 'vertebral, anorectal, cardiac, tracheo-esophageal, renal and limb (VACTERL) defects': 1, 'atrio-ventricular delay/block': 1, 'ventriculo direito aparecem': 1, 'VD apareciam': 1, 'impairments of hand movements': 1, 'Atrio-venticular canal defect': 1, 'Atrio-ventricular (AV) blocks': 1, 'limb-threating injury': 1, 'other injuries of the limbs': 1, 'ventriculo post reseccion tumoral': 1, 'Down, Alagille, or Holt-Oram': 1, 'Heart-Hand Syndrome Type 1': 1, 'Abnormal hand': 1, 'atrio-esophageal fistulais': 1, 'Hands on heart': 1, 'Hand abnormality': 2, 'AV canal defect': 4, 'AV canal': 1, 'AV canal defects': 1, 'Atrio-ventricular canal (AV canal) defect': 1, 'AV Canal': 1, 'AV Canal defect': 1, 'Atrio-ventricular (AV) canal defect': 1, 'HOS type 1 syndrome': 1, 'atrio-femoral': 1, 'AF': 1, 'dysfunction of the hand and leg': 1, 'hand and leg dysfunction': 1, 'hind limb joint injury': 1, 'atrio-ventricular dehiscence': 1, 'posterior limb injuries': 1, 'atrio ventricular (AV) blocks': 1, 'Ventriculo-subgaleal shunt': 2, 'atrio ventricular blocks': 2, 'Impairment in hand dexterity': 1, 'AV reentry': 1, 'AV junctional': 1, 'atrio-caval thrombosis': 1, 'isolated hand impairment': 1, 'sino-atrial or atrio-ventricular blocks': 1, 'motor dysfunction of dominant hand': 1, 'Impairment of Hand Movement': 1, 'limb, cardiac and/or craniofacial malformations': 1, 'Ventriculo-Megaly': 1, 'vertebral, cardiac, renal, genital, and limb anomalies': 1, 'abnormality of atrio-ventricular conduction': 1, 'Vertebral-Anal-Cardiac-Tracheo-Esophageal-Renal-Limb defects': 1, 'AVC malformation': 1, 'atrio-ventricular (AV) canal': 1, 'malformations of the AV canal, AV valves, ventricles': 1, 'atrio-ventricular (AV) nodal blocks': 1, 'Atrio-fascicular Mahaim': 1, 'atrio-fascicular Mahaim': 1, 'AFM': 1, 'of limb injuries': 1, 'cervico-oculo-acoustic (COA) syndrome': 1, 'impaired in hand': 1, 'impairments in hand speed or movement area': 1, 'Hand-hoot syndrome': 1, 'atrio-ventricular nodal disease': 2, 'cardiac, limb and gastrointestinal defects': 1, 'ventriculo-atrial regurgitation': 1, 'cutaneous, craniofacial, cardiac, and limb anomalies': 1, 'cutaneous, cardiac, and limb anomalies': 1, 'ischemic symptoms of hand and fingers': 1, 'Holt - Oram syndrome': 1, 'cardiac and limb ischemic': 1, 'Cervico-oculo-acoustic syndrome': 4, 'vertebral/anorectal/cardiac/tracheoesophageal/renal/limb defects': 1, 'AN': 3, 'atrio-ventricular activation': 1, 'ventriculo-septal defects': 3, 'Violent injury to limbs': 1, 'VACTERL (vertebral, and, cardiac, tracheal, esophageal, renal, limb) malformations': 1, 'impairment in the hand': 1, 'Holt-Oram-like syndrome': 1, "washerwoman's hand's syndrome": 1, 'Injuries to other limbs': 1, 'injuries to other limbs': 1, 'facial, limb, respiratory, and cardiac muscles': 1, 'vertebral, cardiac, renal, and limb defects syndrome': 2, 'MN': 1, 'Motorcycle limb injuries': 1, 'impairments in hand dexterity': 2, 'heart hand disorders': 1, 'heart hand syndromes': 2, 'Holt-Oram like syndrome': 1, 'Holt-Oram or velocardiofacial-like syndromes': 1, 'TES': 1, 'defects in limb, cardiac, and genitourinary development': 1, 'Ventriculo-atrial shunt': 1, 'Goldenhar or Wildervanck syndrome': 1, 'atrio-ventricular captures': 1, 'LI': 1, 'disorders of the atrio-ventricular': 1, 'after-limb injury': 1, 'hand kinematic dysfunction': 1, 'abnormality of HGS': 1, 'Abnormal Hand Grip Strength': 1, 'HGS abnormality': 1, 'VACTERL vertebra, anal, cardiac, trachea-esophageal, renal and limb anomalies': 1, 'atrio-ventricular (A-V) blockade': 1, 'A-V blockade': 1, 'anomalies of atrio-ventricular orifices': 1, '-limb noncontact injuries': 1, 'atrio-ventricular (AV) conduction disorders': 1, 'retrograde atrio-ventricular conduction': 1, 'hand usage dysfunction': 2, 'abnormalities of the hand-': 1, 'ATRIO-': 1, 'VU shunts': 1, 'Williams, and Holt-Oram syndromes': 1, 'hand impaired by': 1, 'cardiac, limb and neurodevelopmental anomalies': 1, 'Abnormal hand sensations': 1, 'abnormal hand sensations': 1, 'cardiac, limb, and CNS defects': 1, 'systemic atrio-ventricular': 1, 'limb-saving injuries': 1, 'ventriculos cerebrais': 1, '-Oram': 1, 'ventriculo-radial dysplasia': 1, 'Impaired hand movement': 1, 'abnormal vein of the hand': 1, 'Atrio-ventricular (AV) dyssynchrony': 1, 'Atrio-ventricular dyssinchrony': 1, 'atrio-ventricular,': 1, 'hand andfoot syndrome': 1, 'front limb injuries': 1, 'Hand washing:1': 1, 'atrio-ventricular block III': 2, 'limb and cardiac malformations': 1, 'cardiac or limb anomalies': 3, 'heart-hand defects': 1, 'gastrointestinal, cardiac, pulmonary and limb abnormalities': 1, 'atrio-ventricualr blocks': 1, 'limb joint injuries': 2, 'HOS Hostility': 1, 'HOS OMIM 142900': 1, 'hand knob syndrome': 1, 'Hand Knob Syndrome': 1, 'atrio-ventricular interval shortening': 1, 'hand sensory or motor dysfunction': 1, 'Atrio-ventricular canal malformations': 1, 'atrio-ventricular canal malformations': 1, 'sistolica del ventriculo': 1, 'atrio-myopathy': 1, 'extremity (limb) injuries': 2, 'Atrio-ventricular Septum': 1, 'limb, respiratory, and cardiac muscle dysfunction': 1, 'motor hand dysfunction': 1, 'Atrio-ventricular conduction Disease': 1, 'atrio-ventricular conductive disorders': 1, '(VA)': 1, 'atrio-ventricular nodal rhythm': 1, 'orejuela izquierda del atrio': 1, 'vertebral, anorectal, cardiac, tracheoesophageal, renal, and limb malformations': 2, 'atrio-ventricular inflow obstruction': 1, 'Atrio- Ventricular Clock': 1, 'and hand motor impairment': 1, 'HOS-1': 1, 'MNNG-HOS': 1, 'Atrio-ventricular conduction disorders': 4, 'dominant limb injuries': 2, 'VSGS': 3, 'Ventriculo subgaleal shunt': 1, 'Congenital ventriculo-atrial communication': 1, 'HOS-R': 1, 'HOS-CDX': 1, 'brain, cardiac, and limb malformations': 1, "sensory and/or motor dysfunction of the hand's fingers": 1, 'VNC': 1, 'upper limb-cardiovascular (Holt-Oram) syndrome': 1, 'Hand- Fuss-Syndrom': 1, 'atrio-ventricular-canal (avc) malformations': 1, 'hand neuromotor impairment': 1, 'os atrios': 1, 'AVV': 1, 'HOS 10': 1, 'HOS 12': 1, 'VD poderia': 1, 'AV-block III': 1, 'ventriculo esquerda': 1, 'del ventriculo izquierdo': 2, 'vertebral, anal, cardiac, tracheal, esophageal, renal, and limb (VACTERL) syndrome': 1, 'atrio-His jump': 2, 'HOS-C-AAC': 1, 'HOS-C': 1, 'HOS-AAC': 1, 'cardiac, scalp, and limb defects': 1, 'superior limb injury': 1, 'motor dysfunctions in the hand': 1, 'vertebral, cardiac, trachea-esophageal, renal, or limb defects': 1, 'Atrio-Ventricular(A-V) cushion abnormalities': 1, 'osteovascular limb injuries': 1, 'impaired sensibility of the hand': 1, 'abnormal hands or fingers': 1, 'VCP': 2, 'A-V conduction delay': 1, 'A-V stenosis': 1, 'joint injury of limbs': 1, 'atrio-ventricular disease': 1, 'VAS': 1, 'Impairment of one hand': 1, 'hand-dysfunction': 1, 'Holt-Oram/ulnar-mammary syndrome': 1, 'anomalies of the face, heart, and hands': 1, 'AV concordance': 1, 'atrio-ventricular (AV) delay': 1, 'atrio-ventricular discordant connection': 1, 'Ventriculo Izquierdo': 3, 'Ventriculo Izqueirdo': 1, 'Fraccion de Eyeccion del Ventriculo Izquierdo': 1, 'dilatacion severa del VI': 1, 'ischemic hand syndrome': 1, 'Hand Impairments': 2, 'injury to limbs': 1, 'atrio-ventricular canalHypoplastic': 1, 'hand motor area': 1, 'AV canal regurgitation': 1, 'impaired hand grip strength': 2, 'limb or cardiac ischemia': 2, 'impairments of hands': 1, 'impaired hands': 2, 'AV-conduction disorders': 1, 'Ventriculo-ventricular': 1, 'atrio-ventricular (AV) canal defects': 1, 'atrio ventricular and ventriculo-arterial discordance': 1, 'Big Hand Syndrome': 1, 'big hand syndrome":is': 1, 'AV conduction problems': 1, 'Hand-Heart Syndrome': 1, 'atrio-ventricular conduction defect': 3, 'cerebral, cardiac, intestinal or limb ischaemia': 1, 'facial, skull, limbs, cardiac, and cerebral malformations': 1, 'injuries to upper limb, lower limb and ophthalmic injuries': 1, 'and atrio-ventricular': 1, 'AV node block': 1, 'renal, cardiac and limb anomalies': 1, 'DSVE': 1, 'AV conduction defects': 3, 'Atrio-ventricular (AV) nodal conduction defects': 1, 'malformations (limbs, cardiac, and visceral)': 1, 'atrio ventricular primary block': 1, 'atrio-ventricular deformation': 2, 'congenital anomalies of the hands, feet, heart': 2, 'HOS tumorigenesis': 1, 'motor dysfunction of the hand': 2, 'atrio-ventricular block I': 2, 'atrio-oesophageal or atrial-pericardial fistula': 1, 'atrio- or intraventricular conduction anomalies': 1, 'HOS-tumor': 1, 'Ventriculo-direct atrial shunts': 1, 'VACTEL (vertebral, anal, cardiac, trachea-esophageal, and limb) syndrome': 1, 'Hand Hygiene 1': 1, "autosomal-dominant 'heart-hand' condition": 1, 'MMNG HOS transforming gene': 2, 'Ventriculo-radial dysplasia': 2, 'abnormalities of the hand and upper': 1, 'impaired HGS': 1, 'limb and cardiac malformation': 1, 'Heart-hand syndrome type 3': 1, 'ventriculo-arterial malformation': 1, 'VVS': 1, 'Ventriculo-Vesicle Shunt': 1, 'ventriculo-vesicle shunt': 1, 'VD nesta doenca rara': 1, 'VD nessa rara doenca genetica': 1, 'SLPLVD': 1, 'limb or forepaw injury': 1, 'motor impairment of the nondominant hand': 1, 'Duane-Radial-Ray and Holt-Oram syndromes': 1, 'injury to either limb': 1, 'atrio-ventricualr block': 1, 'AV conduction abnormality': 2, 'impairments regarding hand strength and': 1, 'disfuncion severa de VD': 1, 'cardiac, skeletal, craniofacial, and limb defects': 1, 'limb and paw injuries': 1, 'impaired hand grip': 5, 'Dominant limb injuries': 1, 'malformations of the atrio-ventricular canal': 1, 'atrio-ventricular interruption': 1, 'or impaired hand': 1, 'impaired hand-steadiness': 1, 'weaker limb injury': 1, 'Limb or other injury': 1, 'pulmonary, cardiac, and upper limb loss of function': 1, 'hand abnormal flexion/': 1, 'Ventriculo atrial shunts': 1, 'injuries to the limb': 2, 'Hands - 1': 1, 'VD dilatado': 1, 'hand movement dysfunction': 1, 'No hand abnormalities': 1, 'AVNA': 2, 'cardiac, renal, eye, ear and limb malformations': 1, 'atrio-ventricular conduction impairments': 1, 'vertebral, anorectal, cardiac, tracheoesophageal, renal, limb malformation': 1, 'atrio-vetricular blocks': 1, 'thick limb injury': 2, 'limb, cardiac, and/or craniofacial malformations': 1, 'atrio His delay': 1, 'VAB': 1, 'Cervico-oculo-acusticus syndrome': 2, 'atrio-ventricular conduction decelerating': 1, 'Ventriculo-cysto': 1, 'limb denervation injury': 1, 'atrio-His (AH) jump': 2, 'Ventriculo-cardiac shunt': 1, 'AVR': 1, 'cord, urologic, and limb anomalies vertebral ano-rectal cardiac tracheo-esophageal renal limb': 1, 'Holt-Oram (Harris-Osborne) syndrome': 1, 'AVB) type 1': 1, 'atrio-ventricular block (': 1, '-motor hand dysfunction': 1, 'limb, oralfacial, and cardiac malformations': 1, 'AV Wenkebaching': 1, 'impaired atrio-ventricular (AV) conduction': 1, 'AV node': 1, 'AV Wenckebaching': 1, 'AV Wenckebach phenomenon': 1, 'impaired AV conduction': 1, 'Atrio-ventricular (AV) Block': 1, 'AVPD': 1, 'limb and cardiac malformations and conduction defects': 1, 'ventriculo-arterial junction abnormalities': 1, 'loss of VA conduction': 1, 'hand-finger-syndrome': 1, 'atrio - ventricular block': 2, 'Holt-Oram ("heart-hand") syndrome': 1, 'Vertebral, Anal, Cardiac, Tracheo-Esophageal, Renal, and Limb defects': 1, "cervico-oculo-acoustic (Wildervanck's) syndrome": 1, 'impaired hand stereognosis': 1, 'atrio-ventricular block II': 1, 'hand sudomotor dysfunction': 1, 'atrio ventricular defect': 1, 'Sequelae of limb injuries': 1, 'atrio-ventricular Wenckebach': 1, 'Dysfunction of the hand': 1, 'Cyanotic hands syndrome': 1, 'atrio-ventricular murmur': 1, 'Zancolli hand impairment': 1, 'hind-limb injuries': 1, 'Hypothenar hand syndrome': 1, 'Hoty-Oram syndrome': 1, 'cardiac, craniofacial, skeletal and limb defects': 2, 'atrio-oesophogeal fistula': 1, 'Atrio-oesophageal fistulae': 2, 'Atrio-oesophageal Fistulae': 1, 'facial, limb, and cardiac defects': 1, 'cardiac, renal, intestinal, limb defects': 2, 'Ventriculo-peritonea;l': 1, 'DDFVE': 1, 'FEVE foi': 1, "hand's abnormalities": 1, 'cardiac and limb ischaemia': 1, 'cardio-ventriculo-cerebral" infarction': 1, 'cardiac, orofacial and limb reduction defects': 1, 'limb, rib and cardiac defects': 1, 'cervico-oculo-auditory dysplasia': 1, 'cardiac and limb muscle defects': 1, 'atrio-ventricular rhythm': 1, 'hand performance impairment': 1, 'Hand dexterity impairment': 1, 'Holt-Oram syndrome11': 1, 'dysfunctions of the hand': 1, 'ventriculo-coronary': 2, 'ft-hand syndrome': 1, 'Vertebral, cardiac, renal, and limb defects syndrome': 1, 'vertebral, cardiac, renal, and limb defects syndrome 1': 1, 'Holt-Oram (hand/heart) syndrome': 1, 'Osteosarcoma HOS': 1, 'atrio-ventribular block': 1, 'HOS-OSCs': 1, 'atrial and atrio-ventricular conduction disturbances': 1, 'Atrio-ventricular septum defects': 1, 'mangled injury of limb': 1, 'HMA': 1, 'post-APA': 1, 'APA': 1, 'ventriculos unicos': 1, 'atrio-ventricular displacement': 1, 'AV blockade': 1, 'cardiac and pectoral fin (limb) defects': 1, 'abnormalities in the hand': 1, 'atrio-ventricular and ventriculo-atrial block': 1, 'lateral limb injury': 1, 'HLI': 1, 'atrio-ventricular ischemic block': 1, 'AVF': 1, 'atrio-ventricular fascicle': 2, 'Holt-Qram syndrome': 1, 'Access-related hand dysfunction': 1, 'Holt--Oram syndrome': 1, 'cardiac, lung, craniofacial, and limb defects': 1, 'impairment of hand strength': 1, 'Mobitz type 2 AV block': 1, 'cardiac, tracheoesophageal, renal, and limb abnormalities': 1, 'impairments in hand strength and dexterity': 1, 'Vertebral, Cardiac, Renal, and Limb defects syndrome type 2 and 1': 1, 'Ventriculo-coronary': 2, 'Hind-limb injury': 1, '1 , 2 and 3 AV block': 1, 'arterial abnormalities of the hand': 1, 'cardiac and/or limb ischaemic problem': 1, 'Ventriculos alios': 1, 'anomaly of atrioventricular or ventriculo-arterial connection': 1, 'Holt:Oram syndrome': 1, 'hand related abnormalities': 1, 'hand-related abnormalities': 1, 'isolated hand abnormalities': 1, 'Bilateral Limb Injury': 1, 'Unilateral Limb Injury': 1, 'left limb injury': 1, 'vasospastic syndromes of the hand': 1, 'cardiac (C) and limb defects': 1, 'Goldenhar, Wildervanck, and Hanhart syndromes': 1, "Holt's disease": 1, 'ventriculo-aortic functional disturbances': 1, 'malformations of the limbs, urogenital, craniofacial, and cardiac areas': 1, 'BAV': 1, 'heart/hand syndromes': 1, 'atrio-ventricular Block': 1, 'Centenarian hand syndrome': 1, 'K-HOS tumor': 1, 'K-HOS': 1, 'injury on limbs': 1, 'Roux limb injury': 1, "Cervico-oculo-acusticus (Wildervanck's) syndrome": 1, 'cervico-oculo-acousticus syndrome': 1, "Cervico-Oculo-Acousticus (Wildervanck's) syndrome": 1, 'HOS-MNNG tumors': 1, 'Ventriculo-bulbar malformations': 1, 'and limb injuries': 2, 'ventriculo izquierdo hipoplasico': 1, 'cardiac (Holt-Oram syndrome': 1, 'ventriculo-arterial uncoupling': 1, 'Ventriculo-arterial uncoupling': 1, 'HOS disease': 1, 'impairment of hand-steadiness': 1, 'Vertebral, Anorectal, Cardiac, Tracheo-Esophageal, Renal, and Limb defects': 1, 'injuries to a limb': 1, 'atrio/ventricular blockade': 1, 'MI-AE': 1, 'massa do ventriculo esquerdo': 1, 'MVE': 1, 'Impairment of nonlinguistic hand movements': 1, 'hand movements:1.0': 1, 'Cleft hand type 1': 1, 'Atrio-digital dysplasia with anemia': 1, 'os ventriculos': 1, 'distal hand impairment': 1, 'atrio-ventricular delayed': 1, 'atrio-ventricular desynchrony': 2, 'Cardiac, fin, and limb defects': 1, 'Cervico-oculo-Acoustic syndrome': 1, 'ventriculo-aortic fistula': 1, 'limb swelling or injury': 1, 'hand dysfunction and': 1, 'NCVE': 1, 'NCVE nao e congenita em': 1, 'Atrio-Ventricular (AVB) block': 1, 'abnormal hand position': 2, 'HHD-1': 1, 'neural tube, cardiac, oro-facial/craniofacial, and skeletal and limb malformations': 1, 'atrio-ventricular septum defect': 2, '11-HOS': 1, 'HOS 9': 1, 'hand strength impairment': 1, 'HOS-CasI': 1, 'AV node blocks': 1, 'facial and hand abnormalities': 1, 'atrio/': 1, 'hand grip impairment': 2, 'limb-related injury': 1, 'Atrio-pulmonary': 1, 'AP': 1, 'atrio-pulmonary': 1, 'Heart-Hand" syndrome': 1, 'Heart-hand" syndrome': 1, 'impairment of hand agility': 1, 'atrio-ventricular node blockade': 1, 'limb paediatric injuries': 1, 'muscle Heart-hand syndrome': 1, 'Compartmental syndrome of the hand': 1, 'hand lodge syndrome': 1, 'cardiac, tracheoesophageal, renal and limb defects': 1, 'heart and hand anomalies': 1, 'external joint limb injury': 1, 'calcification of the AV-node': 1, 'atrio-ventricular valve cleft': 1, 'atrio-ventricular valvular cleft': 1, 'vertebral, cardiac, trachea-esophageal, renal, and limb malformations': 1, 'limb, CNS and cardiac malformations': 1, 'atrio-ventricular conduction problems': 1, 'ventriculo-arterial asymmetry': 1, 'V-A gap': 1, 'hypoplasia of the AVJ': 1, 'AVN artery': 1, 'atrio-ventricular junction hypoplasia': 1, 'Ventriculo-Atrial Shunts': 1, 'junctional atrio-ventricular (AV) rhythm': 1, 'defect of the inter atrio-ventricular septum': 1, 'CMA Hand Impairment': 1, 'vertebral, anal, cardiac, tracheo-esophageal, renal and limb malformations': 1, 'tetraplegic hand dysfunction': 1, 'motor impairment of hand grasping': 1, 'Heart in Hand': 1, 'VC connections': 1, 'hand-heart syndromes': 1, 'impaired dexterity of the hand': 1, 'thrombectomie atrio-cave': 1, 'Holt-Oram syndrome conduction system defects': 1, 'DDVI': 1, 'atrio-cava': 1, 'Motor dysfunctions of the hand': 1, 'hands impaired': 1, 'SLG-VE': 1, 'SLG-AE': 1, 'neuromotor hand dysfunction': 1, 'Atrio ventricular block': 1, 'atrio ventricular nodal block': 1, 'eccentric limb injury': 1, 'Displasia arritmogenica do ventriculo direito': 1, 'ventriculo megaly': 1, 'atrio-pulmonary anastamosis': 1, 'disfuncao diastolica do ventriculo esquerdo': 1, 'AV block.8': 1, 'AV block.3': 1, 'sensory and motor dysfunction of hand': 1, 'dysfunction of hand movement': 1, 'AV nodal artery': 1, 'AV nodal artery disease': 1, 'Holt and Oram syndrome': 1, 'limb extremity injuries': 1, 'hand sensory and motor dysfunction': 1, 'TREATMENT OF ATRIO-VENTRICULAR BLOCK': 1, 'Atrio-ventricular alterations': 1, 'cardiac, intestinal, renal, intracranial, and limb anomalies': 1, 'HOS-MNNG tumours': 1, 'atrio-ventricular partial block': 1, 'non-Holt-Oram syndrome': 1, 'limb injuried': 1, 'neurological, craniofacial, cardiac, and limb malformations': 1, 'hand movement syndrome': 1, 'Ventriculo-Peritonial Shunt': 1, 'Atrio-pulmonary connection': 1, 'cardiac, tracheal, renal, limb malformations': 1, 'Holt- Oram-Syndrome': 1, 'Ventriculo-arterial malpositions': 1, 'ventriculo-arterial malposition': 1, '-limb apophyseal injuries': 1, 'dysfunction of hand activity': 1, 'AVH': 1, 'AV hysteresis': 1, '-limb and cardiac malformations': 1, 'facial/hand abnormalities': 1, 'ventriculo-subdural fistula': 1, 'Atrio-ventricular septum defect': 1, 'atrio-ventricular (AV) connection': 1, 'facial, limb, cardiac, and digestive tract abnormalities': 1, 'unaffected limb injury': 2, 'Atrio Ventricular Block': 1, 'Wenckebach atrio-ventricular block': 3, 'fraccion de eyeccion del VI': 1, 'atrio- and intraventricular conduction disorders': 1, 'impaired hand sensibility': 1, 'of atrio-ventricular conduction': 1, 'Cervico-oculo-facial dysmorphism': 1, 'atrio-ventricular III(0) block': 1, 'neurological, renal, craniofacial, cardiac and limb defects': 1, 'Chronic atrio-ventricular (AV)-block': 1, 'hypopyon Hand movement 1': 1, '(A-V) annuli': 1, 'atrio-ventricular (AV) accessory': 1, 'cardiac, limb, renal or vertebral malformations': 1, 'cardiac, limb, renal and vertebral malformations': 1, 'ME AV LAX': 1, 'Holt-Oram and': 1, 'Abnormality of the hand': 2, 'NAVc': 1, 'AV-blockade III': 1, 'atrio-ventricular (AV) blockade': 1, 'AV-blockade': 1, 'hand steadiness impairment': 1, 'Ventriculo-arterial connection anomalies': 1, 'DVP': 1, 'derivation ventriculo-peritoneale': 1, 'canal atrio-': 1, 'FEVE maior': 1, 'ventriculos maiores': 1, 'AHP': 1, 'HOS/I': 1, 'HOS/C': 1, 'injury to the limb': 1, 'cardiac tracheoesophageal renal and limb anomalies': 1, 'atrio-ventriculare blockade': 1, 'ventriculo izquierdo (VI)': 1, 'atrial, atrio-ventricular and intraventricular conduction disorders': 1, 'hand and foot heart heat': 1, 'neuronal dysfunction of hand motor cortex': 1, 'Heinke type 1 radial club hand': 1, 'Atrio-acro-renal syndrome': 1, 'hand-for syndrome': 1, 'cardiac, limb and vertebral malformations': 1, 'impairment of a hand': 1, 'atrio-ventricular sepal defect': 1, 'atrio-ventricular blocked': 1, 'cAVB': 1, 'Hand-motor impairment': 1, 'limb, cardiac, central nervous system and tracheal malformations': 1, 'HOS St': 1, 'vertebral, cardiac, renal, and limb defects syndrome 2': 1, 'hand dexterity impaired': 1, 'vertebral, cardiac, renal and limb defects syndrome 2': 2, 'DiGeorge-, Noonan-, Holt-Oram syndromes': 1, 'arterial and venous limb injury': 1, 'cardiac, renal, gastrointestinal and limb defects': 1, 'Ventriculo-encephalitis': 1, 'Isolated hand/fingers palsy': 1, 'isolated hand/fingers palsy': 1, 'ventriculo-atrial Wenckebach': 1, 'atrio-ventricular or sino-atrial blocks': 1, 'WILDERVANCK': 1, 'atrio--ventricular conduction impairment': 1, 'Congenital cardiac, renal, limb, and ear-related defects': 1, 'Vertebral, cardiac, renal, and limb defects': 1, 'vertebral, cardiac, renal, and limb defects': 1, 'Holt-Oram syndrome with chromosomopathy': 1, 'Hand dysfunctions': 1, 'heart Heart-hand syndrome': 1, 'Impairment of hand movement': 1, 'atrio-oesphageal fistulation': 1, 'ventriculo-atrial Wenckebach block': 1, 'Atrio-ventricular blockAsthma': 1, 'Motor impairment at the hand': 1, 'VSD Holt-Oram syndrome': 1, 'ORS': 1, 'Handedness Impaired Hand': 1, 'Ventriculo-caval shunts': 1, 'joint or limb injury': 1, 'atrio-esophageal ulceration': 1, 'impairment of hand performance': 1, ', cardiac, tracheo-esophageal, renal, and limb': 1, 'AAC': 1, 'Atrio-Atrial Connections': 1, 'atrio-atrial connection': 1, 'cardiac, craniofacial skeletal or limb defects': 1, 'impairments to the injured hand': 1, 'motor hand impairments': 1, 'VF) AP': 1, 'ventriculo-fascicular': 1, 'VF AP': 1, 'VF': 1, 'cardiac, limb and scalp abnormalities': 1, 'limb, cardiac, CNS and tracheal malformations': 2, 'Isolated limb injuries': 1, 'Isolated Limb Injuries': 1, 'ventriculo-venous communications': 1, 'VVC': 1, 'Ventriculo-venous communications': 1, 'Hand to Heart': 1, 'hand to heart': 1, 'AVJ-abl': 1, 'AVB III': 1, 'hand movement impairments': 1, 'syndrome of hand': 1, 'HNNA': 1, 'Cardiac, CNS, and limb': 1, 'cardiac, renal, and limb anomalies': 1, 'cardiac, trachea-esophageal, and limb anomalies': 1, 'cardiac, and limb anomalies': 1, 'cardiac and limb ischemia syndromes': 1, 'vertebral, cardiac, renal and limb malformations': 1, 'ventriculos laterais': 1, 'discordant VA': 1, 'VA connection': 1, 'VA connection in situs solitus': 1, 'impairment of hand': 1, 'ventriculo:annular disproportion': 1, 'atrio-ventricular (AV) canal defect': 1, 'atrio-ventricular blockAtrial': 1, 'AV-conduction abnormalities': 1, 'ventriculo-subarachnoid infections': 1, 'isolated difficulty with hand movements': 1, 'Atrio-Ventricular Canal Defect': 1, 'Vertebral, cardiac, renal and limb defects syndrome': 1, 'cardiac and lower-limb ischemia': 1, 'MNNG HOS transforming gene': 1, 'V-A': 1, 'biomechanical abnormalities of the hand': 1, 'and ventriculo-arterial discordance': 1, 'Luciani-Wenckebach atrio-ventricular block': 1, 'atrio block': 1, 'atrio-pulmonary Fontan': 1, 'AV nodal injury': 1, 'Hand Syndromes': 1, 'THERAPY OF TOTAL ATRIO-VENTRICULAR BLOCK': 1, 'AV disturbances': 1, 'atrio-ventricular valvulogenesis': 1, 'AV valve defects': 1, 'cardiac, digestive and limb anomalies': 1, 'cervico-oculo-acusticus syndrome': 2, 'anomalies of the atrio-ventricular valves': 1, 'Atrio-ventricular-block': 1, 'Holt-Oram syndromeQ12': 1, 'Holt-Oram syndromeQ4': 1, 'A-V)': 1, 'Wildervanck-Syndrom': 1, 'III A-V block': 1, 'Hand motor dysfunctions': 1, '/impaired hand movement': 1, 'limb diseases or injuries': 1, 'Ventriculo-pulmonary fistula': 2, 'Impaired hand abilities': 1, 'AV conduction impairment': 1, 'atrio-ventricular valve malformations': 1, 'atrio-ventricular (a-v) blocks': 1, 'familial or sporadic HOS': 1, 'Autosomal dominant Holt-Oram syndrome': 1, 'atrio-ventricular (AV) junctional': 1, 'atrio-ventricular systole': 1, 'limb or extremity injuries': 1, 'craniofacial, limb and cardiac anomalies': 1, 'heart-hand disease': 1, 'Ventriculo-atrial (VA) shunts': 1, 'rare heart-hand syndrome': 1, 'injuries of the limbs and': 1, 'ventricular-atrio': 1, 'ventriculo-atrial or atrio-ventricular block': 1, 'atrio-ventricular endocardial': 1, 'obstruction of atrio-ventricular blood flow': 1, 'impairment in atrio-ventricular conduction': 1, 'ATRIO-VENTRICULAR': 1, 'deterioration of hand movements': 1, 'deterioration of hand movement': 1, 'congenital and acquired atrio-ventricular blocks': 1, 'Holt Oram disease': 1, 'Atrio-ventricular disorders': 1, 'LH': 1, 'HOS-MNNG': 1, 'II AV block': 1, 'Ventriculo-ureteral (VU) shunts': 1, 'Limb Fracture Injuries': 1, 'impaired hand motor': 1, 'pulmonary, cardiac and limb abnormalities': 1, 'pulmonary, cardiac and limb disorders': 1, 'Useless Hand Syndrome': 1, 'K-HOS tumours': 1, 'hands impairment': 1, 'atrio-ventricular canal (AVC) defect': 1, 'short limb and cardiac malformations': 1, 'Ventriculo-atrial fistulas': 1, 'abnormalities of hands and': 1, 'ventriculo-atrial mal-alignment anomaly': 1, 'ventriculo megalia': 1, 'FEVE menor': 1, 'limb and cardiac ischaemia': 1, 'Atrio ventricular canal defect': 1, 'Familial Holt-Oram syndrome': 1, 'torso and limb injuries': 1, 'vertebral, anorectal, cardiac, tracheoesophageal, renal, limb': 1, 'combined anomalies of the heart, lung, kidney, ipsilateral hand and foot': 1, 'Hand Impairement': 1, 'hand-heart disease': 1, 'LMNA Heart-hand syndrome': 1, 'heart-hand anomalies': 1, 'Ventriculo-orbital fistula': 1, 'ventriculo-orbital fistula': 1, 'cardiac, renal, and limb defects syndrome 2': 1, 'cardiac, renal and limb defects syndrome 2': 1, 'atrio-ventricular canal defect-': 1, 'sino-atrial and atrio-ventricular conduction disturbances': 1, 'VD) hipertrofiada': 1, 'motor-hand impairment': 1, 'Motor-hand impairment': 1, 'hand and general motor impairment': 1, 'AI y VI': 1, 'eyeccion del VI': 1, 'del VI': 1, 'TSVD': 1, 'Atrio-Ventricular Dyssynchrony': 1, 'abnormalities of the hands, feet or heart': 1, 'abnormalities of the hands, feet, spine or heart': 1, "Holt's Diseases of Infancy": 1, 'ventriculo-aortic lesions': 1, 'or atrio-ventricular dyssynchrony': 1, 'Should-hand syndrome': 1, 'VV': 1, 'atrio-ventricular branch': 1, 'dysfunctional hands': 1, 'REHABILITATIONHolt-Oram syndrome': 1, 'injuries to limb(s)': 1, 'impair hand movement': 1, 'do ventriculo esquerdo': 1, 'cardiac, limb': 1, 'injuries of the limb joints': 1, 'Impair Hand': 1, 'Disordersof cardiac rhythm and atrio-ventricular conduction': 1, 'limb, ear, cardiac, and gastrointestinal malformations': 1, 'cardiac, vertebral, and limb abnormalities': 1, 'impairment of hands': 1, 'tachy-long-AH': 1, 'Isolated Hand movements': 1, 'Familial atrio-ventricular block': 1, 'or hand motor impairment': 1, 'Ventriculo-Atrial (VA)': 1, 'Holt-Oram and Okihiro syndromes': 1, ', cardiac as well as limb defects': 1, 'dLower limb injuries': 1, 'cardiac or limb malformations': 1, 'congenital heart and hand anomalies': 1, 'cardiac, and limb malformations': 1, 'ventriculo-subarachnoid fistulas': 1, 'impairment of hand movement': 1, 'atrio-ventricular node developmental anomalies': 1, 'ventriculo-arterial malformations': 1, 'injury of limb': 1, 'Hand-Fuss-Syndroms': 1, 'hand motricity impairments': 1, 'impaired hand abilities': 1, 'Ventriculo arterial discordance': 1, 'atrio ventricular-block': 1, 'Holt-oram Syndrome': 1, 'atrio-ventricular channel': 1, 'Vertebral, Cardiac, Renal and Limb Defects (VCRL) syndrome': 1, 'vertebral, cardiac, renal, and limb malformations': 1, 'cardiac, renal, limb, genitourinary and gastrointestinal defects': 1, 'atrio-ventricular (AV)-Block': 1, 'CNS, cardiac, renal, or limb defects': 1, 'atrio-venous malformation': 1, 'Hand pain and hand symptoms': 1, 'proximal limb injury': 1, 'hand disfiguration and dysfunction': 1, 'Developmental abnormalities of the hands': 1, 'finger and hand abnormalities': 1, 'J--holt-oram syndrome': 1, 'vertebral, anorectal, cardiac, renal, limb, and urogenital malformations': 1, 'cardiac and hand abnormalities': 1, 'Impairment of the hand': 1, 'motor dysfunction of hand': 1, 'cervico-oculo-acoustic': 1, 'disturbances of atrio-ventricular conduction': 1, 'hand motor and oromotor dysfunctions': 1, 'heart and hand abnormalities': 1, 'hand-heart anomalies': 1, 'hand grip strength impairment': 1, 'ventriculo-ventricular delay': 1, 'abnormalities of the heart and hand': 1, 'atrio-ventricular first degree A-V block': 1, 'A-V B': 1}
|
atrio-ventricular block
|
Disease
|
MESH:C535328
|
{'Carnosinemia': 8, 'carnosinase deficiency': 20, 'homocarnosinosis': 15, 'Serum carnosinase deficiency': 3, 'congenital carnosinase deficiency': 2, 'CARNOSINASE ACTIVITY': 1, 'carnosinemia': 20, 'deficiency of carnosinase': 2, 'Homocarnosinosis': 14, 'Plasma carnosinase deficiency': 1, 'Carnosinase deficiency': 2, 'plasma carnosinase deficiency': 1, 'Carnosinase-Related Diseases': 1, 'serum carnosinase deficiency': 6, 'carnosinase enzyme deficiency': 1, 'deficiency of homocarnosinase': 1, 'Serum-carnosinase deficiency': 1}
|
carnosinase deficiency
|
Disease
|
MESH:C535330
|
{'CHLS': 8, 'LCS': 409, 'M-LCS': 1, 'Aagenaes syndrome': 32, "Aagenaes' syndrome": 1, 'LCS-': 2, 'LCS-2019': 2, 'LDCT-LCS': 2, 'lymphedema-cholestasis syndrome': 5, 'Lymphedema-cholestasis syndrome': 3, 'L4-5 LCS': 1, 'EPAD-LCS': 2, 'Lymphedema cholestasis syndrome 1': 2, 'lymphedema and cholestasis': 1, 'lymphedema cholestasis syndrome 1': 4, 'CHLS-TB': 1, 'CHLS-': 1, 'LCS1/Aagenaes syndrome': 2, 'LCS fistulas': 1, 'LCS disability': 1, 'LCS1': 7, 'S-LCS': 1, '-LCS': 4, 'lymphedema cholestasis syndrome': 4, 'LCS_HCC': 1, 'LCS-HCC': 1, 'LCS Carcinoma': 1, 'IDCS LCS': 1, 'Lymphedema Cholestasis Syndrome': 1, 'cholestasis lymphedema syndrome': 1, "Aagenaes's syndrome": 2, 'LCS injury': 1, 'LCS-1 toxicity': 1, 'LCS disease': 1, 'familial cholestasis Malaria Aagenaes syndrome': 1, 'Cholestasis-lymphedema syndrome': 1, 'ASD LCS': 1, 'LCS OF SMOKE': 1, 'LCS RP': 1, 'LCS 8': 1, 'Cholestasis-lymphedema': 2, 'LCS;5': 1, 'LCS;3': 1, 'cholestasis-lymphedema syndrome': 2, 'NSCLC LCS': 1, 'Aagenaes (cholestasis-lymphedema) syndrome': 1, 'Aagenes syndrome Lymphedema cholestasis syndrome 1': 1, 'lymphedema cholestasis syndrome1': 1, 'aagenaes syndrome': 1, 'Cholestasis lymphedema syndrome': 1, 'Aagenaes Syndrome': 2, 'LCS death': 1, 'DePuy Synthes LCS': 1, 'lymphedema cholestasis syndrome 1/': 1, 'lymphedema-cholestasis': 1, 'Aagenaes disease': 1, 'CPS LCS': 1, 'LPR-LCS-01': 2, 'Manifesting Lymphedema-Cholestasis Syndrome': 1, 'Lymphedema cholestasis syndrome': 2, 'LCS leakage': 1, 'LCS-PFA': 1, 'LCS UK 5': 1, 'LCS India': 1, 'LCS-Uro': 1, 'Lymphedema Cholestasis Syndrome 1/': 1, 'Lymphedema Cholestasis Syndrome 1/Aagenaes syndrome': 1, 'ACS+LCS': 2, 'LCS CHR': 1, 'BETWEEN LCS': 1, 'CLS': 1, 'LCS-1': 1, 'CT-LCS-': 1, 'LCS I': 1, 'Aagenaes) syndrome': 1, 'GHS-LCS': 1, "Aagenae's syndrome": 1, 'Aagenaes, syndrome': 1, 'cholestasis-lymphedema': 1, 'LCS restriction': 1}
|
LCS
|
Disease
|
MESH:C535331
|
{'AAS': 305, 'Aarskog-Scott syndrome': 103, 'Aarskog-Scott Syndrome': 18, 'ASS': 8, 'AAS abuse': 15, "Aarskog's faciodigitogenital syndrome": 1, 'autosomal recessive faciodigitogenital syndrome': 2, 'faciodigitogenital syndrome': 9, 'Aarskog syndrome': 131, 'faciogenital dysplasia': 80, 'KHLS': 1, 'Faciogenital Dysplasia': 8, 'Aarskog Syndrome': 9, 'Facio-digito-genital Syndrome': 1, 'KIPC': 1, 'Faciogenital dysplasia': 13, "Aarskog's syndrome": 12, 'Faciodigitogenital (Aarskog-Scott) syndrome': 1, 'facio-genital dysplasia': 3, 'ORO-DIGITO-': 1, 'Aarskog and Rett syndromes': 1, 'faciogenital dysplasia 6': 1, 'FGD6': 1, 'aarskog (facial-digital-genital) syndrome': 1, 'FGDY': 16, 'Aarskog (facial-digital-genital) syndrome': 4, 'AAM-AAS': 1, 'Aarskog syndromes': 2, 'Aarskog Scott syndrome': 3, 'facio-digito-genital dysplasia': 3, 'Faciogenital dysplasia 1': 3, 'Faciodigitogenital syndrome': 3, 'Aarskog': 11, 'faciogenital abnormalities': 1, 'Aarskog-Scott and Teebi syndromes': 1, 'faciogenital dysplasias': 1, 'Fgd': 1, 'Digito-ocular phenomenon': 1, 'facio-digito-genital syndrome': 3, 'faciodigitogenital dysplasia': 1, 'AAS IV': 1, 'AAS I': 1, 'Aarskog syndrome 1': 1, 'KWS': 1, 'KWB': 1, 'faciogenital dysplasia 2': 1, 'Aarskog-scott syndrome': 4, 'faciogenital dysplasia gene': 1, 'AAS Dependence': 1, 'Aarskog-Scott and': 1, 'KOC': 2, 'AAS poderia': 1, 'Aarskog-Scott': 2, 'Aarskog-Scott syndrome (': 1, 'digito-talar dysmorphism': 1, 'FGD': 5, 'AAS-abuse': 1, 'AAS-C': 1, 'BUCCO-DIGITO-FACIAL DYSPLASIA': 1, 'Facio-digito-genital syndrome': 2, '(X-linked) Aarskog syndrome': 1, 'AAS Worry': 1, 'KHC': 1, 'Aarskog (facio-digital-genital) syndrome': 1, 'KHN': 1, 'AARSKOG-SCOTT SYNDROME': 1, 'FACIOGENITAL SYNDROME': 1, 'AAS dependence': 2, 'Aarskog-like': 1, 'AAS & ZM': 1, 'AAS Abuse': 1, 'AARSKOG-syndrome': 1, 'digito-atrial dysplasia': 1, 'faciogenital dysplasia-associated': 1, 'KMGC': 2, "Aarskog's": 1, 'Faciogenital Dysplasia 1': 1, 'FGD1': 1, 'Aarskog-Skott syndrome': 2, 'oligodendroglioma;AAS': 1, 'KFCF': 1, 'KNMSP': 2, 'Aarskog-like phenotype': 1, 'Faciogenital Dysplasia 5': 1, 'AAS-': 2, 'AAS addiction': 2, "Aarskog's facio-digital-genital syndrome": 1, 'KWH': 1, 'rheumatoid AAS': 3, 'Ulnar hypoplasia Aarskog': 1, 'AAS\\1': 1, 'Aarskog facial-digital-genital syndrome': 1, 'facio-genital dysplasia-5': 2, 'KU': 4, 'Aarskog-Scott syndromeallelic': 1, 'faciogenital dysplasia 1': 2, 'pAAS': 1, 'AAS anxious': 1, 'Aarskog-syndrome': 1, 'Digito-palatal syndrome': 1, 'X-linked Aarskog syndrome': 1, 'AASNUs': 1, 'AASU': 1, 'HAP-AAS': 2, 'Aarskog Scott Syndrome': 1, 'KD': 1, 'DINOFLAGELLATE SPECIES FROM KUWAIT': 1, 'X-linked AAS': 2, 'AAS syndrome': 3, 'facio-digital-genital dysplasia': 2, 'AAS Syndrome': 1, 'Kuwait fire': 1, 'KWT': 1, 'KUWAIT': 1, 'Aarskog-Scott syndrome:1:25,648': 1, "Aarskog-Scott's faciogenital dysplasia syndrome": 1, 'Neuro-facio-digito-renal syndrome': 1, 'facial-digital-genital (Aarskog) syndrome': 1, 'FGD5': 2, 'faciogenital dysplasia-5': 1, 'AAS_A': 1, 'AAS instability': 1, 'skeletal dysplasia FGDY': 1, 'FGDY skeletal defects': 1, 'AAS III': 1, 'X-linked faciogenital dysplasia': 1, 'Aarskog and': 1, 'aarskog syndrome': 1, 'nephrosis Renal Agenesis Aarskog': 1, 'A AAS': 1, 'B AAS': 1, 'facial-digital-genital or Aarskog syndrome': 1, 'Aarskog(-Scott) syndrome': 1, 'Fgd1': 1, 'dicotico de digitos': 1, 'Aarskog- Scott syndrome': 1, 'AAS cardiomyopathy': 1, 'X-linked form of AAS': 1, 'Aarskog (facio-digito-genital) syndrome': 1, 'Ku': 1, 'faciogenital dysplasia 3': 2, 'FacioGenital Dysplasia': 1, 'Facio-Genital Dysplasia': 1, 'KDFCA': 1, 'Faciogenital dysplasia 5': 1, 'AS': 1, 'FGD3': 1}
|
AAS
|
Disease
|
MESH:C535332
|
{'myocardial or other abnormalities': 1, 'cardiac or other abnormalities': 10, 'skeletal and other abnormalities': 6, 'Other Disorder': 4, 'stiffness in other joints': 3, 'externalizing (and other) disorders': 1, 'other disorders': 49, 'to joints and other': 1, 'Other defect': 1, 'OTHER SYSTEMS': 2, 'soreness in other joints': 1, 'injury to other joints': 4, 'Other disorders': 15, 'other disorder': 12, 'defect of embryogenesis or other abnormalities': 1, 'OTHER CENTRAL': 1, 'OTHER DISORDERS': 20, 'genital and other coexisting anomalies': 1, 'Other disorder': 29, 'haematological and other clinical disorders': 1, 'HSO': 1, 'sore areas other than joints': 1, 'TLE-other disorder': 1, 'other abnormal movements': 4, 'cardiac and other abnormalities': 3, 'swelling in other joints': 8, 'other abnormalities': 11, 'Other general disorder': 1, 'Cardiac and other abnormalities': 1, 'OD': 2, 'Other Disorders': 23, 'neuronal and other developmental abnormalities': 2, 'Degenerative and other Joint problem': 1, 'Other joint disorder': 1, 'Other abnormalities': 4, 'other systemic disorders': 3, 'and other clinical abnormalities': 1, 'or other disorder or': 1, 'other birth defects': 1, 'and other abnormalities': 3, 'swelling of other joints': 1, 'OTHER FUNCTIONS OF': 3, 'other nuclear abnormalities': 1, 'ONA': 2, 'other noncardiac abnormalities': 1, 'or other disorder': 2, 'or other vascular abnormalities': 1, 'SAPS Other Disorder': 1, 'OMD': 2, 'and other disorders': 8, 'Epilepsy and other Disorders': 1, 'haematological and other abnormalities': 1, 'oral or other systemic disorders': 1, "other' disorder": 1, 'hip or other joint problem': 2, 'OJD': 2, 'OTHER SYSTEMIC SYNDROMES': 1, 'Aase-Smith syndrome': 11, 'other gland disorders': 1, 'other palate abnormalities': 1, 'abnormalities in other joints': 1, 'Comorbidity with Other Disorders': 2, 'lung, kidney, liver and other functional abnormalities': 1, 'Aase Smith syndrome': 1, 'OTHER DISORDERS OF': 1, 'cardiac, or other system abnormalities': 1, 'contractures of other joints': 6, 'contractures involving other joints': 1, 'Other Abnormalities': 1, 'sexual and other developmental abnormalities': 1, 'vascular or other abnormalities': 2, 'Delimitation from Other Disorders': 2, 'OTHER GENES': 2, 'hepatic or other systemic abnormalities': 1, 'cardiac, brain or other abnormalities': 1, 'renal, skeletal, and other abnormalities': 1, 'OTHER VARIATIONS': 1, 'Callosum Defect Other': 1, 'joint (or other) bleeds': 1, 'abnormalities of other': 5, 'dislocation of other': 1, 'emotional or other disorders': 1, 'or other abnormalities': 3, 'hip and other joint disease': 1, 'haematological and other biochemical abnormalities': 1, 'OHR': 3, 'dysfunction of other joint': 1, 'SYNDROME OF OTHER ABNORMALITIES': 1, 'OTHER FUNCTIONS': 3, 'rythm abnormalities other': 1, 'joint, skeletal muscle, nerve or other diseases': 1, 'joint, and other infections': 1, 'OTH': 1, 'skeletal and other defects': 2, 'muscular and other disorders': 1, 'and other finger defects': 1, 'Skeletal and other abnormalities': 2, 'other abnormal': 1, 'dislocation of the other': 1, 'and other skeletal abnormalities': 1, 'platelet and other intravascular abnormalities': 1, 'radial, thumb or other skeletal abnormalities': 1, 'deformities in other joints': 1, 'spinal and other skeletal abnormalities': 1, 'and other system disorders': 1, 'or other abnormality': 1, 'Muscular and other abnormalities': 1, 'orofacial (and other) abnormalities': 1, 'abnormalities in other': 2, 'other extracardiac abnormalities': 1, 'other systematic abnormality': 1, 'joint and other bleeding': 2, 'other developmental abnormalities': 2, 'other systemic abnormalities': 2, 'abnormalities of posterior alpha and other EEG rhythms': 1, 'kidney, liver, and other systemic diseases': 1, 'endocrinological, cardiac, and other system abnormalities': 1, 'hand and other joints': 1, 'Aase-Smith syndrome 1': 1, 'and other joint arthroplasties': 1, 'Other Defects': 3, 'limb abnormalities other': 1, 'syndromic with other abnormalities': 1, 'other physical abnormalities': 1, 'or other disorders': 2, 'facial, thumb and other abnormalities': 1, 'Vertebral and other abnormalities': 1, 'spinal and other joint degeneration': 1, 'cardiac, cutaneous and other systemic abnormalities': 1, 'liver, renal, and other endocrinological abnormalities': 1, 'abnormalities other than genital tract': 1, 'OM OBD': 1, 'and other systemic disorders': 1, 'fractures of joints other': 1, 'other motor defects': 1, 'Bone, Joint and Other Disorders': 1, 'abnormalities of other systems': 1, 'OND': 2, 'erosions of other joints': 1, 'joint and other bleeds': 1, 'Aase-Smith type': 1, 'ocular and other abnormalities': 1, 'muscular or other disorders': 1, 'damage in other joints': 1, 'genital or other abnormality': 1, 'Birth defects Other': 1, 'OTHER FUNCTIONALS': 1, 'skeletal or other abnormalities': 1, 'and other defects': 1, 'swelling of any other joints': 1, ', legs, or other joints': 1, 'joint, muscle, neurological, and other diseases': 1, 'ADHD symptoms': 1, 'ADHD': 1, 'dislocation of the other facet': 1, 'Neurocognitive abnormalities Other': 1, "other' disorders": 1, 'axonal and other disorders': 1, 'skeletal system abnormality other than': 1, '(OT) defect': 1, 'spinal or other abnormalities': 1, "'other' disorder": 1, 'other joint': 1, 'dental and other oral abnormalities': 1, 'other joint anomaly': 1, 'other joint anomalies': 1, 'other major abnormalities': 1, 'skeletal, cranial and other developmental abnormalities': 1, 'other defects': 1, 'rhizarthritis of the other thumb joints': 1, 'or other cerebral abnormalities': 1, 'epilepsy and others) disorders': 1, 'hip or other limb abnormalities': 1, 'other arch obstruction': 1, 'systemic (or other ocular) disorders': 1, 'Other Joint Diseases': 1, 'OSD': 1, 'bilateral or other focal abnormalities': 1, 'Foot and other joint problems': 1, 'abnormalities of other vertebrae': 1, 'joint and other systemic disease': 1, 'OTHER ABNORMALITIES': 1, 'haematological or other disorder': 1, 'and other phenotypic abnormalities': 1, 'pituitary, other sellar, and juxtasellar abnormalities': 1, 'Others disorders': 1, 'Defective Self and/or Other Mentalising': 1, 'palatal and other related abnormalities': 1, 'back or other joints disorders': 1, 'other trophic abnormalities': 1, 'autonomic or other abnormalities': 1, 'developmental or other abnormalities': 1, 'joint, muscle and other bleeds': 1, 'radiographic abnormalities of other joints': 1, 'skeletal fracture other': 1, 'renal, skeletal or other abnormalities': 1, 'stiffness of other joints': 1, 'diseases of other joints': 1, 'Hepatic, renal and other system abnormalities': 1, 'skeletal and other': 1, 'Strangury disorders Other': 1, 'OG-g': 1, 'OG-': 1, ', other disorders': 1, 'Other joint symptom': 1, 'skeletal, dental, and other extraskeletal abnormalities': 1, 'cardiac or other physical abnormalities': 1, 'or other system abnormalities': 1, 'skeletal and other systemic disabilities': 1, 'other disease of the joints': 1, 'skin, joint, lung, vascular, and other abnormalities': 1, 'Aase-Smith Syndrome': 1, 'OTHER PAROXYSMAL DISORDERS': 1, 'other systems': 1, 'and other systemic defects': 1, 'OTHER DEFECTS OF': 1, 'cardiac or other complex abnormalities': 1, 'and other cerebral disorders': 1, 'Epilepsy and other disorders': 1, ', hip, or other joints': 1, 'OTHER CANDIDATE GENES SUGGESTED': 1, 'other disease abnormalities': 1, ', or other disorder': 1, 'ischemic or other abnormal myocardium': 1, 'disorders of other': 2, 'joint and other disorders': 1, 'OTHER FUNCTIONAL': 1, 'Disks with Other Abnormalities': 1, 'spinal and other abnormalities': 1, 'muscular, skeletal, or other disorders': 1, 'vertebral or other abnormalities': 1, 'central or other': 1, 'bone or other joint problems': 1, 'cardiac and other autonomic abnormalities': 1, 'cerebral, ocular or other systemic disorders': 1, 'or other clinical abnormalities': 1, 'vascular, cardiac and other systemic abnormalities': 1, 'other harm disorder': 1, 'OtherEating Disorders': 1, 'cerebral and other ultrasound abnormalities': 2, 'cardiac and other visceral abnormality': 1, 'gynaecological and other abnormalities': 1, 'ASS': 1, 'joint and other skeletal disease': 1, 'other glycemic disorders': 1, 'to other joints': 1, 'and Other Disorders': 3, 'cardiac, skeletal and other abnormalities': 1, 'OTHER disorders': 1, 'abnormalities of other electrolytes': 1, 'liver, kidney or other systemic diseases': 2, 'Contractures of other joints': 1, 'other tissue abnormalities': 1, 'other joints': 2, 'skeletal and other developmental abnormalities': 4, 'Hand abnormality Foot abnormality Joints contractures Neurological': 1, 'neuropsychological and other defects': 1, 'OTHER RARE DISORDERS OF': 1, 'neurodevelopmental and other abnormalities': 1, 'renal, hepatic or other systemic disorders': 1, 'ocular and other extrarenal abnormalities': 1, 'spinal and other skeletal abnormality': 1, 'OIJD': 1, 'Other Joint Disorders': 1, 'deformity of other joints': 1, '-motor and other abnormalities': 1, 'emotional and other disorders': 2, 'Other Granulomatous Disorders': 1, 'or other defects': 1, 'Other system defects': 1, 'OTHER INFANTILE': 1, 'tarsal or other joint abnormalities': 1, 'injuries in other joints of': 1, 'Sexual and other abnormalities': 1, 'vessel abnormalities other': 1, 'spine or other joint deformity': 1, 'oral and other systemic disorders': 1, 'and other) disorders': 1, 'callosal and other midline abnormalities': 1, 'abnormalities other': 1, 'OCAs': 1, 'other" disorder': 1, 'deformities of other joints': 1, 'OTHER DISLOCATIONS': 1, 'joint (and other organ) damage': 1, 'vitreoretinal and other ocular and skeletal abnormalities': 1, 'OBDs': 1, 'and other related abnormalities': 1, 'OTHER MOLECULAR FUNCTIONS': 1, 'injury to other lower extremity joints': 1, 'othere abnormalities': 1}
|
other disorders
|
Disease
|
MESH:C535334
|
{'gut dysfunction': 1058, 'Gut dysfunction': 81, 'ABCD': 1294, 'gut dysfunctions': 78, 'Gut Dysfunction': 33, 'GM dysfunctions': 1, 'ABCDE': 97, 'gut microbiome dysfunction': 4, 'ABCDE 81.82 -': 1, 'neurocytes': 3, 'ABCDs': 40, 'GOLD ABCD': 5, 'gut mucosa dysfunction': 3, 'neurocyte': 17, 'gut microbiota dysfunction': 19, 'Gut Dysfunction of the': 1, 'ABCD ectasia': 3, 'ABCD + E ectasia': 1, 'neurocyte damage': 4, 'gut-dysfunction': 5, 'Gut-dysfunction': 1, "ABCD's": 2, 'toxic gut syndrome': 2, 'ABCD of': 1, 'dysfunction of the gut': 12, 'AbCD??GHiJK?M': 1, 'ABCD IS diabetes': 1, 'neurocyte injury': 12, 'Gut dysfunctions': 3, 'ABCDs of Melanoma': 1, 'GM dysfunction': 9, 'neurocytic lesions': 1, 'non-ABCDE hepatitis': 3, 'ABCD Mnemonic': 1, 'Dysfunction of the gut': 6, 'ABCD diabetes': 2, "ABCDE'S": 1, 'neurocytic': 2, 'Neurocytic': 1, 'black lock, cell migration disorder syndrome': 1, 'ABCD syndrome': 11, 'NEUROCYTE': 1, 'Gut microbiota dysfunction': 1, 'abcd': 7, 'ABCD disease': 2, 'ABCD/E': 1, 'ABCD drugs': 1, 'Neurocytic lesions': 1, 'ABCDE-SE': 1, 'ABCD dysfunction': 1, 'Neurocyte Injury': 1, 'ABCD -': 1, 'ABCD-F.': 1, 'ABCD-F': 1, 'dysfunctions of the gut': 4, 'AR;ABCD syndrome': 1, 'ABCDE syndrome': 1, 'ABCDE Syndrome': 1, 'ABCD-GENE': 2, 'ABCDs of Moles & Melanomas': 1, 'ABCD lesion': 1, 'ABCDs.6': 1, 'gut cell injury': 1, '-ABCD': 1, 'Gut Dysfunctions': 1, 'ABCD-3': 1, 'ABCDE-Schema': 1, 'impairment of gut homeostasis': 2, 'AbCD': 1, 'Gut flora dysfunction': 1, 'oral and gut toxicity': 1, 'Dysfunctional gut': 1, 'cell migration disorder of neurocytes and deafness syndrome': 1, '-gut dysfunction': 2, 'guts dysfunction': 1, 'Gut Microbiota Dysfunction': 2, 'gut microbiota dysfunctions': 2, '-gut dysfunctions': 1, 'GM dysfunctioning': 1, 'neurocyte chromatolysis': 1, 'NCH': 2, 'VA-EPS[ABCD]n': 1, 'ABCD-stable': 1, 'PAP-ABCDE': 1, 'gut biome dysfunction': 1, 'gut dysfunction syndrome': 1, 'ABCD-': 3, 'ABCD"denomination': 1, 'dysfunction of gut peristalsis': 1, 'neurocyte dysfunction': 1, 'ABCD-E': 6, 'Cell migration disorder of the neurocytes': 1, 'neurocytic injury': 1, 'ABC ABCD': 1, 'gut metabolite dysfunction': 1, 'ABCD instability': 1, 'ABCDE UPS': 1, 'upper-gut dysfunction': 1, 'gut microflora dysfunction': 1, 'ABCD keratoconus': 2, 'gut permeability dysfunction': 1, 'Gut-Dysfunction': 1, 'pycnosis of neurocytes': 1, 'damage to neurocytes': 1, 'ABCD stage': 1, 'ABCD-M': 1, 'ABCD-E.': 3, 'ABCDs of Dignity': 1, 'Neurocytes Injury': 1, 'neurocytes injury': 1, 'oral and gut toxicities': 1, 'neurocytic damages': 1, 'ABCD 2017b': 1, 'Postdysenteric gut dysfunction': 1, 'Non-ABCDE hepatitis': 1, 'ABCD.There': 1, 'ABCD-NL': 1, 'ABCD-problems': 1, 'dABCD': 1, 'gut-associated dysfunction': 1, 'and gut dysfunction': 1, 'ABCD - SAT': 1, 'neurocytic dystrophy': 1, 'upper gut dysfunction': 1, 'dysfunction of the upper gut': 1, 'ABCDE of the trauma': 1, 'gut system dysfunctions': 1, 'dysfunction of gut': 1, 'KC-ABCD': 1, 'neurocytes injuries': 1, 'ABCD(2)': 1, 'gut cell necrosis': 1, 'ABCDs of melanoma-A': 1}
|
ABCD
|
Disease
|
MESH:C535336
|
{'sclerodactyly': 1344, 'Sclerodactyly': 219, 'bilateral sclerodactyly': 1, 'sclerodactyly of': 4, 'puffy fingers or sclerodactyly': 1, 'Sclerodactyly of the': 1, 'sclerodactyly in': 1, 'Cutaneous Sclerodactyly': 2, 'Cutaneous Sclerodactyly': 1, 'sclerodactyly and': 1, 'Scleroderma type sclerodactyly': 1, 'sclerodactyly of the hands': 2, 'sclerodactyly,': 3, 'sclerodactyly 1': 1, 'sclerodactyly of the fingers': 3, 'Bilateral sclerodactyly': 2, 'sclerodactyly of fingers': 1, 'sclerodactylie': 2, 'digital sclerodactyly': 1, 'Sclerodactyly of the left hand': 1, 'sclerodactyly of the hand': 1, 'alopecia-sclerodactyly': 1, 'Cutaneous Sclerodactyly': 1, 'Distal extremities and finger sclerodactyly': 1, 'Syndrome of sclerodactyly': 1, 'SCLERODACTYLY': 3, 'S - sclerodactyly': 1, 'Sclerodactyly 2': 1, 'Skin Sclerodactyly': 1, 'stage III Sclerodactyly': 1, 'Sclerodactyly of the fingers': 1, 'of Sclerodactyly': 1, 'Sclerodactyly of the digits of the hand': 1, 'finger sclerodactyly': 1}
|
sclerodactyly
|
Disease
|
MESH:C535337
|
{'or type 18': 1, 'RCM type 2': 1, 'cataract 18': 2, 'arCC-2': 1, 'myocardial ischaemia.18': 2, 'disorders.18': 1, 'Fimbria type 18': 1, 'autosomal recessive congenital 2': 2, 'cataract-18': 1, 'autosomal recessive congenital cataract-2': 2, 'myocardial ischemia.18': 2, 'autosomal recessive cataract 18': 1, 'CTRCT18': 1, '18 disorders': 1, 'ABC type 18': 1, 'CATC2': 1, 'Type-18': 1, 'type 18': 1, 'RECESSION OF 2': 1, 'distal titinopathy,18': 1}
|
cataract 18
|
Disease
|
MESH:C535338
|
{'congenital total cataracts': 7, 'TS': 132, 'cytotoxicity.40': 2, 'TLS:213': 1, 'TLS:219': 1, 'TLS:107': 1, 'TP': 296, 'TPIAT': 1, 'TOTAL': 806, 'emotional, conduct and total': 2, 'TG': 191, 'TAUC': 3, 'total': 359, 'seizures.40': 5, 'T-AOC': 551, 'TA': 79, 'TD': 209, 'TLS': 96, 'TIC': 228, 'SLIGHT': 12, 'TTP': 1, 'TC': 242, 'TLH': 196, 'congenital hypoplasia': 133, '40': 65, 'TDS': 52, 'Slight impairment': 16, 'X-linked congenital bleeding disorder': 36, '20/40 or worse': 12, 'genotoxicity Red 40': 1, 'GTSs': 1, 'Total and': 2, 'TB': 122, 'TAA': 69, 'PTF': 2, 'TM': 13, 'TFE': 1, 'MIMS TN': 1, 'NA1.40': 1, 'tOC': 8, 'Slight': 50, 'CCT': 244, 'PIT': 1, 'TWM': 1, 'HE': 7, 'TEP': 241, 'e-TEP': 2, '-TEP': 7, 'TES': 13, 'tumors.40': 7, 'total obstruction': 3, 'TAOC': 18, 'TT': 491, 'TV': 79, 'Rhizoma drynariae total flavonoids': 1, 'RDTF': 1, 'TDP': 21, 'TPE': 15, 'TCS': 21, 'damage in area 40': 1, 'CT': 18, 'toxicity.40': 3, 'TLPD': 12, 'Total': 79, 'TNS': 38, 'TLTG': 18, '-NEWDEAL TOTAL METATARSOPHALANGEAL': 1, 'Total cavopulmonary connexion': 1, 'X linked congenital cataract': 1, 'HT': 26, 'impairment in total': 1, 'TMS': 46, 'TIV': 1, 'TIA': 4, 'TL': 147, 'Slight leaf mosaic': 1, 'RA-TLH': 1, 'TAC': 99, 'TFC': 68, 'autism-40': 1, 'TBC': 3, 'TE': 72, 'Cutaneous 40': 2, 'TBP': 14, 'congenital X-linked bleeding disorder': 9, 'HTSP-TLTG': 1, '40S ribosome deficiency': 1, 'NSABP B-40': 19, 'TBI': 13, 'bEMD,40': 1, 'THEA': 1, 'congenital hypoplasia of': 6, 'Congenital hypoplasia': 13, 'toTAL': 1, 'total organification defects': 1, 'S/TVA': 1, 'X-linked, congenital bleeding disorder': 4, 'TSC': 29, 'LATG': 29, 'cardiomyopathy,40': 1, 'SLW': 1, 'SV 40 tumors': 1, 'TEV': 8, 'MRTV-CG': 1, 'conduct and total': 1, 'TFM': 6, 'CPT': 2, 'capacite pulmonaire totale': 1, 'BTHKA': 1, 'tPLN': 1, 'congenital total deficiency of both tibias': 1, 'TR': 27, 'TGP': 33, 'sepsis.40': 3, 'DSQ-40': 1, 'Slight hyperactive': 1, 'hysterectomie totale': 1, 'UPN-40': 1, 'HET': 22, 'TOTAL VARIANCE': 1, 'X-linked cataract': 23, 'tHcys': 3, 'psiquiatria39,40': 1, 'TECAB': 1, 'Slight disturbance of sleep': 1, 'TLE': 12, 'DTAC': 11, '40-': 3, 'T-AOCs': 1, 'of Differentiation (CD)40': 1, 'Tc': 1, 'TAO': 3, 'TCHO': 1, 'TI': 8, 'TALD': 2, 'ETCC': 1, 'DPF': 1, 'sarcoma.40': 1, 'Slight problems': 33, 'CCT abnormalities': 2, 'reduction in 40': 1, 'TSU': 1, 'OV/TV': 1, 'TEIC': 1, 'TTHM': 17, 'TCE': 6, 'bleeding.40': 2, 'Slight Strokes': 1, 'TLN': 10, 'TML': 1, 'COVARIATES TOTAL': 1, 'thyroidectomie totale elargie': 1, 'Slight disturbance': 4, 'TPC': 18, 'FT': 1, 'TQM': 29, 'TLRH': 12, 'toxicity[40': 1, 'X-linked congenital disorder of glycosylation': 5, 'TH': 20, 'OT': 4, 'TVD': 7, 'X-linked multiple congenital anomalies': 3, 'X-linked congenital cataract': 13, 'X-linked cataract syndrome': 1, 'Congenital hypoplasia of the': 2, 'TST': 1, 'skin involvement.40': 1, 'TBS': 10, 'TDC': 6, 'Nervous 40': 1, 'CTC - 40': 1, 'impulsivity.40': 1, 'heterozygote': 1, 'Slight tibial dysplasia': 1, 'TAAs': 2, 'total chronic total occlusion': 3, 'DEFINING TOTAL': 1, 'TOTALS': 13, 'neuroinflammation.40': 2, 'TCO': 4, 'TGA': 3, 'ZTD': 4, 'short and slight stature': 1, 'Slight injury': 15, 'EARLY TREATMENT OF TOTAL BILATERAL CONGENITAL CATARACT': 1, 'TOTAL DISPOSABLES': 1, 'ATC': 1, 'TOTAL DISTANCE COVERED': 1, 'TOC': 8, 'Slight disability': 64, 'FXC': 1, 'social isolation.40': 1, 'Slight limitation': 9, 'Slight Injury': 2, 'Kenalog-40': 2, 'LTG': 32, 'total cavopulmonary': 2, 'MEM 40': 1, 'TF': 48, 'Total talar replacement': 1, 'TTR': 3, 'TICs': 18, 'Tumor D2-40': 1, 'TID': 15, 'TOTAL SALPINGECTOMY': 1, 'ATD': 1, 'TGDP': 1, 'total craniopagus': 1, 'TSS': 26, 'mitomap 40': 1, 'TNE': 2, 'TCA': 3, 'X-linked bilateral congenital cataracts': 1, 'SV 40 VIRUSES': 1, 'TOTAL Pt': 1, 'SIR': 1, 'Slight external rotation': 1, 'TFRD': 14, 'Total Coliform': 2, 'OTC': 3, 'TPS': 6, 'TPP': 3, 'TMA': 18, 'TOTAL GASTRECTOMY': 9, 'DRTV': 1, 'SP-TLH': 1, 'LT': 1, 'NSABPB-40': 2, 'hippocampal atrophy.40': 1, 'ID': 2, 'TOtal': 3, 'X-linked recessive congenital bleeding disorder': 5, 'ventricular slight enlargement': 1, 'congenital hypoplasia of the atlas': 5, 'TNU': 3, 'ASTF': 1, 'TCN': 11, 'Congenital hypoplasia of': 3, 'TCR': 12, 'total lesion': 3, 'TBE': 1, 'LAPAROTOMIC TOTAL GASTRECTOMY': 1, 'TAN': 10, 'carica batterica totale': 2, 'CMT': 2, 'carica micotica totale': 1, 'CBT': 2, 'TED': 6, 'brain,40': 1, 'TAI': 1, 'DMR': 1, 'SCA 40': 3, 'Slight valgus': 2, 'SV': 1, 'POP': 1, 'congenital posterior polar or total cataract': 1, 'TOTAL COLECTOMY': 12, 'TARC': 6, 'TINB': 2, 'V/A 20/40': 1, 'congenital X-linked recessive bleeding disorder': 3, 'PROPAN': 1, 'TDR': 14, 'TSP': 26, 'total dysplasia': 2, 'TTN': 17, 'TGS': 10, 'total hemolytic complement': 1, 'Total hemolytic complement': 2, 'Slight limitation of physical activity': 16, '-40': 26, 'TPL': 8, 'CR': 1, 'metabolic syndrome 40': 1, 'SCIENCE OF THE TOTAL ENVIRONMENT': 3, 'Slight depression': 2, 'TET': 7, 'Total Central longi': 1, 'Slight limp': 1, 'TOTAL EFFICACY OF': 1, 'NS': 3, 'arryhthmias.40': 1, 'congenital, recessive, X-linked bleeding disorder': 1, 'TVREM': 2, 'Congenital hypoplasia and': 2, 'TOTAL LOAN DEFAULTS': 1, 'Slight movement': 1, 'TOTAL EXTENDED COLPOADNEXOHYSTERECTOMIES': 1, 'Slight injuries': 12, 'LTP': 2, 'TIN': 1, '-TES': 1, 'loss of 40 dB or greater': 1, 'CRT': 1, 'Congenital polar cataract 2': 1, 'III 40': 1, 'P-40': 13, 'TSD': 9, 'haemorrhage1:40': 1, 'THEH': 1, 'ATF': 1, 'ATF-': 1, 'congenital total white cataracts': 1, 'AGE 40': 1, 'X-linked keratosis congenital': 1, 'congenital, X-linked bleeding disorders': 2, 'TME': 9, 'primarer TME': 1, 'TOTAL POSITIVE': 1, 'TNS-c': 1, 'TDD': 6, 'total distal deformity': 1, 'TOTAL A-V': 1, 'TBN': 5, '-TFRD': 2, 'FEN-TOTAL': 1, 'tDON': 2, 'X-linked congenital adrenocortical hypoplasia': 1, 'TDSs': 2, 'TOTAL OF INDENTIFIED': 1, 'TDM': 14, 'reflux;40': 1, 'TY': 5, 'TAH': 6, 'TOSH': 1, 'TPD': 15, 'MTD-A': 1, 'HZ': 6, 'T-CEL': 1, 'loss in total': 1, 'prolongation of CCT': 1, 'tonic flexion and slight rotation of the trunk': 1, 'OMTL - - - 40': 1, 'TYLL': 1, 'grief,40': 1, 'TEP.p': 1, 'TEP;n': 1, 'TEP;p': 1, 'TEPt': 1, 'CCT-NPC': 2, 'total fertilisation': 2, 'ZIN PH 40': 1, 'necrosis,40': 1, 'fractures,40': 1, 'SD': 3, 'Slight damage': 1, 'TOTAL NUMBER ESTIMATES': 1, 'LAPAROSCOPY-ASSISTED TOTAL GASTRECTOMY': 1, 'X-linked congenital cataracts': 3, 'X-linked cataract disease': 2, 'TNM': 3, 'TFLB': 1, 'QoR-40': 3, 'TSA': 9, 'congenital suprarenal hypoplasia': 2, 'slight': 4, 'stroke,40': 5, 'congenital hypoplasia of the risorius': 1, 'Total or': 1, 'total defect': 1, 'LAY-FOMM 40': 1, '40 C': 1, 'ENROLLED TOTAL COST': 1, 'sclerosis at fingers 40': 1, 'total spondyloptosis': 2, 'TEP hernioplasty': 1, 'congenital, recessive X-linked disorders': 2, 'THMs': 1, 'TPai': 1, 'Carum carvi L. 40': 1, 'tCa': 1, 'PTVE': 1, 'Slight slip': 2, 'curves 40 or greater': 1, 'TOTAL CYSTECTOMY IN': 1, 'TOTAL EXTIRPATION': 2, 'total reocclusion': 1, 'TOTAL SOCIAL SUPPORT': 1, 'cTNS': 2, 'motor and total patient (TFC) dysfunction': 1, 'X-linked congenital cataracts and microcornea': 3, 'congenital X-linked recessive disorder': 1, 'Slight Economic': 1, 'HN 40': 1, 'TNP': 5, 'MADIT II': 1, 'TSN': 4, 'SV-40-Renilla-Luc': 1, 'X-linked Congenital Cerebellar hypoplasia': 1, 'TNA': 9, 'congenital X-linked disorder': 4, 'TRiC': 1, 'T-AST': 1, 'TGI': 1, 'Slight limitation of ordinary physical activity': 2, 'congenital hypoplasia of the': 4, 'CEMENTLESS TOTAL': 1, 'TBF': 6, 'adiposity.40': 2, 'ST necesita': 1, 'ST': 1, 'PTS': 1, 'Slight Problem': 1, 'Slight limitation of': 2, 'abnormalities in total': 1, 'TLRT': 1, 'HAP:40': 1, 'hull TP': 1, 'TLA': 4, 'systole:40': 1, 'TAP': 3, 'Slight recurvatum': 1, 'TCs': 3, 'L-TE': 1, 'SV 40': 5, 'TOTAL POPULATION': 3, 'CXN': 7, 'TFV': 1, 'NTU': 1, 'extensor lag of 40 or more': 1, 'totally': 16, 'TRS': 19, 'heterozygote deficiency': 11, 'total motor impairments': 1, 'TBILI': 2, 'Total Billirubin': 1, 'TMM': 1, 'of T-AOC': 1, 'STBM': 3, 'metabolic syndrome,40': 2, 'TFOs': 1, 'X-linked congenital disorder': 12, 'CD 40': 2, 'C3F8,40': 1, 'TNG': 2, 'TEa': 16, 'LOB DOMAIN-CONTAINING PROTEIN 40': 1, 'LBD40': 1, 'TOTAL HELP': 1, 'tHcy': 21, 'TGN': 3, 'TF:40': 1, 'NGTS': 1, 'neurological disorders.40': 1, 'thyroidectomie totale': 2, 'SEMI-CONSTRAINED TOTAL': 1, 'vascular access thrombosis,40': 1, 'tOPN': 3, 'congenital bilateral congenital cataracts': 1, 'CMF': 5, 'TBM': 5, 'congenital hypoplasias': 5, 'IDC D2-40': 1, 'TNV': 2, 'MLF': 1, 'stroke.40': 5, 'R1-40': 1, 'TNS -': 1, 'cataract 40': 2, 'gliobastoma,40': 1, 'ADRC-40': 1, 'TOTAL COMPLIANCE': 1, 'TOTAL ALKALOID EXTRACTION': 1, 'health.40': 1, 'DIC.total': 1, 'ETC': 1, 'RRub': 1, 'ENREF_40': 2, 'Other metastatic carcinoma 40': 1, 'embryotoxic effects,40': 1, 'St-40': 1, 'LMT': 1, 'HTZ': 3, 'LTC': 1, 'neurosis.40': 1, 'TNT': 2, 'TGTL': 1, 'AFR': 1, 'PNS': 1, 'TRA': 10, 'metabolic disorders.40': 1, 'TPAT': 1, 'X-linked PIGA-CDG': 1, 'Lee/40': 1, 'AP@40': 1, 'Slight sclerosis': 1, 'PF-40': 1, 'LRN': 1, 'toxicity,40': 1, 'SL40': 1, 'Total Defects': 1, 'TLDG': 20, 'slight limb activity disorder': 1, 'slight injury': 2, 'NTM': 4, 'and total melanonychia': 1, 'total or': 2, 'acuity of 20/40 or worse': 1, 'TOTAL Syndrome': 1, 'nTA': 1, 'TEC': 3, 'SALVAGE TOTAL LARYNGECTOMY': 1, 'PCH,.40': 1, 'congenital total': 2, 'TFA': 5, 'TP-': 4, '40S RP deficiency': 1, 'or 40S RPs': 1, '40S RPs': 1, 'epilepsy.40': 3, 'TVC': 2, 'TOTAL INFORMATION': 1, 'autism spectrum disorder 40': 1, 'Slight limitations': 1, 'TAM': 4, 'TTC': 2, 'TDA': 6, 'CH 40-41': 1, 'CH 40-30': 1, 'of 20/40': 1, 'ITM': 1, 'LCSIL 28 and 40': 1, 'DAC': 2, 'HA': 5, 'TTA': 12, 'SO': 1, 'Chondroblastic 40': 1, 'myocardial injury,40': 1, 'LTH': 1, 'X-linked congenital immune-deficiency syndrome': 1, 'SLA': 1, 'TLC': 3, 'TGV': 13, 'HTs': 2, 'malignancy.40': 1, 'SCIENCE OF THE TOTAL': 1, 'TEA': 6, 'saprotroph 40': 1, 'Saprotroph 40': 1, 'TAF': 4, 'congenital X-linked neuromuscular disorder': 1, 'Slight varus reduction': 1, 'HC.Total': 1, 'RATLH': 2, 'Black Leaf 40': 1, 'Congenital hypoplasia of the atlas': 3, 'TEs': 1, 'Ps': 1, 'Xcat': 3, 'TOTAL VOLUME OF': 1, 'MM37-40': 1, 'tNCC': 6, 'AT': 4, 'SCC-40': 2, 'KE': 1, 'ABDOMINOTHORACIC TOTAL GASTRECTOMY': 1, 'HC:40': 3, 'SZ:40': 1, 'anaemia,40': 1, 'Slight balance': 1, 'Slight limitation of ordinary activity': 2, 'ESTIMATED WORLDWIDE APPROXIMATE TOTAL': 1, 'PTP': 2, 'bilateral congenital total cataract': 1, 'X-linked dominant congenital disorder': 3, 'CTS': 1, 'T-AOC damage': 1, 'tAUC': 8, 'NETosis.40': 1, 'SV-40': 2, '40S Ribi': 1, 'Slight abnormality': 2, 'Total coliforms': 5, 'PTG': 17, 'TOTAL ACIDITY': 1, 'THA': 3, 'TLAP': 1, 'Total Cholesterolemia': 2, 'T. TES': 1, 'COVID1-40': 1, 'PTL': 1, 'TLP': 1, 'X-linked multiple congenital anomaly syndrome': 2, 'X-linked congenital bleeding disorders': 3, 'TECHNIC OF TOTAL TRANSPLANTATION': 1, 'HH39-40': 1, 'TICC': 2, 'Alzheimer amyloid abeta9-40': 1, 'DERM - Organic - 40 Sp': 1, 'DK': 1, 'atrophy.40': 1, 'TOTAL POWER EXPENDED': 1, 'impairments in total': 1, '20/40': 17, 'SGN-40': 1, 'TKS': 2, 'TOTAL HYSTERECTOMY': 1, 'Slight disturbances in early': 1, 'ARTF': 1, 'dementia.40': 6, 'TVOC': 3, 'X-linked recessive, congenital syndrome': 1, 'A69.40': 1, 'AFT': 2, 'Total cholesteremia': 3, 'DLS,~40': 1, 'lymphoid and 40 myeloid neoplasms': 1, 'TO': 7, 'cardiac conduction disorders.40': 1, 'TPR': 4, 'renal injury.40': 1, 'Luminal 40': 1, 'slight injuries': 2, 'TNSs': 2, 'TOTAL REWARDS': 1, 'MSTF': 1, '40 of external rotation': 1, 'TEP-': 2, 'TEP-GA': 1, 'TN': 10, 'TOTAL HEAT LOAD': 1, 'X-linked congenital clotting disorder': 1, '40, 41': 1, 'THE': 2, 'congenital, X-linked': 2, 'posterior frontal suture defect': 1, 'congenital recessive X-linked disorder': 1, 'APROPOS OF 40 OBSERVATIONS': 1, 'Hets': 1, 'THE HETEROZYGOTE TEST': 1, 'behavioral deficits.40': 1, 'deficiency of 40S ribosomal': 1, 'TDBR': 1, 'Slight shyness': 1, 'Slight dystrophy': 1, 'TRN': 1, 'VAP-RA:40': 1, '40 dB) loss': 1, 'X-DC': 1, 'X-linked congenital keratosis': 1, 'NTD': 1, 'X-linked congenital cataract with microcornea': 1, 'X-linked cataract 40': 1, 'X-linked cataracts': 8, 'LC:40': 1, 'TSM': 6, 'TCNs': 2, 'TOTALLY TUBELESS': 1, 'HFrEF.40': 1, 'tPTX': 2, 'congenital total av-block': 1, 'slight binocular blindness': 1, 'TBL': 1, 'TNSc': 8, 'NE:40': 1, 'TCPM': 1, 'TMD': 2, 'VA-TT': 1, 'congenital hypoplasia or': 3, 'ANA:40': 1, 'TCEs': 2, 'CCT-SE': 1, 'VT.40': 1, 'ARLD-40': 1, 'USE OF G.330-40': 1, 'Total cholesterolemia': 3, 'total cholesterolemia': 1, 'TOTAL CONCEPT': 1, 'MTCY': 1, 'OBSERVING THE TOTAL': 1, 'myotube atrophy,40': 1, 'COMPARED TO': 1, 'X-linked syndromic cataracts': 1, 'TVL': 1, 'GTS': 3, 'depression.40': 2, 'loss of <=40 dB': 1, 'C-40': 2, 'Slight degeneration': 1, 'VA.40': 1, 'NUT': 1, 'Nephro-ureterectomie totale': 1, 'artroplastia total primaria': 2, 'TOTAL POP': 1, 'aHC': 1, 'STVD': 1, "Rising tide of bad science',40": 1, 'TU': 1, 'X-linked lethal congenital malformation syndrome': 3, 'Cortical lesion 40': 1, 'TSB': 1, 'CME': 1, 'TLV': 2, 'Slight dependency': 2, 'ALMOST TOTAL': 1, 'of 40S': 1, 'TOTAL-AMI': 1, 'PNM-40': 1, 'TDB': 1, 'TTON': 2, 'Total Nonfarm Payroll': 1, 'TNC': 4, 'emotional, conduct, and total': 2, 'Slight disorder': 2, '-TPC': 1, 'DP;40': 1, 'psychosis.40': 1, 'tPD': 1, 'NP-40': 6, 'depressive episodes.40': 1, 'Total melanonychia': 1, 'Slight symptoms': 1, 'X-linked congenital cerebellar hypoplasia': 4, 'TOTAL COLONOSCOPY': 1, 'HE*40': 2, 'X-linked isolated pediatric cataract': 1, 'TK': 2, 'Slight limb movement': 1, 'Reduced CCT': 1, 'TQ': 1, 'TOTAL SCATTERING OF X-RAYS BY': 1, 'Slight Problems': 1, 'complications.40': 1, '40S deficit': 1, '20/40 or': 2, 'congenital, recessive, X-linked disorder': 1, 'IMR 40': 1, 'Total body': 1, "dying';40": 1, 'fatigueT:40': 1, 'TAR': 4, 'X-linked multiple congenital anomalies (MCA) syndrome': 2, 'low 40': 1, 'congenital X-linked developmental disorders': 1, 'convicts.40': 1, 'congenital and acquired X-linked disorders': 1, 'CCT-LC': 1, 'RIPC.40': 1, 'TOTAL DISTANCE': 1, '-Type Amyloid-beta1-40': 1, 'TFDR': 1, 'PCSD': 1, 'TNO': 1, 'TO-': 1, 'Slight unbalance': 1, 'TCT CCT': 1, 'TEPA': 1, 'SV-40 INDUCED PROLIFERATION': 1, 'GDMG2:40': 1, 'GDMG1:40': 1, 'tyes 40': 1, 'carcinogenicity.40': 1, 'pulmonary toxicity.40': 1, 'CONGENITAL HYPOPLASIA': 1, 'TEF': 1, 'TEAD': 1, 'TSSN': 3, 'SCZ,40': 1, 'endometriotic lesions.40': 1, 'Sporadic Spinal 40': 1, 'Slight difficulties': 1, 'premature death.40': 1, 'TOTAL 9999b': 1, 'LUSC 40': 1, 'Heterozygote Deficiency': 2, 'TLM': 2, 'UT-SCC-40': 1, 'lipomatosis,40': 1, 'intracranial bleeding.40': 1, 'TEo': 3, 'tCS': 1, 'Slight ache': 1, 'TOTD': 1, 'congenital, X-linked dominant syndrome': 1, 'DD,40': 1, 'TCD': 4, 'SIT-40': 1, 'SMU.40/41 TA': 1, 'Slight retardation': 2, 'PCG:40': 1, 'syndrome".40': 1, 'TRDG': 3, 'ABOVE TOTAL NO': 1, 'TOTAL SCORE': 1, 'total edentia': 1, 'bronchus total obstruction': 1, 'pTNM category I/II 40': 1, 'CARS-29-40': 1, 'SV 40-INDUCED TRANSFORMATION': 1, 'congenital, recessive X-linked disorder': 1, 'X-linked dominant multiple congenital anomalies syndrome': 1, 'X-linked dominant MCA syndrome': 1, 'PROPAGATION OF SV 40': 1, '20.40': 1, 'TMC': 2, 'N.40': 1, 'NM TT': 1, 'X linked cataract': 1, 'Strong Medium Slight': 1, 'anxious.40': 1, 'depression,40': 2, 'tHCY': 3, 'CCT lesions': 1, 'LSIL 40': 1, 'RPTS': 1, 'TSPs': 2, 'MTF': 1, 'C-40 c': 1, 'TDMV': 2, 'MINLEN:40': 5, 'OB.Total': 1, 'SRE-T': 1, '/40': 1, 'X chromosome-linked cataract': 1, 'total cochleovestibular syndrome': 1, 'X-linked recessive congenital disorder': 2, 'Slight dysfunction': 4, 'MF': 1, 'epileptic.40': 1, 'Slight dullness': 1, 'ACI TLS': 1, 'NB:40': 1, 'X-linked CDG': 4, 'TOTAL STUDY POPULATION': 1, 'Slight Disability': 2, 'THS': 1, 'THSs': 1, 'TT +': 1, 'or=20/40': 1, 'T-SH': 1, 'II:40': 1, 'oncsis.2017.40': 1, 'BCC (40': 1, 'AWGN 40': 1, 'total body dolor': 1, 'TLG': 8, 'infections39, 40, 41': 1, 'CCT prolongations': 1, 'congenital total lipoatrophy': 1, 'TOTAL VAGOTOMY': 1, '40-41 C': 1, 'Slight regurgitation': 1, 'TDAP': 1, 'nerve damage.40': 1, 'Slight Cool': 1, 'TOTAL SYNOVECTOMY IN': 1, 'AetCCTs': 1, 'TOTALLY GASTRECTOMIZED DOGS': 1, 'AML': 1, 'X-linked congenital disorders': 2, 'TTHMs': 6, 'SK70-40': 1, 'UNA COLECTOMIA TOTAL': 1, 'dystrophic neurites,40': 1, 'childlessness.40': 1, 'and total': 4, 'LXR-40': 1, 'Arterionephrosclerosis;40': 1, 'total leucoderma': 1, 'Total leucoderma': 1, 'TTD': 2, 'TSE': 3, 'ETTT': 1, 'SLC': 1, 'PLTE': 2, 'IRR-TV': 1, 'PF': 2, 'PF-': 1, 'STL': 10, 'DAS': 1, 'MTS': 1, 'H2T': 1, 'Totox': 1, 'TOTAL DESCRIBED': 2, 'PLF': 1, 'Total colourblindness': 1, 'mTD': 1, 'TOTAL CONGENITAL': 1, 'c. 40': 1, 'Slight disease': 1, 'trauma.40': 1, 'B-CCT': 1, 'TOTAL HTT': 1, 'autonomy loss,40': 1, 'tWMH': 1, 'TG.It': 1, 'TOTAL ESTIMATED': 1, 'Congenital hypoplasia of the pericardium': 1, 'microalbuminuria,40': 1, 'disability pension:40.0': 1, 'Gastric 40': 1, 'TOTAL MOVEMENT': 1, 'SCR': 1, 'oclusao total cronica retrograda': 1, 'TSH': 1, 'TSL': 1, 'dTAC': 3, 'cluster of differentiation 40 ligand': 1, 'LVID2-40': 1, 'total loss of ossicles': 1, 'the 20/40': 1, '-TLH': 2, 'mini-TLH': 1, 'COMPLETE GENERALIZATION OF 2 CONGENITAL CATARACTS AFTER CRANIAL': 1, 'X-linked recessive congenital bleeding disorders': 1, 'NDs': 1, 'N-Linked Congenital Disorders of': 1, 'TOTAL 231': 1, 'genetic discrimination.40': 1, 'CD 40 deficiency': 1, 'atrophic.40': 1, 'Low No Unclear 40': 1, 'TOTAL SAMPLE': 4, 'TPLE': 4, 'Heterozygote': 2, '40-41': 1, 'TOTAL DIPHALLIA': 1, 'to 40': 1, 'ALL': 2, 'NLTV': 2, 'NTC': 1, 'aphasie totale': 1, 'TOTAL VARIATION REGULARIZATION': 1, 'ANPR 40 Tumors': 1, 'TOTAL EDENTIA': 1, 'SI': 3, 'ICT': 1, 'X linked congenital disorder': 1, 'LETHAL TOTAL': 1, 'MPS 15-40': 1, '20-40': 1, 'Total Coliforms': 1, 'X-linked lifelong congenital bleeding disorder': 1, '40.2Cyclothymia': 1, 'TR-TC': 2, 'CONGENITAL HYPOPLASIA OF': 2, 'ASTFs': 1, 'suicide.40': 1, 'THA\\TKA': 1, 'congenital total hypoplasia of the aorta': 1, 'TW': 1, 'traumatic event:40': 1, 'TAD': 1, 'TOTAL HAND': 1, 'TNLE': 1, 'NP 40': 1, 'TDPs': 2, 'sleepiness,40': 1, 'Gastrectomie totale': 1, 'Total muestra Perfil': 1, 'MM 40': 1, '39C -40 C': 1, 'TN-E': 2, 'ATTS': 1, 'follicular atresia.40': 1, 'TPN': 2, 'HOVON-40': 1, 'slight limitation': 1, 'Heterozygote deficiencies': 3, 'HE:40': 1, 'HADD:40': 1, 'EC-40': 1, 'ITT': 1, 'ITT a': 1, 'MI.40': 1, 'Slight Ailments': 1, 'SP': 1, 'Congenital cataract 2': 1, 'TCF': 1, 'tAM': 1, 'TTS': 3, 'SLIGHT INFLUENCE': 1, 'TOTALING COSTS': 1, 'OCCURRING RADIONUCLIDES K-40': 1, 'ischemic stroke.40': 3, 'congenital, X-linked recessive bleeding disorder': 1, 'TB TB': 1, 'DE:40': 1, 'TBIL': 2, 'TLDP': 1, 'Slight abnormalities': 2, 'allergic symptoms.40': 1, 'NM-40': 1, 'total laparoscopica esquerda': 1, 'Colectomia total laparoscopica esquerda': 1, 'TOTAL LARYNGOFISSURE': 1, 'CL.Total': 1, 'total prolapsus': 1, 'GVHD.40': 1, 'retinopathy,40': 1, 'FID-40': 1, 'Slight Damage': 1, 'congenital X-linked bleeding disorders': 3, 'ischaemic stroke.40': 1, 'TKR': 1, 'CCT dysfunction': 1, 'MEAN TOTAL': 1, 'TOTAL NUMBER': 2, 'CMN.40': 1, 'CMN,40': 1, 'atherosclerotic burden.40': 1, 'TVB': 1, 'OM 40': 2, 'MAC:40': 1, 'MCI 40': 1, 'TOTAL OMENTECTOMY': 1, 'Leucoma totale': 1, 'CR,40': 1, 'Systemic 40': 1, 'TIS': 5, 'Myalgia:40': 1, 'Agitation:40': 1, 'TFD': 1, 'PERCENTAGE OF TOTAL': 1, 'AMOUNT OF EXTRACTED OP TOTAL POLYPHENOLS': 1, 'AMOUNT OF EXTRACTED OP TOTAL FLAVONOIDS': 1, 'RATG': 1, 'TOTAL Unnatural': 1, 'aggregation.40': 1, 'TTE': 1, 'T-AO': 1, 'total knee and total hip infections': 1, 'TOTAL PARATHYROIDECTOMY': 1, 'TOTAL ANTIOXIDANT': 2, 'TFL': 3, 'TOD': 3, 'Slight hoarding': 1, 'tumors,40,41': 1, 'CTRCT40': 1, 'TA+A': 1, 'TKA': 2, 'X-linked cataract phenotypes': 1, 'X-linked cataract phenotype': 1, 'Non-syndromic X-linked congenital cataract': 1, 'TOTAL EXTIRPATION OF': 1, 'TOTAL DISULFIDE BONDS': 1, 'HA:40': 1, 'total coliforms': 2, 'X-linked congenital syndrome': 3, 'NTS': 1, 'disease.40': 1, 'TOT': 2, 'STC': 1, 'HEZ': 1, 'neutropenic sepsis.40': 1, 'CONGENITAL TOTAL': 1, 'E-TEP': 1, 'Slight limitation of ordinary physical activity': 1, 'NMI:40.0': 1, 'than 20/40': 2, 'heterozygote deficiencies': 1, 'SCOPA.total': 1, 'GDS.total': 1, 'MOCA.total': 1, 'congenital, X-linked recessive disorder': 1, 'eTEP': 4, 'congenital X-linked bleeding disease': 1, 'TRF': 1, 'TQS': 1, 'tMPA': 1, 'HOC 40': 1, 'Congenital Congenital Cataract Congenital bilateral': 1, 'TCH': 2, 'Slight illness': 4, 'THg': 2, 'TOTAL INDICATORS': 1, 'X-linked congenital hyperuricosuria': 2, 'TLR': 2, 'TOTAL SYNTHESES': 1, 'Slight trauma': 2, 'SR': 3, 'genocide.40': 1, 'malignant degeneration".40': 1, 'MTA': 2, 'Heterozygote deficiency': 6, 'Slight Impairment': 1, 'X-linked congenital abnormalities': 2, 'TPTA': 1, 'totally cyanide': 3, 'Slight delay': 2, 'TSedD': 1, 'TAIL': 1, 'TAPVC total': 1, 'TLNs': 2, 'RLS-40': 2, 'Heterozygote defects': 1, 'Soy- Soy- TOTAL': 1, 'CD40L deficiency': 1, 'TFS': 2, 'X-linked congenital hemorrhagic disorder': 1, 'TTH': 1, 'X-chromosomal recessive congenital cataract': 1, 'TOTALLY EVISCERATED': 1, 'RTG': 3, 'TMSAS': 1, 'X-linked isolated paediatric cataracts': 1, 'X-linked isolated paediatric cataract': 1, 'TVA': 1, 'TTERPT': 1, 'D2-40': 2, 'SCA type 40': 1, 'TMPs': 2, 'X-linked recessive, congenital disorder': 1, 'ETORPHINE-KETAMINE-MEDETOMIDINE TOTAL': 1, 'T/T': 1, 'TAS': 3, 'MUTATIONAL HETEROZYGOTES': 1, 'EF:40': 1, 'colesterolemia totale': 1, 'posterior suture anomaly': 1, 'CD-40 ligand deficiency': 1, 'schizophrenia.40': 1, 'REACTOME PREFOLDIN MEDIATED TRANSFER OF SUBSTRATE TO CCT TRIC': 1, 'wasting conditions.40': 1, 'DTF': 1, 'nuclear with posterior suture opacities': 1, 'CONN-TOTAL': 1, 'TIQ': 1, 'TXVI': 2, 'SCORAD 40': 1, 'HAYLING TOTAL ERROR': 1, 'CXN disease': 1, 'STL-LOR': 1, 'cancerdevelopment.40': 1, 'RALH': 1, 'Total peduncular syndrome': 1, 'X-linked syndromal cataract': 1, 'TOTAL COHORT': 2, 'embryonic lethality.40': 1, 'Renal 40': 2, 'hyperglycemia39,40': 1, 'TEH': 1, 'PFS': 1, 'slight pressure symptoms': 1, 'TOTAL PATELLECTOMY IN': 1, 'ADNt': 1, '32-40': 1, 'MMTC': 1, 'FAU': 1, 'TYS': 1, 'Slight epiphyseal deformities': 1, 'congenital atlas hypoplasia': 1, 'loss of >=40 dB': 1, 'RTLH': 2, 'myocardial total ischemia': 1, 'ECR-40.29': 1, 'ECR-40': 1, 'X-linked congenital microcephaly': 1, 'Slight impairment of performance': 1, 'NMS': 1, 'TOTAL EVIDENCE': 2, 'homicide.40': 1, 'TOTAL ECONOMIC COST': 1, 'mToxicity:40': 1, 'YES 40-': 1, 'ETPD': 1, 'TOTAL VAGOTOMY': 2, 'dysphagic TL': 1, 'Pancreas 40': 1, 'Hepatocellular 40': 1, 'PF suture anomalies': 1, 'posterior frontal suture anomalies': 1, 'infertility.40': 1, 'joint damage.40': 1, 'congenital X-linked blindness': 1, 'total organification defect': 2, 'Slight impingement': 1, 'TOTAL RESPONDENTS': 1, 'TB TS': 1, 'Total congenital leukonychia': 1, 'RTS': 1, 'stenosis*40': 1, 'BDI-T': 1, 'NEC,40': 1, 'ToT': 1, 'TOTAL WAITING TIME': 1, 'X-linked recessive, congenital bleeding disorder': 1, 'TMP': 3, 'TEM': 1, 'GCs.40': 1, 'NP-R': 1, 'NP-E': 1, 'Congenital Congenital Congenital Cataract': 1, 'FBO 40': 1, 'TDOA': 1, 'OXA-40 R': 1, 'congenital hypoplasia of the LG': 1, 'HETEROZYGOTES': 3, 'OS': 1, 'SUD 40': 1, 'X-linked multiple congenital abnormality': 1, 'bone.40': 1, 'X-linked multiple congenital anomaly disorder': 1, 'tLD': 1, 'TSCPC': 2, 'HeFH': 1, 'Total perfusion defect': 1, 'TMN': 1, 'td': 1, 'Slight visual field defect': 1, 'X-linked recessive congenital malformation syndrome': 1, 'GVFQ-40': 1, 'X-linked congenital leukodystrophy': 1, 'TNFE': 1, 'congenital total arhinia': 1, 'TARQUIN': 1, 'congenital X-linked disorders': 1, 'TOP': 1, 'X-chromosomal-linked sutural cataracts': 1, 'ITB-40': 1, 'Slight upset': 1, 'MR:40': 1, 'tCPP': 1, 'impaired total': 2, 'TV loss': 1, 'congenital abnormalities.40': 1, 'SA,40': 1, 'ANTIPIOJOS FORMULA TOTAL': 1, 'total coliform': 2, 'Slight hyper': 1, 'Slight necrosis': 1, 'slight anomalies of the limbs': 1, 'MPS 40': 1, 'TPNS': 1, 'NEDIM 40': 1, 'AGTL heterozygote deficiency': 1, 'LPSR': 1, 'deformities of slight scoliokyphosis': 1, 'TOTAL OSTEOPLASTY': 1, 'TIM': 1, 'TMLS': 1, 'arvensis Myo_arv 40': 1, 'jenvironpatholtoxicoloncol.v25.i3.40': 1, 'total melanonychia': 1, 'CAG)40': 1, 'die.40': 1, 'Hip-40 Knee-80': 1, 'motor neuron loss.40': 1, 'TNW': 1, 'neurons.40': 1, 'than 40': 1, 'APT': 1, 'TNL': 1, 'slight dysmorphism': 2, 'RATP': 1, 'Slight dysplasia': 1, 'TAOA': 1, 'incapacite temporaire totale': 1, 'MRM 40': 1, 'total facet replacement': 1, 'L-TG': 2, 'ID 40 and 41': 1, 'TOS': 1, 'TNC CPP': 1, 'Kenalog -40': 1, 'CS': 2, 'ototoxicity.40': 1, 'WMH:40': 1, 'Slight deterioration': 1, 'TOPICAL PREPARATIONS REQUIRED FOR TOTAL': 1, 'TSR': 1, 'TVM': 2, 'PART': 1, 'LTT': 1, 'LLT': 1, 'TOTAL SOCIAL': 1, 'CCT-POP': 1, 'TOTAL NO': 2, 'dementias.40': 1, 'TOTAL NUMBEROF': 1, 'HD-40': 1, '-IV 40': 1, 'X-linked congenital disorder of': 1, 'CCT injury': 1, 'X-linked multiple congenital anomalies and overgrowth syndrome': 1, 'MVT': 1, 'OCT': 1, 'TT-': 1, 'necrosis.40': 2, 'ED.40': 1, 'tet(40)': 1, 'SV40ST': 1, 'AFTER SUBLETHAL TOTAL': 1, '40S subunit': 1, 'HF.40': 1, 'TMAE': 1, 'hFH-P': 1, 'hFH-': 1, 'hFH': 1, 'TSCCs': 1, 'Gastrointestinal 40': 1, 'TDN': 1, 'OTC foi maior': 1, 'BAA-40': 1, 'TTRE': 1, 'TDs': 1, 'GTO-40': 1, 'SLIGHT INCREASE': 1, 'TPAIT': 1, 'TLPTG': 1, 'TTPM': 1, 'I3DU 40-43': 1, 'WTTV': 1, 'TMR': 1, 'THP': 1, 'TCI': 2, 'SRET': 1, 'Het': 1, 'MEET TOTAL FINANCIAL NEEDS': 1, 'BPTS': 1, 'TIC of': 1, 'Total incapacity to': 1, 'Slight disruption': 1, 'bleeding complications.40': 1, 'TOTAL PAROTIDECTOMY--TECHNIQUE': 2, 'MSP Tissue 40': 1, 'TOTDIST': 1, 'CAC 40': 3, 'HetDef': 1, 'fracture,40': 1, 'recessive, X-linked, congenital bleeding disorder': 1, 'TB-': 1, '40-Illness': 1, 'proctectomia total abierta': 1, 'TNN': 1, 'ASD;40': 1, 'Slight swelling - 1': 1, 'TOTAL THYROIDECTOMY RATIONAL AS': 1, 'MN1:40': 1, 'Tumor:40': 1, 'Total psychopathy': 1, 'Slight body movement': 1, '- 40': 1, 'TARGET_TOTAL': 1, 'SchizophreniaBipolardisorder[40': 1, 'THHE': 1, 'Slight loss of vertebral reduction': 1, 'CNS': 1, 'SF': 2, 'PROPORTION OF TOTAL VARIANCE': 1, 'TOTAL 2,207': 1, 'TEP LIHR + RP': 1, 'PTT': 1, 'HTN.Total': 1, '40S subunit deficiency': 1, 'X-linked congenital overgrowth syndrome': 1, 'RAH': 1, 'tumors,40': 1, 'loss of total': 2, 'clumsy movement and slight balance disorders': 1, 'OXA-40': 2, 'lesions 29, 32, and 40': 1, 'TLSRD': 2, 'TLhH': 1, 'PTIF': 1, 'Total intestinalaganglionosis': 1, 'Ds': 2, 'TTL': 1, 'AD': 1, 'total phallic loss': 1, 'cardiac malfunction.40': 1, 'inflammatory cytokines.40': 1, 'MetS.40': 2, 'TOTAL CONSUMERS': 1, 'X-linked multiple congenital malformation syndrome': 1, 'blackout:40': 1, 'ERA-40': 2, 'HA (40)': 1, 'RCUD 40': 1, '40S': 3, 'SLIGHT DIABETOGENIC EFFECT': 1, 'TOTAL LARYNGECTOMY': 2, 'myocardial total': 1, 'TC CPP': 1, 'TOTAL VARIATION': 1, 'X-linked congenital pleiotropic developmental anomaly': 1, 'CLP': 1, 'nogaitabnormalities,40': 1, 'tachyarrhythmias.40': 1, '40S.': 1, 'TSSM': 3, 'Visual 40': 1, 'HARE-40': 1, 'DETECTION OF HETEROZYGOTES': 1, 'GENETIC COUNSELING OF HETEROZYGOTE': 1, 'TSRDN': 1, 'UC.Slight': 1, 'HO': 1, 'ARTROPLASTIA TOTAL': 1, 'TRH': 1, 'Total Haematuria': 1, 'renal ischaemia and reperfusion injury.40': 1, 'RAW TOTAL SIGNATURES': 1, 'X-linked recessive congenital disorders': 1, 'TOTAL PANCREACTOMY': 1, 'TTF': 1, 'Congenital hypoplasia or': 2, 'tDLP': 1, 'NT': 1, '- CT (CCT)': 1, 'injury.40': 1, 'artroplastia total': 1, 'desire.40': 1, 'TOTAL ESTRATIFICACION': 1, 'TGL': 1, 'NSABP-40': 1, 'TOTAL TOCOPHEROLS': 1, 'Chalcones 40': 1, 'Ts': 1, 'IPE.40': 1, 'helplessness:40.94': 1, 'artroplastia total primaria eletiva': 1, 'pre-40S': 1, 'PND 40': 1, 'thrombolysis*40': 1, 'SUB-TOTAL': 1, 'TOTAL POSTERIOR TARSECTOMY AS AN EXCEPTIONAL': 1, 'Total -ese -myense -taka -nuntey -teni -ese -ekaciko': 1, 'TSPJ': 1, 'VENC 40': 1, 'GCT CCT': 1, 'TLLDN': 1, 'myocardial necrosis.40': 1, 'NObCADs.40': 1, 'AGREED TOTALLY': 1, 'HISTOPATHOLOGICAL OBSERVATION OF 40 CASES': 1, 'TWD': 1, 'TSBM': 1, '40 27 38 40': 1, 'ED': 1, '20/40 or better': 2, 'autosomal recessive or X-linked congenital brain malformation': 1, 'Total arhinogenesis': 1, 'DNH 40': 1, 'Decreased total': 1, 'congenital total pericardial defect': 1, 'TOTAL SCORES': 1, 'VPT': 1, '40CD': 1, '40SD': 1, '40WD': 1, '40WMD': 1, 'TOTAL ERROR': 1, 'Slight blurriness': 1, 'TX': 1, 'PTH&TKA': 1, 'TOTAL ADRENALECTOMY': 1, 'CVD.40': 1, 'BC-40': 1, 'tumor.40': 1, 'BRAZIL OVER 40': 1, 'CAUTION NP-40': 2, 'SLIGHT DECREASE': 1, 'TOTAL LISTED FACILITIES': 1, 'Slight intoeing': 1, 'total occlusiona': 1, 'TND': 1, 'TSV (V': 1, 'TOTAL ACTIVITY OF': 1, 'PROPAGATION OF SV-40': 1, 'DKT': 1, 'Slight infections': 1, 'CFS 40': 1, 'TLRG': 1, 'FF 40': 1, 'total VC': 1, 'TDAH': 1, 'Congenital hypoplasia of ICAs': 1, 'Slight Damages': 1, '40S deficits': 1, 'Congenital cerebella hypoplasia': 1, 'SV40 tumor antigen': 1, 'FGR_40': 1, 'Total coliform': 2, 'POSITIVE TOTAL': 1, 'TFHL': 2, 'TOTAL TRANSGENDER': 1, 'stent thrombosis.40': 1, 'histerectomia total': 1, 'TL?How': 1, 'conduct, peer, and total': 1, 'type II 40': 1, 'total body': 1, 'TOTAL COST': 2, 'HSH': 1, 'tVAF': 1, 'homo-40S.': 1, 'homo-40S': 1, 'injury;40': 1, 'SLIGHT MODIFICATION': 1, 'keratomycosis,40': 1, 'PM 40': 1, 'Slight sensory disturbance': 1, 'MS Tp': 1, 'TRs-TC': 1, 'X-linked recessive cataract': 1, 'TCCpM': 1, 'CLTG': 1, 'POM 40': 1, 'Slight handicap': 1, 'TNEP': 1, 'thcys': 1, 'TOTAL RAINFALL': 2, 'oligomeganephronic congenital hypoplasia': 1, 'SPA-TLH': 1, 'TFGU': 1, 'Urinary 40 Skin 14': 1, 'BREATHING 40': 1, 'T-AOC of': 1, 'UM 40': 1, 'Slight wilting': 1, 'congenital hypoplasia of the leaflets': 1, 'TNOM': 1, 'Slight deviation of right eye': 1, 'THCY': 1, 'totSS': 1, 'HC,40': 1, 'NTSP': 1, 'metabolic syndromes.40': 1, 'TLHs': 1, '-TGC-AAC-ACT-CTT-CCT-': 1, 'Slight deformity': 1, 'LG9.40': 1, '-A-40': 1, 'decreased total': 1, 'TOSC': 2, 'RTLS': 1, 'TAUS': 1, 'TT;Total': 1, 'TLP defects': 1, 'Total talar extrusion': 1, 'total talar extrusion': 1, 'X-linked recessive multiple congenital anomalies': 1, 'Total cholesterolaemia': 1, 'in total': 1, 'TOF': 1, 'EM-TV': 1, 'NI-T': 1, 'I-T': 1, 'TMS abnormality': 1, 'Slight blush': 1, 'TT-Ca': 1, 'melancholic depression:40.0': 1, 'sita:40vog:40': 1, 'extensor lag of 40': 1, 'TP-IATs': 1, 'Total craniopagus': 1, 'PTD': 2, 'II and III meningiomas.40': 1, 'ES': 1, 'TTLS': 1, 'TTLS-': 1, 'sex-linked congenital cataracts': 1, 'PS': 1, 'PSD': 1, 'RE 20/40': 1, 'X-linked developmental cataract': 1, '30-40': 1, '-H.40': 1, 'TAOxC': 1, 'Total endolabyrinthine syndrome': 1, 'PS 20-40': 1, 'HC.40': 1, 'BT-40': 1, '40-41 C': 1, 'TEDs': 1, 'TOTAL GLOSSECTOMY': 1, 'TVB-N': 1, 'SVC': 1, 'Slight Necrosis': 1, 'Medium Slight': 1, 'ENCEPHALOPATHIES IN SLIGHT HEAD INJURIES': 1, 'Biliary 40': 1, 'TAFU': 1, 'MSI tumors.40': 1, 'T2Dvs.40': 1, 'muscle damage.40': 1, 'MTCC 40': 1, 'Screened Total': 1, 'CAD$40': 1, 'SCD': 1, 'inflammatory,40': 1, 'TOTAL REVENUE': 1, 'osteoarthritic joints.40': 1, 'Slight visuomotor deficits': 1, 'X-linked congenital vision disorder': 2, 'CIN3 lesions{40': 1, 'taupathies.40': 1, 'X-linked CA': 1, 'TCOM': 1, 'Slight memory problems': 1, 'TOTAL DIET': 1, 'PfnHet': 1, 'Nevus 40': 1, 'cerebrovascular event:40': 1, 'asthmatics,40': 1, 'TCP': 2, 'TCC': 2, 'TOTAL BEDS': 1, 'ESTADs': 1, 'GCS': 1, 'total-': 1, 'Congenital reticulohistiocytosis X': 1, 'tOCN': 1, 'cardiomyopathy.40': 1, 'type 40 SCA': 1, 'visual worse than 20/40': 1, 'PX 40': 1, 'total or nearly total occlusions': 1, 'tPLB': 1, 'Slight sleepiness': 1, 'Sex-linked congenital cataract': 1, 'sex-linked congenital cataract': 1, 'YAA': 1, 'amyloid -40': 1, 'X linked Hungarian Congenital': 1, 'abnormalities of total': 1, 'CYTOPLASMIC STEPS OF 40S': 1, 'CT e': 1, 'SC': 1, 'tMM': 1, 'CCT prolongation': 1, 'Congenital X-linked cataract': 1, 'congenital X-linked cataracts': 1, 'TVN': 1, 'TOTALLY': 1, 'HEAT': 1, 'total loss': 1, 'TTRM': 1, 'TOMM-40': 1, 'TOTAL 2': 1, 'congenital X-linked stapes gusher syndrome': 1, 'TOTALLY TRANSCUTANEOUS': 1, 'cifra total acumulada': 1, 'TOTAL CLEFT AS': 1, 'NF_40': 1, 'atherosclerotic disease.40': 1, 'TNB': 1, 'neuronal damage.40': 1, 'HGD%total': 1, 'RTP': 1, 'extramedullary diseases.40': 1, 'Slight disorders': 1, 'slight disorders': 1, 'myeloma.40': 1, 'TRD': 1, 'Total spondyloptosis': 1, 'BT-40 tumors': 1, 'BT-40 astrocytoma': 1, 'CCT GCT CTC': 1, 'SLIGHT MODIFICATIONS': 1, 'HPF': 1, 'Total ligation syndrome': 1, 'clicking at 40': 1, 'TIR': 1, 'TFSD': 1, 'PFS defect': 1, 'LS-TV': 1, 'CID 40': 1, 'dysphagic TLE': 1, 'TLE WITH': 1, 'reproductive disorders:40': 1, 'neurodevelopmental disorders[40': 1, 'TACS': 1, 'visual complications.40': 1, 'Ab der 40': 1, 'CM-SD': 1, 'CCT defects': 1, 'TEMA': 1, 'TBD': 1, 'vitiligo (vit)-40': 1, 'TMB': 1, 'MHOTV': 1, "H'40-L'40": 1, 'CD 40 ligand deficiency': 1, 'Frontotemporal atrophy;40': 1, 'VV/TV': 1, 'toxicities.40,41': 1, 'OP_TR_40': 1, 'FEP 40': 1, 'Tc00.1047053510507.40': 1, 'SL': 1, 'TOTAL AMOUNT': 1, 'TOTAL NUMBER OF VISITS': 1, 'TOTAL COLOPROCTECTOMY WITH': 1, 'loss of 40 dB or more': 1, 'LR-TV': 1, 'tumor protein 40': 1, 'P40': 1, 'tT': 1, 'hydrocephalus.40': 1, 'Slight loss': 1, 'TIF': 1, 'SI.40': 1, 'X-linked multiple congenital anomalies syndrome': 1, 'OligPC 40': 1, 'SIP': 1, 'CM TD': 1, 'remodelling.40': 1, 'TOTAL 496 - 301': 1, 'total body irradation': 1, 'glaucomatous neuropathy.40': 1, 'seekers[40]Migrant': 1, 'Total pseudoepiphysis': 1, 'OAs': 1, 'abnormality Total': 1, 'OND;40': 1, 'TBMA': 1, 'TISAB': 1, 'TDL': 1, 'C:40': 1, 'ADOSE': 1, 'UC.40': 1, 'TER': 1, 'X linked congenital cerebellar hypoplasia': 1, 'TOTAL INDIVIDUALS': 1, "Long Drought'.40": 1, 'beta-amyloid(40)': 1, 'TRE': 1, 'X-linked idiopathic congenital nystagmus3': 1, 'INTERRUPTION OF SV-40': 1, 'TJA': 1, 'X-linked isolated pediatric cataract formation': 1, 'Slight dysmorphism': 1, 'NONE-SLIGHT': 1, 'WS 40': 1, 'VCT': 1, 'TBFs': 1, 'TGSs': 1, 'L:40': 1, 'SJ-G2b 40': 1, 'OP-40': 1, '-CCT': 1, 'SSTF': 1, 'X-linked syndromic cataract': 1, 'LRTG': 1, 'TMQS': 1, 'slight lateral ventricular enlargement': 1, 'Slight lateral ventricular enlargement': 1, 'Slight limitations of ocular movements': 1, 'C-TP': 1, 'Slight Hyperactivity': 1, 'CIN1+ 40': 1, 'metabolic disorder.40': 1, 'VA< 20/40': 1, 'Slight facial dysmorphism': 1, 'TRB': 1, 'TOTAL PROGRAMMATIC': 1, 'X-linked congenital syndromes': 1, 'schizophrenia,40': 1, 'TOTAL DUODENECTOMY': 1, 'Slight poisoning': 1, 'sSM': 1, 'TELRC': 1, 'Congenital X-linked color deficiencies': 1}
|
TOTAL
|
Disease
|
MESH:C535339
|
{'CONCRETENESS EFFECT RELATED TO CORTICAL': 1, 'age-related cortical cataracts': 17, 'age-related visual and cortical disorders': 1, 'age-related cortical cataract': 14, 'ARCC': 11, 'Age-related cortical neurodegeneration': 1, 'Age-related cortical cataracts': 2, 'cortical-related disease': 1, '1 PPC': 1, 'Age-related cortical': 1, 'inherited congenital and age-related cataracts': 1, 'cortical type of ARC': 1, 'CoBRA': 1, 'cortical aging-related tau astrogliopathy': 1, 'Cortical Aging-Related Tau Astrogliopathy': 1, 'AAM-CT': 1, 'Age-related cortical 3': 1, 'Age-related cortical 2': 1, 'cortical neuron-related disorders': 1, 'MRCP': 4, 'age-related cortical': 2, 'X-linked aDMCs': 1, 'ARCCs': 1, 'ACR': 1, 'cortical interneuron-related disorders': 2, 'THALAMO-CORTICAL RELATIONS': 1, 'abnormalities of movement related cortical': 1, 'isolated posterior polar cataract': 1, 'age-related "cortical" cataracts': 1, 'DECODING ATTENTION-RELATED CORTICAL INFORMATION': 1, 'Age-Related Cortical Cataract': 1, 'retardation of age-related epileptic-like cortical activity': 1, 'CSD-related diseases': 1, 'cortical age-related cataracts': 1, 'CARC': 1, 'cortical age-related cataract': 1, 'Age-related cortical decline': 1, 'ARC-C': 1, 'age-related cortical decline': 1, 'age - related cortical cataracts': 1, 'medial temporal or cortical related dysfunction': 1, 'Familial Candidiasis - Age-related cortical cataract': 1, 'age-related declines in cortical': 1, 'cortical ARC': 1}
|
age-related cortical cataracts
|
Disease
|
MESH:C535342
|
{'Lamellar': 28, 'lamellar cataracts': 33, 'Perinuclear lipofuscin': 1, 'ALK': 8, 'Perinuclear antineutrophil cytoplasmic antibody-': 1, 'CTM': 390, 'Perinuclear nonlipofuscin': 1, 'lamellar trama': 2, 'DALK': 203, 'deep anterior lamellar keratoplasty': 6, 'ALTK': 2, 'ZONULAR': 1, 'LBC': 3, 'outer lamellar defect': 1, 'zonular deficiency': 23, 'zonular laxity': 62, 'Perinuclear ANCA': 13, 'zonular disease': 7, 'Degeneration of lamellar bodies': 1, 'FL': 1, 'pANCA': 28, 'Zonular damage': 2, 'autosomal dominant lamellar and Marner cataracts': 4, 'zonular dehiscence': 59, 'LB': 23, 'PNS': 34, 'perinuclear antineutrophil cytoplasmic autoantibodies': 1, 'p-ANCA': 19, 'LK': 25, 'lamellar': 17, 'anterior lamellar defect': 11, 'congenital zonular cataract': 5, 'Lamellar trama': 6, 'zonular or': 1, 'Zonular Dehiscence': 5, 'perinuclear cataract': 2, 'congenital perinuclear and nuclear cataracts': 1, 'anterior lamellar defect of': 1, 'anterior lamellar defect of the': 1, 'LBs': 8, 'Giant lamellar bodies': 1, 'GLBs': 2, 'zonular abnormality': 8, 'P-ANCA': 17, 'LKP': 12, 'P_ANCA perinuclear antineutrophil': 1, 'autosomal dominant lamellar cataract': 3, 'Degenerate lamellar bodies': 1, 'lamellar fractures': 1, 'zonular trauma': 1, 'Perinuclear Anchoring': 1, 'cortical, subcortical, or lamellar cataracts': 1, 'zonular cataract': 5, 'DLKP': 3, 'P/S': 1, 'congenital zonular cataracts': 2, 'MPMC': 1, 'PNMC': 1, 'lamellar degeneration': 10, 'bilateral lamellar cataracts': 6, 'Marner': 5, 'autosomal dominant zonular cataracts': 3, 'A-ANCA': 1, 'LAMELLAR HOLE': 3, 'PLTR': 13, 'PLSU': 6, 'ZD': 15, 'zonular defects': 15, 'or zonular abnormalities': 2, 'anterior lamellar defects of the': 1, 'lamellar keratoplasty': 5, 'zonular abnormalities': 20, 'PT': 8, 'POSTERIOR LAMELLAR': 1, 'posterior lamellar defects': 2, 'deep anterior lamellar': 2, 'lamellare Keratoplastik': 1, 'perinuclear ANCA-associated disease': 1, 'CTM-3': 14, 'lamellar lesions': 7, 'PAS-PT': 4, 'posterior lamellar defect': 4, 'PNRC': 1, 'zonular defect': 13, 'lamellar injuries': 2, 'Zonular cataracts': 2, 'zonular cataracts': 5, 'congenital bilateral zonular cataracts': 1, 'congenital autosomal dominant zonular cataracts': 1, 'autosomal dominant congenital zonular powdery cataracts': 1, 'CTM-15': 10, 'lamellar defect at the': 1, 'lamellar defect': 8, 'lamellar defects': 7, 'lamellar macular defects': 8, 'Lamellar Trauma': 1, 'lax zonular fibers': 1, 'zonular tear': 8, 'congenital perinuclear cataracts': 1, 'Lamellar onychoschizia': 2, 'Zonular Laxity': 1, 'LB abnormalities': 2, 'LB malformation': 1, 'Lamellar cataracts': 8, 'PN': 14, 'nuclear-lamellar cataracts': 1, 'Lamellar keratoplasty': 4, 'zonular fragility': 6, 'zonular instability': 19, 'Lamellar cataract': 6, 'lamellar cataract': 11, 'zonular dysfunction': 2, 'CTM contraction': 1, 'TDALK': 1, 'zonular injury': 7, '-DALK': 2, 'anterior lamellar keratoplasty': 7, 'fetal nuclear lamellar cataracts': 1, 'cortical and lamellar cataracts': 1, 'LAM': 9, 'zonular tears': 1, 'CTM-M': 3, 'Lamellar shadow': 1, 'LAMELLAR MACULAR HOLE': 5, 'Zonular or lamellar cataracts': 1, 'PNL': 1, 'PNH': 1, 'deep anterior lamellar keratoplasy': 1, 'zonular dialysis': 5, 'anterior lamellar damage': 2, 'LNV': 1, 'sporadic multiple (5) and familial multiple (4) tumors': 1, 'Lamellar calcifications': 1, 'PEVs': 2, 'lipoma 5': 1, 'Congenital zonular cataract': 1, 'lamellar body degeneration': 1, 'Zonular laxity': 2, 'TLKP': 1, 'LD-CTM': 1, 'lamellar oedema': 2, 'zonular impairment': 2, 'zonular lamellar cataracts': 1, 'zonular damage': 27, 'Lamellar Injuries': 1, 'lamellar fracture': 3, 'PeriN': 1, 'PERINUCLEAR PLASM': 1, 'PNM': 9, 'deep anterior lamellar keratoplasty dehiscence': 1, 'DALK dehiscence': 1, 'p-ANCA pachymeningitis': 1, 'perinuclear-antineutrophil cytoplasmic autoantibody (p-ANCA) vasculitis': 1, 'ILM': 2, 'zonular': 3, 'Zonular instability': 1, 'lamellar ichthyoisis': 1, 'I-CTM': 1, '-CTM': 2, 'A-CTM': 1, 'Lamellar degeneration': 1, 'LS': 1, 'lamellar bodies degeneration': 1, 'giant lamellar body degeneration': 5, 'Deficiency of lamellar bodies in': 1, 'CTM-2': 1, 'zonular problems': 2, 'Marner cataract': 6, 'lamellar orthokeratosis': 5, 'dilation of PNS': 1, 'lamellar ichythosis': 1, 'lamellar and marner cataracts': 2, 'p-ANCAs': 2, 'LP': 1, 'Perinuclear': 7, 'lamellar keratectomy': 1, 'Lamellar Keratectomy': 1, 'Lamellar keratectomy': 1, 'Zonular cataract': 2, 'lamellar calcification of the falx': 1, 'posterior lamellar tarsal rotation': 4, 'perinuclear antineutrophil cytoplasmic antibodies (': 1, 'APN': 1, '-zonular disruption': 1, 'pnAC': 1, 'Lamellar Bodies': 5, 'LB abnormality': 1, 'lamellar calcifications': 2, 'Zonular deficiency': 1, 'DLK': 4, 'PERINUCLEAR': 1, 'zonular weakening': 2, 'CTM-OM': 1, 'Zonular dehiscence': 13, 'zonular loss': 7, 'LAMELLAR': 16, 'Zonular': 1, 'posterior lamellar dislocation': 2, 'Lamellar bodies': 1, 'renal LB': 1, 'Lamellar Bodies in': 1, 'zonular lesion': 1, 'DALK C': 1, 'Lamellar ischaemia': 1, 'lamellar ischaemia': 1, 'lamellar onychoschizia': 1, 'lamellar dystrophy': 3, 'CTM.4sS': 1, 'Lamellar Cataract': 1, 'Perinuclear-ANCAs': 2, 'nuclear or lamellar cataract': 2, 'Perinuclear-antineutrophil cytoplasmatic antibody': 1, 'perinuclear antineutrophil cytoplasmic': 1, 'CTM-': 2, 'DAL-LK': 1, 'lamellar injury': 10, 'LB in': 1, 'zonular deficit': 1, 'CTM-N2D': 2, 'PNC': 2, 'PL-CTs': 1, 'PL': 1, 'Perinuclear antineutrophil cytoplasmic antibodies (': 1, 'perinuclear ANCA': 4, 'AK': 1, 'nuclear and perinuclear cataracts': 1, 'or zonular defects': 1, 'FALK': 2, 'DM': 1, 'CHARACTERIZATION OF LAMELLAR BODIES': 1, 'autosomal dominant lamellar cataracts': 1, 'anterior lamellar deficiency': 3, 'anterior lamellar defects': 4, 'CLM': 1, 'zonular deficiencies': 3, 'posterior lamellar loss': 1, 'lamellar hyperkeratosis': 6, 'Cortical lamellar cataracts': 1, 'nuclear or lamellar cataracts': 3, 'perinuclear (p)-antibody-associated vasculitis': 1, 'Inter-lamellar degeneration with mucoid replacement': 1, 'zonular lamellar opacification': 3, 'APF': 1, 'Perinuclear-ANCA': 3, 'Lamellar and nuclear cataracts': 1, 'Ciliary zonular dehiscence': 2, 'LM': 2, 'Lamellar necrosis': 2, 'BIOMICROSCOPIC STUDY OF THE ZONULAR FISSURE': 1, 'lamellar disorder': 3, 'Lamellar tarsectomy': 1, 'perinuclear antineutrophil cytoplasmic antibodies': 1, 'DD-DALK': 1, 'Lamellar KeratoPlasty': 1, 'CTM#25': 1, 'CTM#42"My': 1, 'outer lamellar defects of the': 1, 'outer lamellar defects': 1, 'OLD': 1, 'lamellar keratoderma of the palms': 1, 'Perinuclear antineutrophil cytoplasmic': 1, 'perinuclear antineutrophil cytoplasmic antibody': 2, 'Perinuclear antineutrophil cytoplasmic antibody': 1, 'zonular coloboma': 1, 'Zonular abnormality': 2, 'Posterior lamellar tarsal rotation': 2, 'PLK': 2, 'perinuclear-ANCA': 1, 'and lamellar defects of the macula': 1, 'Deep Anterior Lamellar Keratoplasty': 2, 'THE TREATMENT OF LAMELLAR': 4, 'zonular disruption': 3, 'zonular injuries': 2, 'PNV': 1, 'CTM adenocarcinoma': 1, 'zonular incompetence': 1, 'Lamellar splitting': 1, 'Lamellar Bulbous': 1, 'LCB': 1, 'Perinuclear (P': 1, 'Multiple Complex Deficiencies 5': 1, 'LAMELLAR CATARACT': 1, 'LMB': 1, 'Posterior lamellar disc dislocation': 1, 'fibrous lamellar carcinomas': 1, 'Lipoma 5': 2, 'lamellar macular defect': 7, 'lamellar damage': 2, 'post-LKP': 1, 'LAMELLAR SYSTEM IN': 1, 'abnormal lamellar bodies': 1, 'lamellar lesion': 4, 'Perinuclear antineutrophilic': 1, 'zonular degeneration': 3, 'CTM anomalies': 1, 'CTM-SOP': 1, 'lam': 1, 'Lamellar calcification': 1, 'lamellar and nuclear cataract': 1, 'Bilateral zonular': 2, 'bilateral zonular': 1, 'MI-5': 1, 'ultrastructural abnormalities of LB': 1, 'atrophic lamellar defect': 1, 'Posterior lamellar defect': 1, 'CTM-X 15': 1, 'IMAGES CTM 2': 1, 'abnormalities in lamellar bodies': 1, 'PNM type 3': 1, 'CAP-CTM': 3, 'Zonular defects': 1, 'zonular anomalies': 3, 'lamellar ichythiosis': 1, 'Zonular Instability': 1, 'Perinuclear cataracts': 2, 'lipoma:5': 1, 'Lamellar Trama': 1, 'lamellar and dense nuclear cataracts': 1, 'perinuclear antineutrophil': 3, 'deep lamellar keratoplasty': 1, 'Lamellar Macular Defects': 1, 'pNcH.': 1, 'pNcH': 1, 'Zonular juvenile cataract': 1, 'IBperi': 1, 'Perinuclear lipofuscin deposit': 1, 'Nuclear lamellar cataracts': 1, 'lamellar body accumulation': 1, 'autosomal dominant lamellar and Marner cataract': 1, 'CTM fracture': 1, 'LAMELLAR STROMECTOMY': 1, 'Hoof lamellar pathology': 1, 'Lamellar pathology': 2, 'lamellar body abnormalities': 3, 'Perinuclear cararact': 1, 'deep anterior lamellar dystrophy': 1, 'PV': 1, 'abnormalities of lamellar bodies': 2, 'lamellar mineralization': 1, 'zonular traction': 1, 'deep lamellar': 1, 'nuclear and lamellar cataracts': 1, 'zonular dysplasia': 4, 'autosomal-dominant lamellar cataracts': 1, 'Lamellar hyperkeratosis': 4, 'Multi-Lamellar Emulsion': 1, 'MLE': 1, 'multi-lamellar emulsion': 1, 'LAMELLAR SYSTEMS': 2, 'LAMELLAR SCLEROPLASTY': 1, 'LAMELLAR BONE': 1, 'ALR': 4, 'anterior lamellar recession': 1, 'lamellar necrosis': 2, 'defective lamellar bodies': 1, 'hoof lamellar lesions': 1, 'CAP/CTM': 1, 'lenticular or zonular instability': 2, 'LGs': 2, 'ZONULAR CATARACT': 1, 'corneal anterior lamellar replacement': 1, 'Corneal anterior lamellar replacement': 1, 'MLU': 1, 'LAMELLAR BODIES': 2, 'post-DALK': 1, 'deficiencies of zonular ligaments': 1, 'posterior lamellar defect of the upper': 1, 'Lamellar telangictasia': 1, 'lamellar or total cataracts': 1, 'Lamellar body degeneration': 1, 'fibrous lamellar carcinoma': 3, 'lamellar defect of the macula': 1, 'perinuclear [P]-ANCA': 1, 'PERINUCLEAR CLOUD': 1, 'autosomal dominant cortical lamellar cataracts': 1, 'cortical lamellar cataracts': 1, ', lamellar': 1, 'perinuclear antineutrophil cytoplasmic autoantibody vasculitis': 1, 'deep lamellar keratectomy': 1, 'LK) injury': 1, 'LK injury': 2, 'perinuclear antineutrophil cytoplasm antibody (': 1, 'zonular phacodonesis or dehiscence': 1, 'Lamellar hole2': 1, 'Zonular pathology': 1, 'zonular pathology': 1, 'and lamellar cataracts': 2, 'LNLCs': 1, 'DLEK': 3, 'm5C': 1, 'zonular ligament dysplasia': 1, 'or lamellar cataract': 1, 'nuclear/lamellar cataract': 1, 'congenital central, zonular cataract': 1, 'Zonular degeneration of the cornea': 1, 'EL': 1, 'Lamellar coxitis': 1, 'lamellar defect of': 1, 'lamellar tears': 1, 'LALAK': 1, "zonular fibers' injury": 1, 'elastic lamellar degeneration': 1, 'lamellar body deletion': 1, 'perinuclear (p)-ANCA': 1, 'Lamellar and sutural cataracts': 1, 'zonular absence': 1, 'zonular compromise': 2, 'Lamellar and Marner cataracts': 1, 'zot': 1, 'LAMELLAR BODY SECRETION': 1, 'CTM CMV': 1, 'CTM HCV': 1, 'zonular degeneration of the cornea': 1, 'TPS': 1, 'Lamellar or': 1, 'Lb': 1, 'PLCSs': 1, 'zonular disorder': 1, 'dominant zonular congenital cataract': 1, 'ADZCC': 1, 'PNAC': 1, 'Anterior lamellar defect': 1, 'Anterior Lamellar Defects': 1, 'Posterior Lamellar Defects': 1, 'Posterior lamellar defects': 1, 'TOTAL LAMELLAR': 1, 'Zonular Cataracts': 1, 'LBPs': 2, 'dystrophic lamellar calcification': 1, 'Lamellar falx calcification': 1, 'Zonular anomalies': 1, 'Lamellar calcification of the falx': 3, 'CTM disease': 1, 'Anterior lamellar keratoplasty': 1, 'age-related lamellar cataracts': 1, 'PCC': 1, 'lamellar keratoderma': 1, 'lamellar/nuclear cataract': 1, 'Lamellar macular defects': 2, 'CTM Disease': 1, 'P-ANCA associated vasculitides': 1, 'Lamellar oedema': 3, 'LCx': 1, 'Perinuclear-antineutrophil cytoplasmic antibodies': 1, 'perinuclear-antineutrophil cytoplasmic antibodies': 1, 'anterior lamellar deformities': 1, 'lamellar disease,20': 1, "Marner's cataract": 1, 'MEME-5': 1, 'AMNC': 1, 'PP': 1, 'PP adenomas': 1, 'Zonular tear': 2, 'anterior lamellar shortage': 1, '/lamellar cataract': 1, 'STAINING FOR CONFIRMATION OF INTER-LAMELLAR': 1, 'lamellar degeneration in': 1, 'lamellar and nuclear cataracts': 1, 'lamellar abnormal': 1, 'lamellar body deficiency': 1, 'zonular bundling disorders': 1, 'MLB': 1, 'CTM-CMV': 1, 'nuclear, lamellar and cortical cataracts': 1, 'Perinuclear Cataracts': 1, 'perinuclear cataracts': 1, 'lamellar (perinuclear) cataracts': 1, 'bilateral lamellar (perinuclear) cataract': 1, 'zonular fiber abnormalities': 1, 'zonular fiber hypoplasia': 1, 'Lamellar malfunction': 1, 'and zonular defects': 1, 'lamellar body defect': 1, 'posterior lamellar': 1, 'LAMELLAR JUNCTIONAL': 1, 'PARTIAL LAMELLAR': 1, 'irregular lamellar cataracts': 1, 'LMK': 1, 'lamellar microkeratotomy': 1, 'PERINUCLEAR SPACE': 1, 'LN': 1, 'exocystosis of LB': 1, 'CTM-H': 1, 'ZA': 1, 'ZA laxity': 1, 'Loose ZA': 1, 'lamellar calcification': 1, 'zonular diseases': 1, 'PH': 1, 'CLT': 1, 'demyelinating perinuclear lesions': 1, 'Transgluteal Lipoma 5': 1, 'Anterior Lamellar Keratoplasty': 1, 'CTM 3-16-': 1, 'CTM 2-23': 1, 'PEDIATRIC LAMELLAR MACULAR HOLE': 1, 'PLS': 1, 'filament and lamellar degeneration': 1, 'PNF': 1, 'Zonular defect': 1, 'ZFC abnormality': 1, 'ZFD': 1, 'zonular fiber dysplasia': 1, 'lamellar pathology': 1, 'Perinuclear manchette': 1, 'perinuclear manchette': 1, 'lamellar body damage': 1, 'Post-LK': 1, 'post-LK': 1, 'LAMELLAR TEXTURES': 1, 'PNR': 1, 'lamellar opacity cataracts': 1, 'mixed lamellar cataracts': 1, 'ILD': 1, 'CRYSTALLINE LAMELLAR LATTICE': 1, 'lamellar tissue defects': 1, 'perinuclear ANCA-': 1, '-Lamellar Emulsion': 1, 'Multi-Lamellar': 1, 'and lamellar lesions': 1, 'lamellar keratophy': 1, 'Deep lamellar keratophy': 1, 'HII': 1, 'IVF-CTM': 1, 'Lamellar periostosis of the': 1, 'lamellar periostosis of the radius': 1, 'dominant zonular cataracts': 1, 'zonular subluxation': 1, 'Lamellar Defects': 1}
|
CTM
|
Disease
|
MESH:C535343
|
{'posterior polar': 19, 'fracture type 31': 1, 'AO/OTA type 31-A1 or 31-A2 fractures': 1, 'SCA type 31': 1, '3 PPC': 1, 'type 3 PPC': 2, 'type 31-': 2, 'AO/OTA type 31-': 4, 'CONGENITAL POSTERIOR POLAR CHORIORETINAL HYPOPLASIA': 1, 'congenital posterior polar chorioretinal hypoplasia': 2, 'AO types 31-A1 and 31-A2': 1, 'AO/OTA Type 31': 1, 'Cataract 31': 1, 'Posterior polar': 6, 'posterior polar and posterior lentiglobus (': 1, 'posterior polar and posterior lentiglobus cataract': 1, 'Posterior polar and posterior lentiglobus cataracts': 1, 'posterior polar and posterior lentiglobus cataracts': 1, 'PMSC type 31': 1, 'PPCDD': 1, 'posterior polar cortical disc defect': 1, 'posterior polar CC': 1, 'AO/OTA type 31-A fracture': 1, 'Spinocerebellarataxia type 31': 1, 'AO/OTA type 31-A2 and 31-A3': 1, 'Congenital posterior polar chorioretinal hypoplasia': 1, 'posterior polar lesions': 1, 'posterior polar lesion': 1, 'AO fracture type 31': 1, 'Fracture type 31': 1, 'posterior polar"': 1, 'Type 3 PPC': 1, 'AO type 31-A fracture': 1, 'posterior polar dystrophy': 1, 'type 31': 3, 'AO/OTA type 31': 2, 'AO type 31-A': 2, 'posterior polar syndrome': 1, 'AO 31 type fracture': 1, 'type 2 and 3 posterior polar cataracts': 1, 'AO type 31-': 1, 'AO type 31-B and 31-C)': 1, 'cataract:1:31,567': 1, 'Posterior polar lesions': 1, 'OTA type 31 fracture': 1, 'OTA type 31-': 1, 'AO/OTA type-31-A': 1, 'posterior-polar': 1, 'OTA Type 31 fractures': 1, 'CPP3': 3, 'AO type 31': 1, 'cataract.31': 1, 'to type 31': 1, 'and Orthopaedic Trauma Association [AO/OTA] type 31-A1 or 31-A2) fractures': 1}
|
posterior polar
|
Disease
|
MESH:C535344
|
{'TGA type III 11': 1, 'II, and type-11/2': 1, 'type-11 cryoglobulinaemia': 1, 'multiple sclerosis 11': 1, 'MS.11': 6, 'MS,11': 2, 'AQP4 polarity disorder': 1, 'ST11': 3, 'MS:11.9': 1, 'and type-II errors.11': 1, 'CeraRoot type 11': 1, 'CATARACT 11': 1, 'cataract 11': 3, 'multiple sclerosis,11': 3, 'IGS types 4 and 11': 1, 'cataract.11': 2, 'Cataract 11': 1, 'ST-11': 10, 'nephronophtisis type 11': 1, 'type 4 PPC': 2, 'skin type 1 or 11': 1, 'ABC type 11': 1, 'CPP4': 2, 'type 11': 3, 'Mobitz type 11 s block': 1, 'spinocerebellarataxia type 11': 1, 'Lior type 11': 1, 'Epithelioid type 11': 1, '[ST]-11': 1, 'Cardiac 14 Multiple 11 Renal': 1, 'VT-11': 1, 'Cataract*11': 1, 'Bismuth Type 1 or 11': 1, 'ECMs of type 11': 1, 'multiple sclerosis (MS) lesions.11': 1, 'type 11 multiple autoimmune syndrome': 1, 'AO) type 11': 1, '4 posterior polar cataracts': 1, 'CMS type 11': 1, 'MS 1-11': 1, 'MenW CC ST-11': 1, 'CC ST-11': 1, 'DLST type 25-11': 1, 'BA 4p': 1, 'HSP type 11': 1, 'multiple sclerosis.11': 1, 'AO type 11 C': 1, 'and type 11': 1, 'type 1/11 hypoplasia': 1, 'thumb hypoplasia type 1/11': 1, 'premature stop codons (PMSC) type 11': 1, 'Multiple malformation 11': 1, 'skin type 11': 1, 'Type II and III MX-CBD-11': 1, 'sequence type 11': 1, 'AO/OTA type 11-C': 1, 'Filum lipomas:11': 1, 'Cougar type 11': 1, 'type I deficiency.11': 1}
|
ST-11
|
Disease
|
MESH:C535346
|
{'forelock': 8, 'hypopigmentation of the forelock': 1, 'forelock repigmentation': 1, 'forelocks': 1, 'forelock pigmentation loss': 1, 'hypopigmented forelock': 1}
|
forelock
|
Disease
|
MESH:C535349
|
{'depressor': 680, 'ACF': 588, 'unilateral vestibular paresis': 8, 'unilateral upper limb conversion paresis': 2, 'unilateral facial paralysis': 215, 'crying facies': 18, 'unilateral facial palsy': 232, 'Unilateral facial swelling': 9, 'TDT': 11, 'Unilateral paresis': 6, 'unilateral facial drooping': 2, 'unilateral paresis': 21, 'depressor supercilii muscle': 2, 'anguli iridocornialis': 1, 'unilateral facial weakness': 54, 'oris muscle': 11, 'OOM defects': 6, 'Cayler cardio-facial syndrome': 3, 'Cayler Cardio-facial syndrome': 3, 'Cayler Cardio facial syndrome': 1, 'abnormality of depressor angular oris muscle': 1, 'Cayler Cardio-facial Syndrome': 1, 'agenesis of depressor angular oris muscle of the': 1, 'hypoplasia of the depressor anguli oris muscle': 11, 'hypoplasia of depressor angular oris muscle': 1, 'Cayler cardio facial syndrome': 1, 'Cayler Cardio-Facial Syndrome': 1, 'Cayler syndrome': 11, 'ACF-': 3, 'depressors': 24, 'Asymmetric crying facies syndrome': 3, 'asymmetric crying facies': 43, 'congenital hypoplasia of depressor anguli oris muscle': 4, 'levator anguli oris': 9, 'anguli': 4, 'Cardiofacial syndrome': 17, 'agenesis of the depressor anguli oris muscle': 5, 'Asymmetric crying facies': 23, 'unilateral paralysis': 32, 'Unilateral facial paralysis': 18, 'DS': 3, 'hypoplasia of the anguli oris muscle': 1, 'depressor-': 1, 'unilateral idiopathic facial palsy': 5, 'Unilateral facial palsy': 19, 'unilateral facial enlargement': 5, 'defects in the orbicularis oris muscle': 5, 'Unilateral left facial palsy': 1, 'Depressor': 61, 'unilateral partial visual field deficiency': 1, 'velo-cardiofacial syndrome': 16, 'Congenital hypoplasia of the depressor anguli oris (': 1, 'asymmetrical crying facies': 5, 'Congenital unilateral hypoplasia of depressor anguli oris muscle': 1, 'Depressor labii inferioris': 5, 'hypoplasia of the DAO muscle': 1, 'Congenital hypoplasia of the DAO muscle': 1, 'left congenital hypoplasia of the DAO muscle': 1, 'congenital unilateral hypoplasia of the DAO muscle': 1, 'congenital hypoplasia of the DAO muscle': 1, 'cardiofacial syndrome': 23, 'DAO) muscle': 1, 'Congenital hypoplasia of the depressor anguli oris muscle': 6, 'DLI': 10, 'anguli oris': 11, 'DAO': 18, 'Anguli Oris': 3, 'depressor anguli oris': 27, 'Congenital hypoplasia of depressor angularis oris muscle': 2, 'Depressor anguli oris': 10, 'absence of the depressor anguli oris muscle': 2, 'CHDAOM': 4, 'Congenital absence or hypoplasia of the depressor anguli oris muscle': 1, 'unilateral facial neuropathy': 7, 'orbicularis oris muscle defect': 2, 'Orbicularis oris muscle defects': 2, 'unilateral lower motor neuron paresis': 1, 'unilateral facial paresis': 8, 'velo-cardiofacial defect': 1, 'congenital hypoplasia of the depressor anguli oris muscle': 5, 'Unilateral mandibulo-facial dysostosis': 2, 'unilateral canal paresis': 13, 'incompetence of the orbicularis oris muscle': 1, 'congenital anomalies of the orbicularis oris muscle': 1, 'unilateral recurrent eye and facial swelling': 1, 'unilateral eye and facial swelling': 1, 'unilateral gaze paresis': 1, 'brow depressors': 2, 'unilateral facial swelling': 42, 'sahaj adhi-anguli': 1, 'UNILATERAL PARALYSIS OF': 1, 'orbicularis oris muscle defects': 16, 'defects of the orbicularis oris muscle': 8, 'unilateral facial CM': 1, 'depressor labii inferioris': 27, 'depressor labii': 2, 'unilateral facial overgrowth': 1, 'hyperactivity of the depressor septi nasi muscle': 1, 'unilateral leg paresis': 5, 'Idiopathic unilateral paralysis of the palate': 1, 'unilateral facial melanocytosis': 1, 'loss of partial facial sensation': 1, 'unilateral facial atrophy': 25, 'UFP': 1, 'Cayler cardiofacial syndrome': 29, 'unilateral idiopathic facial atrophy': 1, 'unilateral facial deformity': 2, "Cayler's cardiofacial syndrome": 2, 'asymmetric crying face': 13, 'Congenital asymmetric crying facies': 8, 'paralysis of the unilateral facial expression muscles': 2, 'depressor anguli': 3, 'unilateral facial movement disorder': 1, 'unilateral partial obstruction': 4, 'Nodulus-uvula depressor': 1, 'unilateral scalp, facial, and ocular lesions': 1, 'depressor labii inferioris muscle': 7, 'depressor inferioris': 1, 'Unilateral facial lesions': 1, 'unilateral paralysis of the face': 1, 'OOM': 16, 'unilateral facial bone hypoplasia': 1, 'Unilateral facial clefts': 1, 'unilateral facial cleft': 5, 'Cardiofacial syndromes': 1, 'unilateral facial nerve paralysis': 11, 'Defects of the orbicularis oris muscle': 1, 'hyperactivity of orbicularis oris and mentalis muscles': 1, 'unilateral or bilateral paralysis': 4, 'Unilateral facial weakness': 8, 'facial unilateral or bilateral paralysis': 1, 'unilateral abducens paralysis': 3, 'Unilateral paralysis': 10, 'ACF influenza': 2, 'deficiencies of the upper lip orbicularis oris muscle': 1, 'ADN': 22, 'Depressor Labii': 1, 'Depressor Anguli Oris': 4, 'unilateral facial lipoatrophy': 1, 'unilateral rigid paralysis': 1, 'et depressor': 1, 'OO muscle defects': 6, 'OO muscle defect': 4, 'left unilateral paralysis': 1, 'unilateral superior oblique paresis': 6, 'Hyperactivity of the DAO muscle': 1, 'depressor angulii oris': 1, 'precancerous ACF': 2, 'colon ACF': 2, 'unilateral facial hypoplasia': 11, 'velo-cardiofacial': 4, 'Unilateral Facial Paralysis': 4, 'hypoplasia of the DAOM': 6, 'ACF C': 1, 'unilateral cortical facial paralysis': 1, 'unilateral hypoplasia of depressor anguli oris': 2, 'oris muscles': 2, 'unilateral oculomotor paresis': 3, 'depressor helicis': 1, 'bradycardiac and depressor': 2, 'neuro-cardiofacial-cutaneous (NCFC) syndromes': 2, 'cardiofacial': 1, 'unilateral infranuclear facial palsy': 3, 'Unilateral palate paralysis': 1, 'unilateral palate paralysis': 1, 'unilateral vestibular canal paresis': 1, 'colorectal ACF': 2, 'orbicularis oris muscle': 12, 'and depressor': 4, 'congenital absence or hypoplasia of the depressor anguli oris muscle': 2, 'unilateral lower motor neurone facial weakness': 2, 'tensioning of the orbicularis oris muscle': 1, 'Depressor supercilii': 3, 'of unilateral facial muscles': 1, 'subepithelial defects of the orbicularis oris muscle': 1, 'unilateral nerve paralysis': 3, 'post-neuralgic motor paralysis of the unilateral': 1, 'hypoplasia of the right depressor angularis oris': 1, 'depressor angularis oris hypoplasia': 1, 'Unilateral Facial Palsy': 5, 'hasta, anguli paradesha': 1, 'arterial depressor': 2, 'paralysis of unilateral accommodation': 1, 'asymmetric crying facies syndrome': 3, 'deficient of orbicularis oris muscle': 1, 'myocardial depressor': 6, 'unilateral limb paralysis': 8, 'PUDQL': 2, 'unilateral supranuclear paralysis': 2, 'Velo-CardioFacial syndrome': 1, 'Unilateral facial hyperpigmented lesions': 1, 'unilateral facial hyperpigmented lesions': 1, 'unilateral partial central cleft of hand': 1, 'unilateral facial involvement': 2, 'Cayler Cardiofacial syndrome': 5, 'unilateral paralysis of the recurrent nerve': 1, 'DEPRESSOR EFFECT OF PADUTIN': 1, 'Unilateral facial hypoplasia': 1, 'unilateral partial trapezius hypoplasia': 1, 'Coxal depressor': 1, 'unilateral facial movements': 1, 'TmDM': 1, 'unilateral recurrent nerve paralysis': 3, 'Dep MN': 1, 'Unilateral and bilateral facial paralysis': 1, 'unilateral lower motor neuron facial paralysis': 7, 'Asymmetric Crying Face': 2, 'unilateral facial and upper limb anhydrosis': 1, 'myasthenia of the left orbicularis oris muscle': 1, 'depressor of mean arterial pressure': 1, 'DSN muscle depresses': 1, 'Cayler': 2, 'right unilateral facial contractions': 1, 'dysplasia of upper lip orbicularis oris muscle': 1, 'Unilateral leg paresis': 1, 'Unilateral canal paresis': 3, 'peripheral vestibular system unilateral paresis': 1, 'unilateral nerve paresis': 1, 'Congenital Hypoplasia of Depressor Angularis': 1, 'the orbicularis oris muscle': 2, 'Hyperactivity of depressor septi nasi muscle': 1, 'unilateral vestibular paralysis': 6, 'Unilateral paralysis of facial nerve': 1, 'unilateral facial twitching': 1, 'OOMDSCs': 1, 'dental and orbicularis oris muscle anomalies': 1, 'OOM defect': 2, 'unilateral third nerve paresis': 2, 'Unilateral hemidiaphragmatic paralysis': 1, 'unilateral hemidiaphragmatic paralysis': 1, 'triangular and/or asymmetric facies': 1, 'BCACF': 1, 'Orbicularis Oris muscle': 1, 'ACF Tumor': 1, 'unilateral facial palsies': 7, 'Cardiofacial Syndrome': 1, 'left unilateral canal paresis': 1, 'ADM': 1, 'unilateral or bilateral facial paralysis': 6, 'Unilateral paralysis of CN 7': 1, 'unilateral spastic paresis of the upper': 1, 'Spastic unilateral arm paralysis': 1, 'Hypoplasia of depressor anguli oris muscle': 2, 'unilateral and pharyngeal paresis': 1, 'unilateral facial enlargements': 1, 'idiopathic unilateral facial palsy': 1, 'unilateral leg paralysis': 2, 'ADNs': 1, 'unilateral complete suprastapedial facial paralysis': 1, 'of the orbicularis oris muscle': 2, 'unilateral abduction paresis': 2, 'Congenital hypoplasia of depressor-labii-inferioris-muscle': 1, 'asymmetric facies': 11, 'paralysis of the ipsilateral depressor anguli oris muscle': 1, 'CFS': 1, 'Asymmetric Crying Facies': 1, 'unilateral facial and hypoglossal palsy': 1, 'Unilateral recurrent nerve paralysis': 1, 'unilateral paralysis of the facial nerve': 2, 'defects in the orbicularis oris (OO) muscle': 1, 'defects in the OO muscle': 1, 'Depressor anguli oris muscle': 3, 'unilateral facial nevus': 4, 'autosomal dominant cardiofacial syndrome': 1, 'aplasia of the left depressor anguli oris muscle': 1, 'depressor do sistema nervoso central': 1, 'Asymmetric crying face': 4, 'of the depressor anguli oris': 1, 'congenital asymmetric crying facies': 3, 'paralysis of unilateral facial muscles': 2, 'unilateral facial droop': 2, 'defect in the orbicularis oris muscle': 1, 'ACF infections': 1, 'insertion of the orbicularis oris muscle': 1, 'dysplastic ACF': 1, 'depressor and': 1, 'tonic contraction of the orbicularis oris muscle': 1, 'Unilateral infranuclear facial palsy': 1, 'unilateral recurrent paralysis': 2, 'PUDQL injury': 1, 'fMC depressor': 1, 'unilateral right facial palsy': 1, 'DSN': 3, 'hypotrophy of the septal depressor muscle': 1, 'Chin Sutured to orbicularis oris muscle': 1, 'tergal depressor of the trochanter': 1, 'Neonatal asymmetric crying facies': 3, 'Hypoplasias of DAOM': 1, 'DAOM': 12, 'NACF': 3, 'DLIM': 3, 'synkinesis of the Depressor Anguli Oris muscle': 1, 'DAO dysfunction': 2, '-acting depressors': 1, 'unilateral trigeminal motor paralysis': 1, 'Congenital hypoplasia of depressor anguli oris muscle': 2, 'musculus depressor': 1, 'musculus depressor anguli': 1, 'Congenital asymmetrical crying facies': 1, 'unilateral mandibulo-facial dysostosis': 2, 'Takao, Cayler': 1, 'Unilateral paralysis of the last': 1, 'unilateral facial symptoms': 1, "Cayler's syndrome": 2, 'unilateral facial deformities': 2, 'unilateral arm paralysis': 4, 'TTM': 1, 'Asymmetric cry (cardio facial) syndrome': 1, 'depressor rhinarii': 1, 'Congenital unilateral facial paralysis': 1, 'Depressor septi nasalis': 1, 'oris muscle contraction': 1, 'depressor anguli oris muscle': 4, 'ACF-rP': 1, 'ACF- rPOSTN': 1, 'DEPRESSOR': 2, 'unilateral facial compression': 2, 'OOM contraction': 1, 'myopathy of orbicularis oris muscle': 1, 'unilateral or partial colobomas': 1, 'progressive unilateral facial palsy': 1, 'cardiocardiac depressor': 1, 'depressor palpebra': 1, 'depressor effect': 1, 'Tentacle depressors': 1, 'hood depressors': 1, 'hd': 1, 'Hood depressors': 1, 'hood depressor': 1, 'unilateral hemi paresis': 1, 'unilateral vestibular paresis or hypofunction': 1, 'depressor anguli oris muscle abnormality': 1, 'Cayler cardiofacial syndromes': 3, 'barnacle depressor': 2, 'musculus depressor labii': 1, 'OOM duplication': 1, 'anomalies of orbicularis oris muscle': 1, 'NACF syndrome': 1, 'DAOM hypoplasia': 2, 'aplasia/hypoplasia of the DAOM': 1, 'agenesis of DAOM': 1, 'DAOM aplasia or hypoplasia': 1, 'congenital absence of the depressor angularis oris muscle': 1, 'absence of the depressor angularis oris muscle': 1, 'Unilateral facial palsyOptic neuropathyEight': 1, 'Immune-depressors': 1, 'hypoplasia of the contralateral depressor anguli oris muscle': 1, 'unilateral functional paralysis': 1, 'unilateral facial skin signs': 1, 'VCFS': 5, 'hypoplasia or absence of the depressor anguli oris muscle': 1, 'Hypoplasia or absence of the depressor anguli oris muscle': 1, 'of the TDT': 1, 'PUVL': 1, 'padakanistaka anguli': 1, 'unilateral and partial palsies': 1, 'UNILATERAL PARALYSIS': 1, 'facial unilateral algias': 1, 'MDM': 1, 'heartrate depressors': 2, 'Orbicularis Oris marginalis muscle deficiency': 1, 'unilateral facial oedema': 2, 'Unilateral facial oedema': 1, 'depressor nerve': 1, 'depressor supercilii': 1, 'asymmetric or asymmetrical crying facies': 1, 'Unilateral facial palsies': 1, 'depressor mandibulae': 1, 'unilateral facial microsomia': 2, 'unilateral facial vitiligo': 1, 'depressor and bradycardic': 3, 'cardiofacial defects': 1, 'cardiofacial abnormalities': 1, 'Depressor supercilii muscle': 1, 'Unilateral facial cleft': 1, 'unilateral sided paresis': 1, 'ACF meningioma': 1, 'flaccid unilateral facial paralysis': 1, 'unilateral impairments in facial movement': 1, 'Hyperactivity of depressor anguli oris': 1, 'injury to the orbicularis oris muscle': 2, 'm. depressor': 1, 'unilateral wing and leg paralysis': 1, 'Cayler Cardiofacial Syndrome': 1, 'hyperactivity of the superior orbicularis oris muscle': 1, 'UNILATERAL PARALYSIS OF ACCOMMODATION': 1, 'unilateral extremity or facial weakness': 1, 'congenital hypoplasia of the depressor anguli muscle': 1, 'hypoplasia of the depressor labii inferioris muscle': 1, 'congenital hypoplasia of the depressor anguli oris and depressor labii inferioris muscles': 1, 'depressor activity': 1, 'UCP': 2, 'Asymmetric cry syndrome': 1, 'asymmetric cry syndrome': 1, 'ACS': 1, 'asymmetric crying faces': 1, 'unilateral labyrinthine paralysis': 2, 'absence or hypoplasia of the depressor anguli oris muscle': 2, 'velo-cardiofacial syn-drome': 1, 'hyperactivity of the depressor anguli oris': 1, 'unilateral disease of the facial musculature': 1, 'Congenital hypoplasia or absence of the depressor anguli oris muscle': 1, 'NCFC syndromes': 1, 'NCFC': 1, 'cardiofacial-cutaneous syndrome': 1, 'palsy of the orbicularis oris muscle': 1, 'colonic ACF': 1, 'paralysis of the unilateral facial muscle': 1, 'unilateral facial anomalies': 2, "crying facies--Hoefnagel's syndrome": 1, 'dysplasia of the DAOM': 1, 'ACF syndrome': 2, 'congenital ACF syndrome': 2, 'neonatal ACF': 1, 'Congenital asymmetric crying facies syndrome': 1, 'OO muscle': 1, 'unilateral lower facial paresis': 1, 'unilateral horizontal gaze paresis': 1, 'movement of depressor anguli oris muscle': 1, 'Unilateral facial nerve paralysis': 2, 'muscle depressors': 1, 'lip muscle depressors': 1, 'AORTIC-DEPRESSOR NERVE SECTION': 1, 'hypofunction of orbicularis oris muscle': 1, 'velo-cardiofacial Syndrome': 1, 'unilateral fourth nerve paresis': 1, 'DMs': 1, 'ACF extra-axial mass': 1, 'unilateral arm and facial weakness': 1, '-depressor': 1, 'aplasia of the depressor anguli oris muscle': 2, 'unilateral facial clefts': 1, 'levator anguli oris muscles': 1, 'Hypoplasia of the depressor anguli oris muscle': 1, 'unilateral palsy of lower CNs': 1, 'asymmetrical facies': 2, 'unilateral convergence paralysis': 1, 'of the depressor labii inferioris muscle': 1, 'Depressor Labii Inferioris': 2, 'cardiofacial-cutaneous syndromes': 1, 'FOVEOLAE ANGULI ORIS': 1, 'depressor anguli oris muscle hypertonicity': 1, 'Depressor Anguli Oris Muscle Block': 1, 'Depressor anguli oris muscle hypertonicity': 1, 'Depressor anguli oris muscle block': 1, 'depressor anguli oris muscle block': 1, 'unilateral facial and cerebral malformations': 1, 'Chronic unilateral facial ulcer': 1, 'depressor labii lateralis': 1, 'Anguli pramana': 1, 'facial unilateral hypoplasia': 1, 'tonic depressor': 1, 'unilateral idiopatic facial palsy': 1, 'unilateral facial movement disorders': 1, 'facial unilateral redness': 1, 'Unilateral paralysis of the face,': 1, 'DSN muscle': 1, 'unilateral laryngeal paresis': 1, 'Unilateral laryngeal paresis': 2, 'unilateral right facial and frontal-temporal subcutaneous lipomas': 1, 'maldevelopment of the depressor anguli oris': 1, 'of bilateral depressor muscles': 1, 'orbicularis oris marginalis muscle deficiency': 1, 'unilateral phrenic paralysis': 1, 'unilateral phrenic nerve paralysis': 3, 'congenital hypoplasia of depressor anguli oris muscle syndrome': 1, 'vaso-depressor': 2, 'unilateral partial facial paralysis': 3, 'velo--cardiofacial syndrome': 1, 'PACF': 1, 'hyperactivity of the orbicularis oris muscle': 1, 'unilateral facial defects': 1, 'Dep': 1, 'unilateral facial sclerodermia': 1, 'l-cyst-ACF': 1, 'postoperative unilateral paresis': 1, 'muscle depressor': 1, 'asymmetrical flat facies': 1, 'ACF-dAVF': 1, 'agenesis or hypoplasia of the depressor anguli oris muscle': 5, 'unilateral canal paralysis': 2, 'Hyperactivity of the depressor anguli oris muscle': 1, 'cleft/OOM defect': 1, 'superior orbicularis oris muscle (OOM) defects': 1, 'Orbicularis oris muscle defect': 1, 'myocardial depressors': 2, 'unilateral enlargement of facial muscles': 1, 'motor deficits of unilateral facial palsy': 1, 'Asymmetric neonatal crying': 1, 'agenesis or hypoplasia of depressor anguli oris muscle': 1, 'm. DM': 1, 'm. depressor mandibulae': 3, 'dysmorphic and asymmetric crying face': 1, 'congenital hypoplasia of the depressor angularis oris muscle': 1, 'depressor septi nasalis': 1, 'involuntary unilateral twitching of the facial muscle': 1, 'Depressor labii inferioris muscle': 2, 'Levator anguli oris': 1, 'a. depressor labii inferioris muscle': 1, 'unilateral facial skeletal cleft': 1, 'Unilateral partial facial palsy': 1, 'weakening of orbicularis oris muscle strength': 1, 'depressor labia muscle': 1, 'hypoplasia of orbicular oris muscle': 1, 'paralysis of the depressor anguli oris': 1, 'Postoperative paralysis of the depressor anguli oris': 1, 'Idiopathic Unilateral Paralysis of the Palate': 1, 'Depressors': 1, 'Cayler syndromes': 1, 'ACF-HS': 1, 'depressor septi nasi muscle hyperactivity': 1, 'spastic unilateral paralysis': 1, 'depressor angular oris muscle': 1, 'unilateral mandibulo facial dysostosis': 1, 'supranuclear unilateral paralysis of 2': 1, 'Anguli Oris syndrome': 1, 'ACF-S': 1, 'depressor supercilii muscle block': 1, 'Depressor supercilii muscle block': 1, 'deficiencies of the orbicularis oris muscle': 1, "Cayler's cardio-facial syndrome": 1, 'Hypoplasia of the depressor angulae oris muscle': 1, 'unilateral facial skeletal deformities': 1, 'weakness of the levator anguli oris muscle': 1, 'OR': 1, 'unilateral facial anomaly': 2, 'neuro-cardiofacial-cutaneous syndromes': 1, 'unilateral upper and lower facial palsy': 1, 'crying facies syndrome': 1, 'unilateral facial hypoplasia and': 1, 'UPN': 1, 'Unilateral partial brain overgrowth': 1, 'Depressor septinasi': 1, 'Aplasia of the depressor anguli oris muscle': 1, 'sadness - depressor anguli oris': 1, 'levator anguli oris muscle': 1, 'unilateral obliquus superior paresis': 1, 'hypoplasia of depressor anguli oris muscle': 2, 'unilateral paralysis of many': 1, 'N. depressor': 1, 'corneal depressor muscle': 1, 'incontinence of the of the orbicularis oris muscle': 1, 'defects of the superior orbicularis oris muscle': 1, 'system depressor': 1, 'unilateral facial and limb palsy': 1, 'sadness depressor': 1, 'unilateral facial selling': 1, 'Leg depressor': 1, 'coxal depressor': 1, 'unilateral facial deficiencies': 1, 'idiopathic unilateral lower motor neurone facial weakness': 1, 'unilateral paralysis of the': 3, 'depressor labii inferioris hyperactive muscle': 1, 'unilateral facial angioma': 2, 'Wing depressor muscles': 1, 'caylor cardiofacial syndrome': 1, 'unilateral FP': 1, 'unilateral permanent facial palsy': 1, 'unilateral partial vestibular paralysis': 1, 'unilateral otitis with facial nerve paralysis': 1, 'DM': 1, 'tear of the orbicularis oris muscle': 1, 'cardiofacial association': 1, 'paralysis of the unilateral facial muscles': 1, 'unilateral superior oblique (SO) paresis': 1, 'anal depressor muscle': 2, 'UNILATERAL FACIAL': 1, 'Postoperative unilateral facial oedema': 1, 'left or right unilateral facial paralysis': 1, 'levator anguli oris facialis': 1, 'ACF carcinomas': 1, 'unilateral arm paresis': 2, 'unilateral hypoplasia of the depressor anguli oris muscle': 1, 'Asymmetric Crying Facies Syndrome': 1, 'agenesis or hypoplasia of the DAOM': 1, 'ACF asymmetry': 1, 'neonatal asymmetric crying facies (ACF) syndrome': 1, 'congenital asymmetric crying facies (ACF) syndrome': 1, 'Neonatal ACF': 1, 'ACF symptom': 1, 'neonatal asymmetric crying facies syndrome': 1, 'hypoplasia of depressor anguli oris': 1, 'CACF': 1, 'depressores': 1, 'depressor palsy': 1, 'AODN': 1, 'Neurogenic depressor': 1, 'depressor labii inferioris (DLI) dysfunction': 1, 'DLI dysfunction': 1, 'hypoplasia of the anguli oris depressor muscles': 1, 'familial hypoplasia of the anguli oris depressor muscle': 1, 'UPD': 1, 'unilateral partial peripheral facial nerve paralysis': 1, 'unilateral facial symptom': 1, 'unilateral intrauterine facial necrosis': 1, 'depressor anguli oris hypertonicity': 1, 'cardiofacial syndromes': 1, 'unilateral saccadic paralysis': 2, 'Unilateral total facial palsy': 1, 'dysfunction of the TDT': 1, 'TDT muscle': 1, 'cleft of the OOM': 1, 'clefting of the orbicularis oris muscle': 1, 'Pure motor unilateral leg paresis': 1, 'hypofunction of the orbicularis oris muscle': 1, 'bilateral and unilateral facial paralysis': 1, 'absence of depressor anguli oris muscle': 1, 'Cayler cardiac syndrome': 1, 'unilateral recurrential paralysis': 1, 'unilateral facial malformation': 1, 'unilateral finger extension paresis': 1, 'Oxyscelio anguli': 1, 'Oxyscelio_anguli': 1, 'Cayler cardiofacial': 1, 'unilateral facial trauma': 1, 'congenital hypoplasia of depressor anguli oris': 1, 'Congenital hypoplasia of depressor anguli oris': 1, 'Congenital unilateral hypoplasia of depressor anguli oris': 1, 'congenital unilateral hypoplasia of depressor anguli oris': 1, 'unilateral, lower facial palsy': 1, 'unilateral paresis of the facial nerve': 1, 'DSNm': 1, 'I and II DSNm': 1, 'unilateral partial squat': 1, 'RUPS': 1, 'PI-ACF': 1, 'unilateral RPD': 1, 'M. levator anguli oris': 1, 'bilateral or unilateral facial paralysis': 1, 'depressor muscles': 1, 'unilateral facial and upper limb oedema': 1, 'Depressor Angularis': 1, 'Hypoplasia of Depressor Angularis': 1, 'DiGeorge and Cayler syndrome': 1, 'hypoplastic depressor angularis oris muscle': 1, 'unilateral congenital hypoplasia of depressor angularis oris muscle': 1, 'congenital hypoplasia of depressor angularis oris muscle': 1, 'unilateral central paresis of the': 1, 'developmental aplasia of the left depressor anguli oris muscle': 1, 'Velo-cardiofacial syndrome': 1, 'depressor anguli oris muscle deficiency': 1, 'Cayler cardiofacial and autosomal dominant Opitz-G/BBB syndromes': 1, 'unilateral facial deficiency': 1, 'Unilateral Facial Deficiency': 1, 'congenital absence or hypoplasia of depressor anguli oris muscle': 1, 'Intramuscular haemangioma of the levator anguli oris': 1, 'Congenital unilateral oculo-facial paralysis': 1, 'Postoperative symptoms after unilateral paresis': 1, 'unilateral ocular paralysis': 1, 'ACF 2': 1, 'fusion defects of orbicularis oris muscle': 1, 'orbicularis oris muscle fusion': 1, 'behavioral depressor effect': 1, 'contraction of orbicularis oris with orbicularis oculi muscle': 1, 'unilateral descending paralysis': 1, 'unilateral facial degeneration of fat': 1, 'vestibular, unilateral facial sensory, and gustatory symptoms': 1, 'unilateral facial weakness of upper and lower face': 1, 'depressor menti': 1, 'depressor menti muscle wasting': 1, 'unilateral facial palsy reanimation': 1, 'depressor anguli oris overactivity': 1, 'unilateral facial muscle twitching': 1, 'congenital cardiofacial defects': 1, 'CPUO': 1, 'multiple unilateral paralysis of the nerves': 1, 'unilateral plantarflexor paralysis': 1, 'depressor anguli oris weakening': 1, 'ADNA': 1, 'orbicularis oris (OO) muscle anomalies': 1, 'paralysis of the ipsilateral depressor anguli oris': 1, 'weakness of the depressor anguli oris': 1, 'Orbicularis oris muscle injury': 1, 'muscular defects in the orbicularis oris muscle': 1, 'Pulmonary depressor': 1, 'orbicularis oris muscle contraction': 2, 'Levator anguli oris facialis': 1, 'bilateral from unilateral paralysis': 1, 'musculus depressor labii inferioris': 1, 'UNILATERAL FACIAL PARALYSIS': 1, 'Unilateral body paralysis': 1, 'unilateral arm and hand paresis': 1, 'Orbicularis oris muscle': 1, 'deficiency of the orbicularis oris muscle': 1, 'depressor anguli oris paralysis': 1, 'unilateral facial dystonia': 1, 'unilateral paralysis and weakness': 1, 'DEPRESSOR ACTIVITIES OF SOME SUBSTITUTED SYDNONES': 1}
|
depressor
|
Disease
|
MESH:C535351
|
{'CAPOS syndrome': 62, 'CAPOS) syndrome': 3, 'CAPOS': 55, 'Capo Peloro': 1, 'capo aria': 1, 'da capo aria': 1, 'CAPOS Syndrome': 6, 'CF': 1, 'CA': 1, 'CAPOS syndromes': 1, 'CAPOS overlap syndrome': 1, 'Capo II': 1, 'CaPo-tris': 1, 'CaPo-bis': 1, 'CaPo': 1, "Capo d'Istria": 1, 'Da capo-crescendo': 1, 'capos': 1, 'CAPOS 5 syndrome': 1, 'CAPOs': 1, 'cAPOE': 1}
|
CAPOS syndrome
|
Disease
|
MESH:C535352
|
{'Subacute cerebellar syndrome': 3, 'SCD subacute cerebellar degeneration': 1, 'subacute cerebellar syndrome': 1, 'SCCD': 1, 'Subacute cerebellar degeneration': 4, 'SCD': 4, 'Subacute Cerebellar syndrome': 1, 'subacute cerebellar degeneration': 2, 'Cerebellar subacute syndrome': 1, 'cerebellar subacute infarctionCT': 1}
|
Subacute cerebellar degeneration
|
Disease
|
MESH:C535355
|
{'rMDD': 97, '-remitting': 156, 'RGD': 16, 'Remitting seronegative symmetrical synovitis with pitting edema': 38, 'remitting seronegative symmetrical synovitis with pitting edema': 19, 'Remitted disorder': 1, 'remitting': 91, '-remitting disease': 6, '-remitting MS': 18, '- remitting': 1, 'Paraneoplastic remitting seronegative symmetrical synovitis with pitting edema': 2, 'Remitting Seronegative Symmetrical Synovitis with Pitting Edema': 8, '-remitting multiplesclerosis': 1, 'remitting disorder': 1, 'PR': 1, 'rLLD': 3, 'RMDD': 3, 'remitting symmetrical seronegative synovitis with pitting edema': 1, 'relapsing-remitting inflammation': 2, 'rLOD': 6, 'remitting hemicrania continua': 1, '-remitting or': 1, 'Remitted depression': 3, '-remitting 14': 1, 'remitting seronegative symmetrical synovitis': 2, 'HC rMDD': 1, 'RR': 1, 'remitting MS': 10, 'RD': 16, '-remitting (RR': 1, 'remitting disease': 8, '-remitting demyelinating phenomenon': 1, 'RMD': 15, 'RBD': 1, 'non-affective, acute, remitting psychosis': 2, 'non-affective, acute remitting psychoses': 1, 'NARP': 6, 'MDD': 1, 'Remitting Psychosis': 1, 'relapsing and remitting multifocal CNS symptoms': 1, 'REMITTED OUTPATIENT SCHIZOPHRENICS': 1, 'RemIT-JAV-RPGN': 1, '-remitting paralysis': 1, 'remitting focal epilepsy': 1, 'and remitting diseases': 1, 'Remitting seronegative symmetrical synovitis with pitting oedema': 9, 'rFED': 2, 'rRD': 2, '/remitting diseases': 1, 'bilious remitting fever': 3, 'Remitting seronegative symmetrical synovitis with pitting edema syndrome': 2, 'RRMS': 2, 'rMDD HC rMDD': 1, 'acute remitting psychosis': 2, '-remitting headache': 1, 'REMIT': 5, 'REM': 2, 'remitting leukodystrophy': 1, 'non-affective acute remitting psychosis': 3, 'remitting MSEDSS': 1, ', remitting': 1, 'REMITTED': 3, 'remitting diabetes': 1, 'Idiopathic remitting diabetes': 1, 'idiopathic remitting diabetes': 1, 'Remitting diabetes': 1, 'rMD': 5, 'RLOD': 1, 'REMITTING SCHIZOPHRENIAS': 2, 'Remitting': 5, 'RemIT-JAV-': 1, 'Syndrome of remitting seronegative symmetrical synovitis with pitting oedema': 1, 'Remitting seronegative, symmetric synovitis with pitting edema': 1, 'RRMS relaxing-remitting MS': 1, 'Remitting seronegative symmetric synovitis with pitting edema': 2, 'remitting seronegative symmetric synovitis with pitting edema': 1, 'rBD': 4, '-Remitting': 9, 'remitting sclerosis': 1, 'chronic and remitting arthritis': 1, 'late remitting arthritis': 1, 'SRDDBC': 1, 'Remitting seronegative syndrome': 1, 'remitting macular oedema': 1, 'RemIT-JAV': 2, 'Idiopathic remitting seronegative symmetrical synovitis': 1, 'Remitting seronegative symmetrical synovitis with pitting oedema syndrome': 1, 'NRD': 1, '-remitting autoimmune uveitis': 1, '-remitting SPMS': 1, '-remitting or secondary': 1, 'relasping-remitting (RR': 1, 'rNMD': 2, 'rheumatoid remitting': 1, 'remitting fever': 5, '-remitting Secondary-': 1, 'Relapsing-remitting chronic lymphocytic inflammation': 1, 'Remitting MultipleSclerosis': 1, 'dRelapsing-remitting disease': 1, 'paraneoplastic remitting seronegative symmetrical synovitis with pitting edema': 1, 'REMIT-UC': 1, 'DEP': 1, 'Depressed': 1, 'remitting seronegative symmetric synovitis with pitting oedema': 2, 'Remitting Seronegative Symmetrical Synovitis With Pitting Edema': 2, '-remitting stable': 1, '-remitting sALS': 1, '-remitting Asthma': 1, 'Remitting demyelinating disease': 1, 'relapsing and remitting disorders of inflammation': 1, 'HC rMD': 1, 'Remitting fasciitis': 1, 'MDD-RM': 1, 'Familial remitting chorea': 1, 'remMDD': 1, 'and remitting': 1, '-remitting inflammatory diseases': 1, 'remitting psychosis': 1, 'juvenile remitting epilepsy': 1, 'NoREM': 1, 'remitting seronegative symmetrical synovitis with pitting edema syndrome': 2, '-remitting N/A': 1, '-remitting;PP': 1, 'remitted psychotic depression': 1, 'Remitted psychotic depression': 1, 'remitting (RR': 1, 'relapsing-remitting and inflammation-related': 1, 'remitting seronegative symmetrical synovitis with pitting oedema': 2, 'Remitted': 1, 'Chronic/remitting neurological disease': 1, 'familial genetic nystagmus': 1, '-remitting disease course': 1, '-remitting chronic disease of the gastrointestinal system': 1, '-remitting SP': 1, 'chronic relapsing remitting inflammation': 1, 'RemIT': 2, 'Remitting ataxia': 1, 'rrMDD': 2, 'remitting seronegative syndrome': 1, 'remitting periodontitis': 1, 'rCUD': 1, 'remitting seronegative symmetrical synovitis with': 1, 'Familial remitting polyneuropathy': 1, 'remitting-': 1, 'nonaffective acute remitting psychoses': 1, '-remitting diseases of the gastrointestinal tract': 1, 'relapsingl remitting sclerosis multiplex': 1, 'Remitting symmetrical seronegative synovitis with pitting edema': 1, '-remitting disease of the gastrointestinal tract': 1, 'Remitting symmetrical seronegative synovitis and pitting edema': 1, 'Relapsing-remitting tumefactive inflammation': 1, 'remitting seronegative symmetric synovitis with': 1, 'Remitting seronegative symmetrical synovitis pitting oedema': 1, 'rrMDD HC': 1, '-remitting (RR)': 1, 'remitting.mp': 1, 'Remitting Multiple Sclrosis': 1, 'remitting inflammation': 1, 'Remitting (RR': 1, 'Remitting-recurrent': 1, 'Remitting-RelapsingMultiple Sclerosis': 1, '-remitting multiple clerosis': 1, 'Remitting Seronegative Symmetrical Synovitis with Pitting Oedema': 1, 'REMITS': 1}
|
-remitting
|
Disease
|
MESH:C535356
|
{'bifocal carcinoma': 6, 'Bifocal fractures': 1, 'BF': 2, 'bifocal chorioretinal atrophy': 13, 'femoral or bifocal deformity': 1, 'femoral and bifocal deformity': 1, 'Bifocal': 1, 'Bifocal disease': 1, 'bifocal diseases45': 1, 'bifocal disease': 5, 'bifocal': 8, 'bifocal deformity': 1, 'BIF': 1, 'PBCRA': 7, 'progressive bifocal chorioretinal atrophy': 5, 'bifocal intradural melanocytoma': 1, 'bifocal melanocytoma': 1, 'bifocal fracture of the mandible': 1, 'Weakened bifocal sensation': 1, 'weakened bifocal sensation': 1, 'CHARACTER PROBE BIFOCALS': 2, 'BIFOCAL FRACTURES OF THE LEG': 1, 'Bifocal leg fractures': 1, 'bifocal leg fractures': 1, 'bifocal pedicular fracture': 1, 'Posterior arch bifocal fracture of the atlas vertebra': 1, 'BIFOCALS': 2, 'BIFOCAL': 1, '(BF/BC)': 1, 'bifocal CL': 1, 'Bifocal CL': 1, 'bifocal callotasis': 1, 'BiF.': 1, 'autosomal dominant progressive bifocal chorioretinal atrophy': 1, 'PBCRA) disease': 1, 'bifocal fractures': 2, 'Bifocal fractures of the leg': 2, 'bifocal myonecrosis': 1, 'Bifocal pap 1': 1, 'bifocal carcinomas': 1, 'bifocal chorioretinal dystrophy': 1, 'BiFC': 1, 'BIFOCAL LEG': 1, 'bifocal diseases': 1, 'bifocal injuries of the radius': 1, 'progressive bifocal retinochoroidal atrophy': 1, 'PBRCA': 1, 'bifocal amyloidomas': 1, 'Progressive bifocal chorioretinal atrophy': 1, 'BiF': 1, 'BIFOCAL LENS': 3, 'BDO': 1, 'bifocal stroke': 1}
|
bifocal chorioretinal atrophy
|
Disease
|
MESH:C535357
|
{'CP calcification': 5, 'calcification of the choroid plexus': 15, 'cerebral calcifications syndrome': 2, 'CEC': 1, 'Cerebral calcifications syndrome': 1, 'choroid plexus calcification': 39, 'choroido-neovascular membrane': 1, 'calcification of the cerebral choroid plexus': 1, 'LCP calcification': 1, 'calcification of pineal, RCP': 1, 'calcification of RCP': 1, 'ChP calcification': 1, 'Choroid plexus calcification': 11, 'Choroid plexus calcifications': 4, 'Extrapineal calcifications of the choroid plexus': 1, 'pineal gland and choroid plexus calcifications': 1, 'choroid plexus calcifications': 12, 'calcification of choroid plexus/': 1, 'calcifications of the choroid plexus': 1, 'choroidal plexus calcification': 1, 'calcifications of choroid plexus/pineal gland': 1, 'CPC': 8, 'choroido-retinits': 1, 'calcific xanthomatosis of the choroid plexus': 1, 'calcification of pineal body and choroid plexus': 1, 'cerebral calcification syndrome': 4, 'calcification of choroid plexus': 1, 'calcification of the CP': 1, 'CP calcifications': 1, 'plexus calcifications': 1, 'oDVP retardation': 1, 'calcification of falx cerebri and choroid plexus': 1, 'CEC syndrome': 1, 'calcification of pineal gland/choroid plexus': 1, 'calcification of choroids plexus': 1, 'dura and choroid plexus calcifications': 1, 'calcifications in the choroid plexus': 2, 'choroido-retinopathy': 1, 'Calcification of the choroid plexus': 2, 'ChP calcifications': 1, 'LARVAL CHOROIDO-': 1, 'retino/choroido-vascular diseases': 1, 'Familial choroid plexus calcification': 1, 'Choroidal calcification Developmental delay Seizure': 1, 'choroids plexus calcification': 1, 'plexus calcification': 1, 'calcification of the falx cerebri and choroid plexus': 1, 'CHOROIDO-': 1, 'CHOROIDO-EPENDYMAL': 1, 'Choroid Plexus Calcification': 2, 'calcification of choroid plexus blood vessels': 1, 'calcification of choroid plexus blood': 1, 'Choroido-vitreal neovascularization': 1, 'Choroido-cerebral calcification syndrome': 1}
|
choroid plexus calcification
|
Disease
|
MESH:C535358
|
{'choroidal sclerosis-type change': 1, 'choroidal sclerosis': 96, '-areolar': 29, 'peripapillary choroidal sclerosis': 2, 'Central Areolar Choroidal Dystrophy': 7, 'CACD': 68, 'central areolar choroidal dystrophy': 90, 'areolar': 24, 'supra areolar lesion': 1, 'areolar choroidal dystrophy': 45, 'autosomal dominant central areolar choroidal dystrophy': 4, 'AD central areolar choroidal dystrophy': 1, 'areolar complex': 4, 'areolar micropigmentation': 1, 'naevoid areolar hyperkeratosis': 1, 'Central areolar choroidal dystrophy': 33, 'areolar sclerosis': 3, 'areolar necrosis': 18, 'central areolar chroidal dystrophy': 2, 'Central areolar atrophy': 1, 'choroidal show and sclerosis': 1, 'Choroidal sclerosis': 7, 'PAT': 2, 'cutaneous or areolar necrosis': 1, 'areolar choroidal atrophy': 8, 'areolar chorioretinal dystrophy': 4, 'areolar swelling': 3, '-areolar complex': 12, 'areolar deformity': 4, 'areolar depigmentation': 6, 'Central areolar choroid dystrophy': 2, 'Central areolar dystrophy': 1, 'sclerosis" of the choroid': 1, 'sclerosis of the choroidal vessels': 4, 'choroidal vascular sclerosis': 4, 'choroid sclerosis': 5, 'central areolar choroidal sclerosis': 4, 'Central areolar choroidal sclerosis': 3, 'Central areolar chorodial atrophy': 1, 'Autosomal dominant central areolar choroidal dystrophy': 2, 'areolar loss': 2, 'sclerosis of the choroid': 2, 'Circinate choroidal sclerosis': 1, 'Choroidal Sclerosis': 3, 'CACD VRLS': 1, 'CACD RLSP': 1, 'leiomiomas areolares': 1, 'CACD central areolar choroidal dystrophy': 2, "Montgomery's areolar": 1, 'sensitivity disorders of papillo-areolar complex': 1, 'areolar choroiditis': 1, 'areolar atrophy of choroid': 1, 'areolar choroidal sclerosis': 4, 'sclerosis of the choroid vessels': 1, 'areolar epidermolysis': 2, 'CACD disease': 1, 'Choroiditis in multiple sclerosis': 1, 'areolar disease': 2, 'choroidal vessels sclerosis': 1, 'Central areolar choroidal dystrophy AD': 1, 'diffuse choroidal sclerosis': 4, 'areolar sensation loss': 1, 'choroidal dystrophy central areolar': 1, '-areolar Complex': 1, 'areolar lesion': 7, 'choriocapillary and choroidal sclerosis': 1, 'central areolar dystrophy': 2, 'Senile choroidal sclerosis': 1, 'sclerosis of choroidal vasculature': 1, 'MD/central areolar choroidal dystrophy': 1, 'Familial Central and Peripapillary Choroidal Sclerosis': 1, 'areolar atrophy of the choroid': 1, 'Areolar': 1, 'Degenerative choroidal sclerosis': 1, 'CACD macular dystrophy': 1, 'areolar perimetric defect': 1, 'areolar lesions': 6, 'areolar asymmetryNo': 1, 'areolar asymmetryTotal': 1, 'areolar hypoplasia': 3, 'hypopigmented areolar': 1, 'loss of areolar sensation': 1, 'central choroidal dystrophy': 1, 'Central choroidal dystrophy': 1, 'central alveolar choroidal dystrophy': 1, 'X-linked choroidal sclerosis': 1, 'areolar atrophy4': 1, 'areolar deformities': 1, 'CHOROIDAL ANGIO-SCLEROSIS': 1, 'areolar calcification': 1, 'central areolar choroidal dystrophy lesions': 1, 'Central areolar choroidal dystrophy lesions': 1, 'sclerosis of choroidal vessels': 2, 'and areolar': 3, 'circinate choroidal sclerosis': 1, 'paracentral choroidal sclerosis': 1, 'AS': 1, 'areolar eruption': 1, 'CACD (': 1, 'central areolar chorioretinal dystrophy': 2, 'Central areolar chorioretinal dystrophy': 1, 'primary choroid sclerosis': 1, 'Diffuse choroidal sclerosis': 1, 'central areolar': 1, 'areolar choroidal degeneration': 1, ', areolar, or': 1, 'para-areolar swelling': 1, 'Areolar Complex': 1, 'areolar hypochromia': 1, 'Annular choroidal sclerosis': 1, 'Xanthelasma areolare multiplex': 1, 'Bilateral central choroid sclerosis': 1, 'unilateral central areolar atrophy': 1, 'diffuse sclerosis of the choroid vessesl': 1, 'of areolar': 1, 'Choroidal vessel sclerosis': 1, 'Areolar necrosis': 1, 'Posterior polar central choroidal dystrophy': 1, 'Posterior Polar Central Choroidal Dystrophy': 1, 'posterior polar central choroidal dystrophy': 1, 'central and peripheral annular choroidal dystrophy': 1, 'areolar choroidal': 1, 'Central aleolar choroidal dystrophy': 1, 'central aleolar choroidal dystrophy': 1, 'Central areolar macular dystrophy': 1, 'Areolar pulmonary dystrophy': 1, 'Primary choroidal sclerosis': 1}
|
choroidal sclerosis
|
Disease
|
MESH:C535361
|
{'Aortic ring calcification': 3, 'aortic ring calcification': 12, 'Aortic ring anomalies': 3, 'pulmonary ring': 1, 'Ring/Giant chromosome 1': 1, 'Lateral Compression Type 1 Pelvic Ring Injuries': 1, 'lateral compression type 1 pelvic ring injuries': 1, 'lateral compression type 1 (LC1) pelvic ring injuries': 1, 'C-1 ring fracture': 1, 'C-1 ring fractures': 1, 'of one X chromosome 1': 1, 'RCMD-RS 1': 1, 'thoracic aortic ring calcification': 2, 'Tile C.1.2-type injury to the pelvic ring': 1, 'lateral compression (LC)-1 pelvic ring disruptions': 1, 'calcification of aortic rings': 2, 'Seno type 1 fracture of the ring finger': 1, 'compression type 1 pelvis ring injury': 1, 'LC-1 pelvis ring injury': 1, 'LC-1 pelvis ring injuries': 1, 'Muscle Ring Finger (MuRF)1 deficiency': 1, 'lateral compression type 1 [LC1] pelvic ring injuries': 1, 'type B-1 or 2 pelvic ring injuries': 1, 'hypoplastic C-1 ring': 1, 'ring chromosome 1': 1, 'AO/OTA B3.1 pelvic ring injury': 1, 'MGRN1 deficiency': 1, 'C-1 ring disruption': 1, 'constitutional ring 1 chromosome syndrome': 1, 'ring 1 chromosome syndrome': 1, 'absenceof 1 X chromosome': 1, 'ROLE OF UHRF1': 1, 'supernumerary ring chromosome 1 syndrome': 1, 'supernumerary ring chromosome 1': 1, 'LC-1 pelvic ring injury': 1, '1 Ring': 1, 'hypoplastic pulmonary ring': 1, 'uterine leiomyomas with ring chromosome 1': 1, 'Mosaic supernumerary ring chromosome 1': 1}
|
aortic ring calcification
|
Disease
|
MESH:C535362
|
{'1p36)': 1, '1p36 deletion syndrome': 279, '1p36 deletion': 92, 'monosomy 1p36': 41, 'Monosomy 1p36 syndrome': 5, 'monosomy 1p36 deletion': 1, '1p36 microdeletion syndrome': 25, '1p36': 31, '1p36 syndrome': 16, '1p36 delection syndrome': 1, '1p36 terminal deletion': 1, '1p36 Deletion': 3, '1p36 deletion4': 1, '1p36 monosomy syndrome': 3, 'chromosome 1p36 deletion syndrome': 14, '1p36 monosomy': 11, '1p36 chromosomal anomaly': 1, 'monosomy 1p36 syndrome': 17, 'monosomy 1p36.3': 3, '1p36 micro-deletion syndrome': 1, '1p36 abnormalities': 4, 'Deletion 1p36 syndrome': 3, '1p36.3 deletion syndrome': 2, '1p36 deletion syndrome3': 1, '1p36 duplication/deletion': 1, '1p36 duplications and deletion': 1, '1p36 microdeletion': 3, '1p36 del': 1, '1P36 deletion syndrome': 3, '1p36DS': 2, 'monosomy 1p36 deletion syndrome': 6, '1p36 contiguous gene deletion syndrome': 1, 'Monosomy 1p36': 20, 'Chromosome 1p36 deletion syndrome': 16, 'Del 1p36 syndrome': 2, 'monosomy of chromosome 1p36.1': 1, '1p36 deletions': 4, '1p36 1p36 deletion syndrome': 2, 'deletion (monosomy) 1p36 syndrome': 1, 'Monosomy 1p36 deletion': 1, '1p36 Deletion Syndrome': 12, 'deficiency of 1p36': 1, 'deletion 1p36 syndrome': 6, '1p36.3 microduplication syndrome': 1, 'Mnonosomy 1p36 syndrome': 1, '1p36 chromosome deletion': 2, '1p36.33 deletion': 1, '1p36 duplication': 2, '1p36.33': 2, '1p36 deletion syndromes': 5, '1p36-deletion': 1, 'Deletion 1p36': 1, 'del1p36 syndrome': 1, 'del1p36) syndrome': 1, 'Deletion 1p36 Syndrome': 2, '19 1p36 deletion syndrome': 1, '1p36 chromosomal duplication': 1, '1p36 deletions syndrome': 1, '1p36 duplication syndrome': 1, '1p36.32': 1, 'terminal 1p36 deletion syndrome': 1, '1p36 deletion (monosomy) syndrome': 1, 'Monosomy 1p36 deletion syndrome': 2, '1p36.3 deletion': 2, 'Chromosome 1p36 deletion': 2, 'deletion of 1p36.3': 1, 'distal and proximal 1p36 monosomy syndromes': 1, '1p36 monosomies': 1, 'Monosomy 1p36 Syndrome': 3, 'chromosomal abnormality of 1p36 deletion syndrome': 1, 'polymicrogyria-like dysgenesis in monosomy 1p36': 1, 'learning disability 1p36 deletion syndrome': 1, '1p36.13-1p36.12 microdeletion syndrome': 1, '1p36 chromosomal abnormalities': 2, 'epilepsy monosomy 1p36 syndrome': 1, 'monosomy 1p36 Syndrome': 1, 'deletion 1p36': 1, '1p36.31-33-->pter': 1, '1p36.1 deletion': 1, 'deletion of 1p36.1': 1, '20q13.33 deletion syndrome': 1, 'sGTC IV 1.0 1p36 deletion': 1, '1p36.3': 3, 'Chr 1p36 microdeletion syndrome': 1, 'distal 1p36 monosomy syndrome': 1, '1p36 DS': 1, '1p36 1p6 deletion syndrome': 1, '1p36 abnormality': 1, 'chromosome 1p36 abnormality': 1, 'Duplications Deletion 1p36 syndrome': 1, 'deletion 1p36"': 1, '1p36MS': 1, 'del(1p36)': 1, 'chromosome 1p36 deletion syndrome7': 1, '1p36 trisomy': 1, 'microtriplication 1p36': 1, '1p36 - 1p36 deletion syndrome': 1, 'DiGeorge and 1p36 deletion syndromes': 1, 'Chromosome 1p36 Deletion Syndrome': 1, '1p36-deletion syndrome': 1, 'Chr 1p36.32 duplication syndrome': 1, '1p36 deletion syndrome n.a': 1}
|
1p36 deletion syndrome
|
Disease
|
MESH:C535364
|
{'1p21 deletions': 1, '1p21.3 duplication': 1, '1p21': 2, '1p21 deletion': 1}
|
1p21
|
Disease
|
MESH:C535365
|
{'PPC': 1, 'p21 deficiency': 5, 'P21 deficiency': 3, 'P21': 2, 'PAK': 3, 'cTKO;p21': 1, 'PBD': 5, 'Paks': 1, 'EOD-P21.1': 1, 'p21': 1, 'type II PAK': 1, 'p21-pter': 1, 'P21 deletion syndrome': 1, 'P21/c': 1, 'PID': 3, 'p21.3': 1, 'hyperactive Ras': 1, 'Hyperactive Ras': 1, 'X-chromosomal (p21) muscular dystrophy': 1, 'BC P21': 1, 'P21 disease': 1, 'PAK-associated diseases': 1, 'type II PAKs': 1, 'PAMs': 1, 'PANDA': 1, 'PL': 1, 'PT': 1, 'CH_P21': 1, 'deficiency of the (p21 leads to pter': 1, 'p21 carcinomas': 1, 'p21-activated': 1, 'GII.3[P21': 1, 'PD': 1}
|
p21 deficiency
|
Disease
|
MESH:C535369
|
{'RC20': 1, 'ring chromosome 20': 29, 'Ring chromosome 20': 22, 'Ring Chromosome 20': 4, 'ring 20 chromosome anomaly': 1, 'supernumerary minute ring chromosome 20': 2, 'RC 20': 1, 'supernumerary ring chromosome 20': 2, 'ring 20 chromosome': 1, 'Ring 20 chromosome': 1, 'r20': 1, 'with ring chromosome 20': 1, 'Ring-20 chromosome': 1}
|
ring chromosome 20
|
Disease
|
MESH:C535370
|
{'Familial tiny 9p/20p': 1, '20P': 1, 'deletion of chromosome 20p': 2, 'deletion of 20': 2, '20p': 10, 'dup(20p) syndrome': 1, 'monosomy 20p': 3, 'Monosomy 20p': 1, 'deletion of 20p': 2, '20p deletions': 1, 'Deletion of 20p': 1, 'of 20p': 1, 'chromosome 20p deletion': 1, 'monosomy 20p-': 1, 'chromosome 20p': 1, 'Chromosome 20p': 1, 'monosomy of 20p': 1}
|
20p
|
Disease
|
MESH:C535371
|
{'trisomy 20p': 31, 'trisomy of 20p': 1, 'Trisomy 20p': 14, '20p trisomy syndrome': 3, '20p duplication chromosomal abnormality': 1, 'trisomy 20p syndrome': 6, 'trisomy 20p syndromes': 1, 'duplication of 20p': 2, 'duplication 20p': 2, 'duplication 20p syndrome': 1, '20p trisomy': 2, 'Familial trisomy 20p': 1, 'Chromosome 20p duplication': 1, '20p duplications': 1, 'trisomy 20P': 1}
|
trisomy 20p
|
Disease
|
MESH:C535372
|
{'Trisomy 20': 52, 'trisomy 7, 14, 18, 20, 48': 1, 'trisomy 6, 7, 11, 14, 15, 16, and 20': 1, 'trisomy of chromosome 20': 13, 'trisomy 20': 193, '-Trisomy 20 47': 1, 'trisomies 7, 18, and 20': 2, 'monosomy of chromosome 20': 1, 'Chromosome 20': 4, 'trisomy 16 and 20': 1, 'trisomies 2, 3, 4, 5, 18, 20, and 22': 1, 'Trisomy of chromosome 20': 4, 'trisomy-20': 3, 'CHROMOSOME 20': 1, 'trisomy 2 and 20': 1, 'Trisomy 2 and 20': 1, 'trisomies for chromosomes 2 and 20': 1, 'Trisomy 21 20': 2, 'trisomy 21 20': 3, 'trisomies of chromosomes 19 and 20': 1, 'chromosome 20': 14, 'trisomy 19-20': 1, 'trisomies 8 and 20': 4, 'trisomy 7 and 20': 2, 'trisomy 20.70': 1, 'trisomy of the long arm of chromosome 20': 1, 'trisomies of chromosomes 5, 7 and 20': 1, 'trisomies 2 and 20': 2, 'trisomy 2, 7, 8, 12, 18, and 20': 1, 'trisomies 7, 14, and 20': 1, 'trisomy 6, 20, and 21': 1, 'trisomy 6 and 20': 1, 'trisomy-20 syndrome': 1, 'trisomy 7, 14, 18 and 20': 1, 'trisomy 10 and 20': 2, 'trisomies 3, 8, 11, 15, 16, 20, and 22': 1, 'Autosomal trisomy 20': 1, 'Chromosome 20 [r(20)] syndrome': 1, 'Trisomies 8 and 20': 2, 'Trisomy 20 PHM': 1, 'Trisomy 8 and 20': 3, 'monosomy for chromosome 20': 1, 'T20': 2, 'Polysomy of chromosomes 2 and 20': 1, 'Chromosome 20 Syndrome': 1, 'trisomy 12 and 20': 1, 'trisomies 8, 11, and 20': 2, 'Gains on chromosome 20': 1, 'gains on chromosome 20': 1, 'trisomies X, 7, and 20': 1, 'heteromorphism of chromosome 20': 1, 'trisomies 5 and 20': 1, 'of chromosome 20': 3, 'trisomy 16, 20 or 12': 1, 'trisomy of chromosome 6, 7, 11, 14, 15, or 20': 1, 'trisomies 20 and 11': 1, 'Gain of chromosome 20': 4, 'mosaic trisomy 20': 2, 'Mosaic trisomy 20': 2, 'trisomy 15, and 20': 1, 'chromosomes 20': 1, 'trisomies 4, 7, 10, 14, 16, 20 and 22': 1, 'trisomies 8, 16 and 20': 1, 'trisomy 12, 16 and 20': 1, 'chromosome 20 associated disorders': 1, 'trisomies 2, 5, 11, and 20': 1, 'trisomies of chromosomes 2 and 20': 1, 'Trisomy of Chromosome 20': 1, 'trisomy 20 syndrome': 1, 'Trisomy 20, 21, and 22': 1, 'trisomy 4, 7, 8, 14, 15, 19, or 20': 1, 'trisomies 7 and 20': 2, 'trisomy 8 and/or 20': 1, 'Trisomy 11, 18, 19, and 20': 1, 'trisomy 18 20': 1, 'trisomy 20 and 8': 1, 'trisomy 5, 7, 8, 11, 15, 16, 20, and 22': 1, 'trisomy 3, 8, 20': 1, 'trisomy for chromosome 20': 1, 'of Chromosome 20': 1, 'Trisomy-20 syndrome': 3, 'duplication of chromosome 20': 1, 'trisomies for chromosome 20': 1, 'trisomy 20 and 21': 1, 'E20ID': 1, 'Heterodisomy of chromosome 20': 1, 'Paternal Isodisomy of Chromosome 20': 1, 'trisomy 7, 14, 18, 20': 1, 'trisomies 20, 16, 15, 10, 6, and 3': 1, 'trisomies of 12, 16, and 20': 1, 'trisomy(8) 20': 1, 'Trisomy 20 Anemia': 1, 'Trisomy 18,20,22': 1, 'trisomy for the long arm of chromosome 20': 1, 'trisomies (3,14,16,19,20 and 21': 1, 'trisomies 18 and 20': 1, 'trisomy 6, 19 and 20': 1, 'trisomy-20 or -8': 1, '18/20 trisomy 8': 1, 'trisomy 7, 16, 8 and 20': 1, 'heterodisomy of chromosome 20': 1, 'UPD of chromosome 20': 1, 'trisomy 20.50': 1, 'r(20) chromosome': 1, 'r(20) chromosome associated': 1, 'gain of chromosome 20': 1, 'trisomies of 5, 7, 8, 11, 15, 16, 20, and 22': 1, 'Chromosom 20': 1, 'trisomy 20(p) syndrome': 1, 'trisomy 7, 8, 16, and 20': 1, 'trisomies 7, 8, 16, and 20': 1, 'trisomy 6, 7, 11, 14, 15, or 20': 1, 'Trisomy-20': 1, 'trisomy 3, 7, and 20': 1, 'trisomy 19 and 20': 1, 'trisomy 2,7,8,20': 1, 'trisomies 20 and 2': 1, 'of chromosome 5 or 20': 1, 'trisomies 1, 3, 15, 20, and 24': 1, 'trisomies 1, 3, 15, 20, 24': 1}
|
trisomy 20
|
Disease
|
MESH:C535374
|
{'Dermatopathia Pigmentosa Reticularis': 9, 'dermatopathia pigmentosa reticularis': 44, 'R-DPR': 1, 'DPR': 65, 'DPR syndromes': 1, 'DPR pigmentation anomaly': 1, 'Dermatopathia pigmentosa reticularis': 26, 'dermatopathia pigmentosa reticularis syndrome AD': 1, 'DPR abnormalities': 1, 'Dermatopathia pigmentosa reticularis AD': 1, 'dermatopathia pigmentoreticularis': 1, 'PR-DPR': 1, 'dermatopathia pigmentosa reticulosis': 1, 'dermatopathias': 1, 'DPR(+)': 1, 'Dermatopathia cyanotica Rost': 1, 'Dystrophia reticularis laminae pigmentosa': 1, 'Dermatopathia pigmentosa reticularis hyperkeratotica et mutilans': 1, 'Osteo-Dermatopathia Hypertrophicans': 1, 'DPR syndrome': 1, 'dermopathia pigmentosa reticularis': 1, 'Osteo-dermatopathia hypertroficans': 1, 'DPR Pesticide': 1}
|
DPR
|
Disease
|
MESH:C535375
|
{'Ullrich-Fremerey-Dohna-Francois syndrome': 2, 'FRANCOIS': 2, "Francois' langurs": 3, "Francois' langur": 4, 'Francois de Meyronnes OFM': 1, 'Fraser-Francois syndrome': 3, 'Francois syndrome': 17, 'FRANCOIS GARDY': 1, "Francois' syndrome": 8, 'Francois and Haustrat syndrome': 1, 'Francois-Katz syndrome': 2, 'FXB': 2, 'AFA': 1, 'Hallerman-Streif-Francois syndrome': 1, 'PSF': 1, 'dermochondrocorneal dystrophy': 3, 'DCCD': 1, 'PH.FRANCOIS': 1, 'Jules Francois': 1, 'Francois haab': 1, 'New Francois syndrome': 1, "Vogt's or Francois central corneal clouding": 1, 'Francois-Heglin syndrome': 1, 'Dermochondrocorneal dystrophy': 3, 'PIERRE-FRANCOIS': 1, 'Francois-De Rouck syndrome': 1, 'Francois Syndrome': 1, "Francois' dyscephaly syndrome": 2, "Francois's langur": 1, 'SF': 1, 'Francois disease': 1, 'Dermochondrocorneal Dystrophy': 1, 'Francois dyscephaly syndrome': 1, 'OMIM 221800 Francois syndrome': 1, "Francois' Syndrome": 1, 'Francois-Haustrate syndrome': 1, 'PLSF': 1}
|
Francois syndrome
|
Disease
|
MESH:C535376
|
{'CND': 294, 'Dermoid of the cornea': 2, 'Bilateral corneal hysteresis': 1, 'CND metastasis': 1, 'Munoz-Comet': 1, 'Tisnado-Munoz and Noriega syndrome': 1, 'Dermoid of cornea': 1, 'impairment of cornea': 1, 'CD-CND': 1, 'WM': 2, 'congenital bilateral corneal anesthesia': 1, 'WM Problemas aplicados': 1, 'CND-P': 1, 'CND-PA': 1, 'CND-PB': 1, 'Vazquez': 3, 'MS CND': 1, 'bilateral corneal abnormalities': 1, 'cornea toxicity': 12, 'bilateral corneal panni': 1, 'Bilateral Corneal Panni': 1, 'bilateral corneal verticillata': 1, 'WMPV': 1, '-Munoz': 1, 'BILATERAL CORNEAL': 1, 'inflammatory demyelinating CND syndromes': 1, 'congenital bilateral corneal disorders': 1, 'Cornea Toxicity': 1, 'Bilateral corneal necrosis': 1, 'CND central nervous disease': 1, 'Gastric and bilateral ovarian carcinoma': 1, '-CND': 2, '-Vazquez': 1, 'bilateral corneal deposits': 1, 'cornea impairment': 2, 'cornea dermoid': 1, 'toxicity to the cornea': 3, 'bilateral corneal deficiency': 1, 'Munoz-Elpinosa L': 1, 'bilateral corneal haze': 2, 'bilateral corneal enlargement': 1, 'bilateral corneal pathology': 1, 'CND demyelination': 1, 'bilateral corneal disorder': 1, 'CND-': 1, 'NC-CND': 1, 'CND_1B': 1, 'Munoz': 1, 'dermoids of the cornea and': 1, 'Bilateral hereditary corneal dermoid': 1, 'CND@PPF': 1, 'Cornea verticillataHypertensionCoronary artery diseaseLVH': 1, 'central nervous system (CND) injury': 1, 'Dermoid, ocular (H) Cornea': 1, 'bilateral corneal opacit': 1, 'bilateral corneal anesthesia': 1, 'CND 14': 1, 'Dermoid tumor of the cornea': 1, 'bilateral corneal condition': 1, 'impaired cornea': 1, 'Cornea dermoids': 1, 'CND_': 1, 'cornea toxicities': 1, 'bilateral corneal affection': 1, 'bilateral corneal involvement': 1, 'ocular and cornea impairment': 1}
|
CND
|
Disease
|
MESH:C535377
|
{'EB': 2207, 'pa': 78, 'Pa': 333, 'PAs': 2230, 'EB-CE': 1, 'ECe': 1, 'JEB-PA': 23, 'junctional epidermolysis bullosa with pyloric atresia': 18, 'PA-JEB': 23, 'CMV-Pa': 1, 'Pas de lesions surrenaliennes': 1, 'pa-disease': 1, 'nyes pas': 1, 'Eb': 52, 'faux pas': 24, 'TFEB': 6, 'junctional EB': 13, 'Carmi syndrome': 15, 'pa maladi dokte': 2, 'Pandemic Pa': 1, 'double PAs': 1, 'DPA': 1, 'EB virus': 47, 'midline PAs': 3, 'PE': 1, 'Pa. striatulus': 1, 'mKhris-pa': 2, 'Junctional epidermolysis bullosa with pyloric atresia': 8, 'ectopic PAs': 2, 'PAs of the': 3, 'EBs': 75, 'Pa-MAP': 2, 'Pa or Pl': 1, 'Paing': 4, 'pA-MN': 3, 'Epidermolysis bullosa with pyloric atresia': 9, 'EB-PA': 21, 'EB thalassaemia': 1, 'Faux pas': 9, 'Faux Pas': 12, 'HPAE-EB': 1, 'EB-AS': 1, 'EB-': 7, 'EB- problems': 1, 'EB-Problems': 1, 'FPRT': 1, 'JEB with pyloric atresia': 3, 'Pas': 83, 'PaS': 26, 'TFEB deficiency': 2, 'EB-VAHS': 1, 'EB,': 1, 'epidermolysis bullosa with PA': 1, 'ebs': 2, 'carcinoma ex PAs': 1, 'CXPA': 1, 'gastrointestinal aplasia': 1, '-I PAs-WSe2': 1, 'paing': 6, 'n.pa_drevoca': 1, 'Carmi Syndrome': 8, 'EB-virus': 2, 'pyloric atresia and epidermolysis bullosa': 1, 'FPAs': 1, 'autoimmune & EB virus': 1, 'ESBL-Eb': 3, 'sporadic PAs': 1, 'Pa.': 26, 'neonatal isolated Carmi syndrome': 1, 'QL.pa': 2, 'Pa Ping': 1, '-Pa': 8, 'Pa-c': 1, 'Pa-': 7, 'Pa- tients': 2, 'pAED': 1, 'EB-MI': 1, 'Pa. decorus': 1, 'junctional epidermolysis bullosa-pyloric atresia': 1, 'PAEDs': 4, 'EBs Malformation': 1, '-pA': 1, 'pa-llar dislocation': 1, 'Eb.19': 1, 'ESBL-EB': 5, 'EBS-PA': 1, 'EBS with pyloric atresia': 1, 'social faux pas': 5, '-PAs': 4, 'EEC': 2, 'EB-5': 1, 'FP': 3, 'Pa infection': 11, 'EB symptom': 1, 'TFEB RCCs': 1, 'Pyloric atresia-junctional epidermolysis bullosa syndrome': 4, 'An-chan-pa': 2, 'Ueang-chan-pa': 1, "Maxil tib'eb": 1, 'A&Eb': 1, 'EBM': 1, 'AB-EB': 1, 'extra-cerebellar midline PAs': 1, 'eb': 4, '3GCR-EB': 1, 'ESBL-P Eb': 1, 'EB EB': 1, 'EB-Vit': 1, 'Junctional EB': 3, 'benign PAs': 2, 'L pa': 1, 'pa bensinmacken nar han var ledig': 1, 'orthostatic PAs': 1, 'pa-': 2, 'nonsyndromic classic EB': 1, 'nonsyndromic EB': 1, 'EB with pyloric atresia': 4, 'JEBs': 2, 'EB disorder': 1, 'EB V': 2, 'hypertoni pa': 1, 'EB-BSI': 1, 'EBV': 4, "pas-Volkovich's loch - Frisch": 1, 'EB-MN': 1, 'pa-tients': 2, 'EB-SCC': 1, 'pa l': 1, 'Bartal Carmi': 1, 'pas nervosa': 1, 'hypoplastic PAs': 6, 'FAMDS- EB': 1, 'metaplastic PAs': 1, 'EB-related': 1, 'EB-injury': 1, 'EB-related injuries': 1, 'Oral Hand /pa/ Dur': 1, 'TFEB Rearranged': 1, 'CA-ex-PAs': 2, 'EBEs': 7, 'EbE': 1, 'EbEs': 2, 'nyes pa': 3, 'PA-EB': 1, 'pas': 14, 'Hypoplastic PAs': 2, 'Pyloric Atresia - Epidermolysis Bullosa) Syndrome': 1, 'Pa. boninensis': 1, 'Pa. servulolimai': 1, 'Pa. shannoni': 2, '-da-pa': 1, 'sri-da-pa': 1, 'Pa infections': 3, 'Junctional epidermolysis bullosa associated with pyloric atresia': 2, 'Pa.D': 1, 'fPA': 1, 'I-EB': 1, 'NPC': 2, 'nolink-eb': 1, ', ne pas nuire': 1, 'NIHTB-EBs': 1, 'Pa) infections': 1, 'pAS': 1, 'prolactin PAs': 1, 'Pa. DSPp': 1, 'cerebellar PAs': 5, 'non-cerebellar PAs': 1, 'Junctional epidermolysis bullosa-pyloric atresia syndrome': 2, 'EB palm': 1, 'EB-106': 1, 'pA': 24, 'Pas syndrome hemorragique': 1, '-Eb': 4, 'renal_pa': 1, 'EB simplex': 12, 'pa tient': 1, 'EB-II': 1, 'r-Pa': 1, 'TFEB abnormalities': 1, 'CR-Pa': 2, 'EB Virus': 6, 'Pa. chlamydospore': 1, 'In(2)eb': 1, 'Faux-Pas': 3, 'pourquoi-pas': 2, 'Pa-ERC': 1, 'Pa O12 infections': 1, 'gland PAs': 2, 'Ca-ex-PAs': 2, '-ex-PAs': 1, 'pA.': 1, "D'abord, ne pas nuire": 1, 'te pa korari': 1, 'Rig-pa': 1, 'EB III': 2, 'junctional form of EB': 1, 'epidermolysis bullosa-pyloric atresia syndrome': 1, 'eB': 3, 'MR': 1, 'Pa-tients': 7, 'aggressive Pas': 1, 'L- and G-PAs': 1, 'EB-VCA': 1, 'GI-EB': 1, '-EB': 3, 'invasive PAs': 2, 'IPA': 1, 'CHESS-PAEDs': 1, 'CHESS-PAEDS': 1, 'MDS-EB': 1, 'jejunoileal junction atresia': 1, 'Pa. involutus': 1, 'Krafft-Ebing': 3, 'NNF-PAs': 1, 'INF-PAs': 1, 'chronic paing': 1, 'EB-V': 1, 'hormone-secreting Pas': 1, 'Valle del Pas': 1, 'EB-thal': 1, 'femoral artery PAs': 1, 'Pa tients': 1, 'benign sporadic PAs': 1, 'nyes pa gsum': 1, 'ebbing': 1, 'PdPV-pa': 1, 'mkhris pa (fire)': 1, 'EB-6m': 1, 'tarda Pas': 1, 'Pa-CC': 1, 'Anaplastic PAs': 1, 'A-PAs': 1, 'anaplastic PAs': 1, 'IS-PAs': 1, 'Pyloric atresia with epidermolysis bullosa (EB) dystrophica': 1, 'EB-like': 1, 'optic pathway Pas': 1, 'EB viraemia': 1, 'calcoaceticus Eb-8': 1, 'calcoaceticus Eb-4': 1, 'EB UTI': 1, 'Pa-kup': 1, 'deficit of faux pas': 1, 'pyloric atresia-junctional epidermolysis bullosa syndrome': 6, 'PA-JEB syndrome': 3, 'MACN-Pa': 1, 't-PAs': 1, 'EB problems': 2, 'PPS PAs': 1, 'pA/H1N1': 2, 'pA(H1N1': 1, 'pA(H1N1)': 1, 'MV-PAs': 1, 'Dogel ebs': 1, 'Pa-3': 1, 'AMDS-EB': 1, 'PRE': 1, 'pa-LN': 1, 'CCPF': 6, 'EB 21': 1, 'Faux Pas deficit': 1, 'WRPH-pa': 1, 'EB FD': 1, 'Pa.C': 1, 'primary EB virus': 1, 'JEB': 8, 'carmi syndrome': 1, 'faux-pas': 1, 'Faux-pas': 2, 'EB-PRS': 1, 'AWPV-Pa': 1, 'pa palate': 1, 'pA-DamID': 2, 'TFEB-tRCCs': 1, 'Pa Dicer syndrome': 1, 'TFEB-DDK': 1, 'Ebbing': 2, 'EBC': 1, 'Pa Leng': 1, 'D-EB': 2, 'Pa-NP': 1, 'congenital gastrointestinal atresia': 4, 'CP-Pa': 2, 'CP-Pa.': 1, 'PAEDS': 1, 'pA&E': 1, 'pA&E.': 1, 'EB II': 3, 'MDS-EB II': 2, 'Faux pas deficits': 1, 'Faux pa': 1, 'pyloric atresia--junctional epidermolysis bullosa': 1, 'PA-JEB) syndrome': 1, 'smen-pas': 1, 'BSM': 2, '-rig-pa': 2, 'Epidermolysis bullosa-pyloric atresia': 1, 'epidermolysis bullosa-pyloric atresia': 1, 'epidermis bullosa-pyloric atresia with obstructive uropathy': 1, 'EB-PA-OU': 2, 'EB-OU': 1, 'EB medicine': 1, 'Pa-pin': 1, 'Lamc2jeb/jeb syndrome': 1, 'jeb': 1, 'FSD+jeb': 1, 'jeb wasting': 1, 'Lamc2jeb/jeb disease': 2, 'lkugs pa': 1, 'epidermolysis bullosa with pyloric atresia': 5, 'back paing': 1, 'ROLE OF TFEB': 2, 'CIN-Paeds': 1, 'NFPAs': 1, 'mkhris-pa': 1, 'spinal PAs': 1, 'Gso ba rig pa': 1, "l'Ebola": 1, 'Ebola': 1, 'EB-1A': 1, 'III EB': 1, 'S-EB': 2, 'APZU': 3, 'EB dystrophica': 1, 'UE-EB': 1, 'AE': 1, 'PaTu-T': 1, 'PaTu-S': 1, 'EECs': 1, 'Pa-OG': 1, 'Pa-FL': 1, 'pyloric atresia Non-Herlitz type Dystrophic EB': 1, 'Ebs': 1, 'pyloric atresia-epidermolysis bullosa syndrome': 1, 'pa.': 2, 'SPR': 1, 'I4_Pa': 1, 'EB PROTEINS': 1, 'cha pa foni': 1, "pa.lus'tris": 1, 'CHARACTERISTICS OF PAs': 1, 'Pa Diseases': 1, 'Pa Operative complications': 1, 'epidermolysis bullosa-pyloric atresia-obstructive uropathy': 1, 'pa infections': 1, 'ischemic PAs': 1, 'CaexPA': 1, 'Pa.m': 1, 'EB-CPGs': 1, 'Pyloric atresia with junctional epidermolysis bullosa (PA-JEB) syndrome': 1, 'JEB-pyloric atresia': 1, "patients' treat-ment condition throughout the trial. Pa-tients": 1, 'Impatiensnavicula Eb': 1, 'Impatiensgalactica Eb': 1, 'Impatienshendrikii Eb': 1, 'Impatienslutzii Eb': 1, 'Impatiens navicula Eb': 1, 'EBS': 3, 'Pa. viridiceps': 1, 'Familial PAs': 1, 'Eb and Tzec': 1, 'DPEB': 1, 'D. psuedoobscura EB': 1, 'junctional epidermolysis associated with pyloric atresia': 1, 'electronic faux pas': 1, 'pa-pyracea': 1, 'enlargement of the PAs': 1, 'Nyes-pa': 1, 'Nyes-pa-gSum': 1, 'Pa-Ping': 1, 'EBSL-EB': 1, 'EB-X': 1, 'Leache EB': 1, 'Epidermolysis Bullosa with Pyloric Atresia': 1, 'pa tients': 1, 'Pa kimchi': 1, 'autosomal recessive inherited junctional epidermolysis bullosa with pyloric atresia': 1, 'transcriptional activator transcription factor EB': 1, "Pa'ar": 1, 'Pa. abonnenci 2': 1, 'pa-2000-': 1, 'mkhris pa diseases': 1, 'Hayes EB': 1, 'Pla-ra/pa-daek': 1, '-ra/pa-daek': 1, 'pla-ra/pa-daek': 1, 'junctional epidermolysis bullosa-pyloric atresia syndrome': 2, 'MIA Pa Ca-2': 2, 'Pa I II': 1, 'LC/PAs': 1, 'pathway PAs': 1, 'DTR-Pa': 1, 'Pa-cherry': 1, 'Pa foramina': 1, 'HO-EB': 1, 'Pa. pradobarrientosi': 1, 'TRS': 1, 'Baso-EB': 1, 'EB-like symptoms': 1, 'Pa-1 to -15': 1, 'cavity Pa': 1, 'mkhris pa': 1, 'Mkhris pa': 1, '3 PAs syndrome': 1, 'Pa Injury': 1, 'ACTH-PAs': 2, 'Pas membranacea': 1, 'Pa Fracture': 1, 'EB VCA': 1, 'eBE': 1, 'myxoid PAs': 1, 'ACC - PA': 1, 'C-PAs': 1, 'EBBING': 1, 'TPL': 1, 'EB antigenemia': 1, "moyen n'est pas": 1, 'SG-PAs': 1, 'Instances of faux pas': 1, 'P-EB': 1, 't-Pa.': 1, 'EB with PA': 1, 'pyloric atresia with aplasia cutis congenita': 1, 'kache pa gen': 1, 'pyloric atresia-junctional epidermolysis bullosa': 1, 'EB +': 1, 'DSM-IV Non-EB': 1, 'EB-VSTC': 1, 'EB-S': 1, 'epidermylosis bullosa': 1, 'Pa Complications': 1, 'Hyperactive pA': 1, 'GOAL': 1, 'LPK': 1, 'live EB': 1, 'Live EB': 1, 'Pas de syndrome inflammatoire': 1, 'mkhris-pa (bile) disorders': 1, '-ba-rig-pa': 1, 'PF PAs': 1, 'Ex-PAs': 1, 'Paed': 1, 'impaired faux-pas': 1, 'EB lesions': 1, 'EBs infection': 1, '-Pa.': 1, 'nH-JEB': 1, 'pa-ra-carcinoma': 1, 'atrial EBs': 1, 'Pa-type 1': 1, 'Pa-type 2': 1, 'Pa-LNM': 1, 'PAs of': 2, 'TFEB AS': 1, 'Hyperemic Pa': 1, 'S-Pa': 1, 'Pa-3-9': 1, 'Pa-2-4': 1, 'Pa-3-': 1, 'Pa-2-': 1, 'Pa-2': 1, 'Pa-2-4-': 1, 'Pa-2-8-1': 1, 'Pa-1-4': 1, 'Pa-2-9-': 1, 'Pa-2-5': 1, 'RPAs': 1, 'Pas-a-pas': 1, 'heart EBs': 1, 'Hypercellular PAs': 1, 'EB-Pyloric-Atresia': 1, 'Epidermolysis-Bullosa pyloric-atresia': 1, 'Pas III Disorder': 1, 'MIA Pa-Ca': 1, "Pas'": 1, 'Pa,': 1, 'Sporadic PAs': 1, 'thrombosis of the PAs': 1, 'PCS': 1, 'EB HLH': 1, 'EBPA': 1, 'junctional epidermolysis bullosa associated with pyloric atresia': 1, 'EB ,': 1, 'CR-Pa.': 1, 'holocord PAs': 1, 'BAP-EB': 1, 'Craniofacial PAs': 1, 'craniofacial PAs': 1, 'GH-PAs': 1, 'EB-N': 2, 'NIHTB-EB': 1, 'Pa ca': 1, 'EB simplex (': 1, 'PAEDS.HOD': 1, 'Pa. hyposidrae': 2, 'Pa.hyposidraevs.Pr.immunis': 1, 'mEB': 1, 'Pa.koratensis': 1, 'paed': 1, 'tMDS-EB': 1, 'Pa-COV19': 1, 'EB-PA-ACC': 1, 'Hap-pas-Hapi': 1, 'Pa dong': 1, 'Tam pa-dong': 1, 'ex-PAs': 2, 'der Pas': 1, 'Ves.Pa.': 1, 'EB-Z': 1, "pa'atuberculosis": 1, 'axS-pA': 1, 'u-PAs': 1, 'enlargement of PAs': 1, '4HNE-PAs': 1, "Ceci n'est pas une pipe": 1, 'Pa. Ps': 1, 'mangel pa energi': 1, 'pa-anga': 1, 'EB injury': 1, 'pA/': 1, '-Pa injury': 1, 'Pa injury': 1, 'eB-': 1, 'Pa-NET': 1, '-oral PAs': 1, 'EB-Pyloric Atresia': 1, 'Myelodysplasia Pa-tientNo': 1, 'Pas infection': 1, 'EB-thalassaemics': 1, 'JEB plus pyloric atresia': 1, "Tonga Pa'anga": 1, "Pa'anga": 1, 'TOP': 1, 'Chipatala cha pa Foni': 1, 'Chipatala cha pa': 1, 'cha pa': 1, 'Pa.c': 1, 'Pa-BSI': 1, 'PAs 1 and 4': 1}
|
PAs
|
Disease
|
MESH:C535378
|
{'Distal arthrogryposis': 91, 'distal arthrogryposis type 1': 28, 'distal arthrogryposis': 333, 'DA': 91, 'Distal arthrogryposis type 1': 10, 'AMC- Distal arthrogryposis 1': 1, 'type I distal arthrogryposis': 2, 'distal arthrogryposis type-1': 2, 'DA syndromes': 12, 'Distal Arthrogryposis (DA) syndromes': 1, 'distal arthrogryposis (DA) syndromes': 8, 'Distal Arthrogryposis': 21, 'distal arthrogryposis syndromes': 29, 'Arthrogryposis distal type 1': 1, 'autosomal dominant distal arthrogryposis': 6, 'Distal arthrogryposis type I': 4, 'DA type 1': 10, 'Distal Arthrogryposis Type 1': 1, 'distal arthrogryposis type I.': 4, 'distal arthrogryposis syndrome': 9, 'Distal arthrogryposis andweakness': 1, 'distal arthrogryposis type I and IX': 1, 'distal arthrogryposis III': 1, 'distal arthrogryposis type I': 6, 'dominant distal arthrogryposis type 1': 1, 'autosomal dominant distal arthrogryposis type 1': 2, 'DA1': 12, 'arthrogryposis multiplex congenita type I': 1, 'distal arthrogryposis (': 3, 'DA) syndromes': 6, 'distal arthrogryposis deformities': 1, 'DAs': 3, 'proximal/distal arthrogryposis': 1, 'autosomal-dominant distal arthrogryposis': 1, 'arthrogryposis distal type 1': 1, 'distal arthrogryposis type 1 myopathy': 1, 'distal arthrogryposis multiplex congenita': 4, 'myopathic distal arthrogryposis': 3, 'Distal arthrogryposis (DA) syndromes': 1, 'autosomal dominant DA type 1': 1, 'distal arthrogryposis of the hands': 2, 'AMC Type I A4': 1, 'AMC Type I-III': 1, 'AMC Type I': 1, 'AMC Type I Amyoplasia': 1, 'AMC Type I.': 1, 'Distal Arthrogryposis-1': 2, 'Gastrocnemius Distal arthrogryposis': 1, 'Distal Arthrogryposis type-1': 1, 'DA-1': 3, 'type 1 arthrogryposis': 2, 'DAS': 1, 'Distal arthrogryposis syndrome': 1, 'distal arthrogryposis (DA) syndrome': 1, 'DA type I': 2, 'DA I': 1, 'Distal arthrogryposis (': 1, 'distal Effmann type 1': 1, 'distal) arthrogryposis': 1, 'type I arthrogryposis multiplex congenita': 2, 'AM) I': 1, 'distal arthrogryposis 1': 1, 'distal arthrogryposis in hands': 1, 'AD distal arthrogryposis type 1': 1, 'distal arthrogryposis is type 1': 1, 'Distal arthrogryposis syndromes': 2, 'distal arthrogryposis (type 1': 1, 'DA type-1': 1, 'arthrogryposis multiplex congenita type I.': 2, 'Dominant distal arthrogryposis': 1, 'DA syndrome': 1, 'distal arthrogryposis, type 1': 1, 'distal arthrogryposis multiplex congenita type 5D': 1, 'Distal AMC Type 5D': 1, 'Distal arthrogryposis multiplex congenita': 1, 'type 1 distal arthrogryposis': 2, 'distal and syndromic arthrogryposis': 2, 'distal arthrogryposis multiplex': 1, 'isolated distal arthrogryposis': 1, 'muscle-distal arthrogryposis type 1': 1, 'AMC type 1': 1, 'AMC Type 1': 1, 'distal arthrogryposis-1': 2, 'autosomal dominant DA syndromes': 1, 'dominant DA syndromes': 1, 'Distal arthrogryposis of the handsBilateral': 1, 'Distal arthrogryposis of the': 1, 'distal arthrogryposis phenotype': 1, 'Arthrogryposis multiplex congenita, distal, type 1': 1, 'autosomal dominant distal arthrogryposis multiplex congenita': 1, 'Distal arthrogryposis multiplex': 1, 'arthrogryposis type 1': 1}
|
distal arthrogryposis
|
Disease
|
MESH:C535379
|
{'congenital distal arthrogryposis': 9, 'thrombotic involvement of major': 1, 'distal arthrogryposis type IIA': 1, 'facial and hand involvement': 1, 'facial or hand involvement': 1, 'Familial distal arthrogryposis': 1, 'type II distal arthrogryposis': 2, 'autosomal dominant type II distal arthrogryposis': 1, 'Arthrogryposis multiplex congenita distal type II': 1, 'arthrogryposis multiplex congenita distal type II': 1, 'Muscle-Related Distal Arthrogryposis': 1, 'major vessel involvement': 1, 'MAJOR ISSUES INVOLVED': 1, 'Distal Arthrogryposis Type 2': 3, 'DA type1 and 2': 1, 'distal hand involvement': 1, 'inflammatory hand involvement': 1, 'Neer type 2 distal clavicular fractures': 1, '/feet/joints involvement': 1, 'hand/feet/joint involvement': 1, 'distal arthrogryposis (DAs) disease': 1, 'Familial distal arthrogryposis type I.': 1, 'arthrogryposis, distal, type 2B3': 1, 'distal arthrogryposis type 2': 4, 'DA type 2': 2, 'distal arthrogryposis type 2B2': 1, 'autosomal dominant distal arthrogryposis type 2B2': 1, 'distal arthrogryposis type 2B3': 1, 'Distal arthrogryposis type II': 1, 'Fractures involving hands and feet': 1, 'hand-feet involvement': 1, 'distal arthrogryposis type 5I': 1, 'asymmetrical involvement of hands and feet': 1, 'DA types 1 and 2': 1, 'DA type 2 syndrome': 1, 'Functional disabilities involving hands and feet': 1, 'DA II': 1, 'hand vascular involvement': 2, 'malformations involving hands, feet, and the gut': 1, 'distal arthrogryposis types 1 and 2': 1, 'major organ involvement': 2, 'Hand and feet involvement': 1, 'symmetrical involvement of hands and feet': 1, 'dorsal involvement of hands and feet': 1, 'arthrogryposis type 1 or type 2': 1, 'Hand vascular involvement': 1, 'symmetrical joints involvement of the hands and feet': 1, 'joint contractures involving hands and feet': 1, 'Multiplex 2': 2, 'distal arthrogryposis types 1b and 2': 1, 'DA-2': 1, 'Distal Arthrogryposis-2': 1, 'DA type-2': 1, 'MOI.Conclusion': 1, 'MOI.Results': 1, 'feet involvement': 1, 'feet and hand involvement': 1, 'hip and hand involvement': 1, 'Major nerve involvement': 1, 'extra-cranial major vessel involvement': 1, 'osseous involvement of the hands and feet': 1, ', 2, 3 Arthrogryposis multiplex congenita': 1, 'MVI': 2, 'major vascular involvement': 2, 'DA2': 1, 'Arthrogryposis Syne-2 Nesprin 2': 1, 'DA type II': 1, 'DA 2': 1, 'Major Organ Involvement': 1, 'MOI': 1, 'type 2 distal arthrogryposis': 1, 'Asymmetric involvement of the hands and feet': 1}
|
congenital distal arthrogryposis
|
Disease
|
MESH:C535380
|
{'X-linked Infantile Spinal Muscular Atrophy': 2, 'X-linked spinal muscular atrophy': 28, 'X-linked arthrogryposis': 8, 'X-linked SMA': 14, 'X-Linked Spinal Muscular Atrophy': 2, 'XL-SMA': 14, 'X-linked lethal': 5, 'X-linked infantile spinal muscular atrophy': 17, 'XLSMA': 1, 'I 2': 3, 'X-linked infantile SMA': 8, 'SMAX2': 7, '2-I': 2, 'PECS I and 2': 1, 'Xfm': 1, 'I-2': 12, 'distal X-linked distal motor neuropathy': 1, 'Spinal 2': 3, 'I-SPY 2': 7, 'X-linked lethals': 9, 'XL-SMA disease': 2, 'X-linked Spinal Muscular Atrophy': 2, 'X-linked Arthrogryposis Multiplex Congenita (AMC) disorder': 2, 'X-linked AMC disorder': 1, 'X-linked muscular dystrophic': 8, 'I and 2': 3, 'X-linked lethality': 4, 'MCI': 1, 'CIN I-2': 1, 'PID I-2': 2, 'XFM': 1, 'I-X': 5, 'PP-I-2': 1, 'I(2)Rs': 1, 'TGr I, 2': 1, 'I to X': 1, 'X-linked lethal muscular dystrophy': 1, 'MED.I.2': 1, 'I-X.': 2, 'X-linked arthrogryposis Type I': 1, 'I.2-DD': 1, 'X-linked muscular dystrophinopathies': 1, 'A-I Munster-2': 1, 'CAD I (2)': 1, 'I(2) and Se deficiency': 1, 'I(2) deficiency': 1, 'X-linked muscular atrophy': 1, 'linked C-telopeptide of type I collage': 1, 'X-linked spinal and bulbal muscular atrophy': 1, 'X-linked lethal disorder of infancy': 1, '/I:2': 1, 'type I arthrogryposis': 2, 'I-Valex-1 & 2': 1, 'H-2-I': 1, '2 XL-SMA': 1, 'CHF(2) I': 1, 'X linked proliferative disease type I': 1, 'X-linked spinal muscular atrophy disease': 1, 'X-linked spinal muscular atrophy (SMA) disease': 1, 'Fiebig I/2)': 1, 'Reabilitacao muscular 2': 1, '-LINKED LETHAL': 1, 'XLH01-I:2': 1, 'I-2-breakingFol': 1, 'X-linked distal neuropathy': 1, 'X-linked spinal muscular atrophy type 2': 1, 'GI-2': 1, 'X-RAY-INDUCED LETHALS': 1, 'X-linked AMC': 1, 'Muscular 2': 1, 'GOLD I 2': 1, 'X-linked lethal traits': 1, 'X-linked spinobular muscular atrophy': 1, 'I X-linked': 1, 'I X-linked miRNA': 1, 'X-linked congenital disorders of glycosylation type I': 1, 'I and 2 errors': 1, '-I-2': 1, 'IVS I-2': 1, 'MIBI': 1, 'X chromosome-linked spinal muscular atrophy': 1, 'CM.I.2': 1, 'Xl-SMA': 1, 'X-Linked Infantile Spinal Muscular Atrophy': 1, 'PIN-I and -2': 1, 'SC-SMA-2-2': 1, 'I or 2': 1, 'pStage I 2': 1, 'X-linked late zygotic lethals': 1, 'hypertrophic collagens, type I and X': 1, 'Congenital Distal Arthrogryposis Type I': 1, 'Congenital Distal Arthrogryposis Type I.': 1, 'Azione I.2': 1, 'GI.2': 2, 'I-type 2-5': 1, 'A.I.2': 1, 'muscular 2': 1, 'Spinal muscular atrophy, X-linked 2': 1, 'X-Linked Spinal Muscular Atrophy 2': 2, 'CO 2 I': 1, 'spinal metastases1,2': 1, 'IVS-I-2': 1, 'lethal X-linked SMA with arthrogryposis and congenital fractures': 1, 'X linked lethal': 1, 'X linked lethal infantile disorder': 1, 'cerebral (2) and spinal (1) vascular pathology': 1, 'X-linked infantile spinal-muscular atrophy': 1, 'I 2': 1, 'X-linked lethal syndrome': 1, 'A-I-2': 2, 'X-linked spinal muscular atrophy 2': 1, 'X-linked congenital disorders of glycosylation type I.': 1, 'I.2': 1, 'type I-X': 1, 'A-I-Munster-2': 1, 'CIN I- 2': 1, 'TNM I 2': 1, 'I-BROMONAPHTHOL-2': 1, 'X-linked spinal tubular muscular atrophy': 1, 'I-12CMS(2)': 1, 'X-linked lethal muscular disorder': 1, 'X-linked bulvo-spinal muscular atrophy': 1, 'X-linked infantile lethal Mendelian disorder': 1, 'X-RAY-INDUCED LETHALITY': 1, 'spinal deformity;2': 1, 'spinal muscular atrophy X-linked 2': 1, 'CIP': 1, 'Type I X-LD': 1, 'X-type and Z-type syndrome': 1, 'I, I1/2, or': 1, 'NYHAa I 2': 1, 'estatistica I 2 foram calculadas': 1, 'I-2_CH': 1, 'H.I.2': 1, 'QPP 2 I': 1, 'I. 2-BIPHENYLYLPENICILLINS': 1, 'OB 2"I': 1, 'lymphomaRow 2:"I': 1, 'X-linked CDG-I': 1, 'I-LOVE-IT 2': 1}
|
X-linked spinal muscular atrophy
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.